Polar Biology

, Volume 40, Issue 11, pp 2239–2252 | Cite as

Integrative redescription of a common Arctic water bear Pilatobius recamieri (Richters, 1911)

  • Piotr Gąsiorek
  • Krzysztof Zawierucha
  • Daniel Stec
  • Łukasz Michalczyk
Open Access
Original Paper
  • 317 Downloads

Abstract

Tardigrada are a group of microscopic metazoans that inhabit a variety of ecosystems throughout the world, including polar regions, where they are a constant element of microfauna with densities exceeding hundreds of individuals per gram of dry plant material. However, despite a long history of research and their ubiquity in tundra ecosystems, the majority of tardigrade species have limited and outdated diagnoses. One such example is Pilatobius recamieri, a common tardigrade that is widely distributed in the Arctic. The aim of this study is to redescribe this species using new material from the type locality and tools of integrative taxonomy, viz. by combining classical imaging and morphometry by light microscopy and scanning electron microscopy imaging with DNA sequencing of four markers with various mutation rates: three nuclear (18S rRNA, 28S rRNA, and ITS-2) and one mitochondrial (COI). The sequences of the three latter markers are also the first to be presented for the genus Pilatobius. This study therefore provides the first necessary step towards the verification of the geographic range of P. recamieri, which is currently assumed to be very broad. A detailed comparison of P. recamieri with Pilatobius secchii (Bertolani and Rebecchi, 1996) from Italy revealed no morphological or morphometric differences between the two species, thus we designate P. secchii as a nomen inquirendum until molecular data for the taxon become available. Finally, we propose to replace the term “lunula” in the superfamilies Hypsibioidea and Isohypsibioidea with the more appropriate “pseudolunula” to differentiate it from the true lunula in other parachelans.

Keywords

Biodiversity Hypsibiidae Microfauna Pilatobius secchii nom. inq. Svalbard Tardigrada 

Introduction

The tardigrades, also known as water bears, are common micrometazoans, usually less than 1 mm in length. They are distributed across the globe, inhabiting a great majority of terrestrial (soil, plants, and leaf litter), freshwater, and marine ecosystems (plants, coastal and deep-oceanic sediments), from tropical and temperate regions to the highest mountain peaks, glaciers, and polar deserts (e.g., Nelson et al. 2015). They are widely known for their cryptobiotic capabilities, thanks to which they can withstand extreme conditions such as low and high temperatures, desiccation, and high ultraviolet radiation doses (e.g. Guidetti et al. 2012). These adaptations allow tardigrades to dwell in harsh environmental conditions, including those shaping polar ecosystems (McInnes and Ellis-Evans 1990; Altiero et al. 2015; Zawierucha et al. 2015). The Svalbard Archipelago is located in the European part of the Arctic and is one of the best investigated polar areas in terms of tardigrade fauna. Studies of Svalbardian tardigrades began in the late 19th century (Scourfield 1897) and have been continued by a number of researchers up to the present day (e.g., Węglarska 1965; Dastych 1985; Maucci 1996; Tumanov 2007; Zawierucha et al. 2015, 2016a).

Because of tardigrade ubiquity, interest in the ecology of Arctic tardigrades has increased during the last decade (Coulson and Midgley 2012; Johansson et al. 2013; Zawierucha et al. 2016a, b). Since species are considered the basic units of ecosystems (e.g., Callaghan et al. 2004), correct species identification is crucial to ecological studies. This is especially important in the face of the impact of climate change on Arctic biota and to understand the biogeographical patterns of life affected by these shifts, as some studies suggest that species alter their distributions rather than evolve in response to environmental changes influenced by global warming (Callaghan et al. 2004; Hodkinson 2013). However, tardigrade taxonomy is based largely on morphological and morphometric traits (e.g., see Michalczyk and Kaczmarek 2013; Kosztyła et al. 2016), and many species descriptions are incomplete and grossly outdated, with molecular data being available for only a small fraction of species (e.g., see Bertolani et al. 2014). One such species with a poor diagnosis is Pilatobius recamieri (Richters, 1911), a limnoterrestrial eutardigrade described from and frequently found in the Svalbard Archipelago (Richters 1911; Zawierucha et al. 2016a, b). The species was subsequently reported from other Arctic localities as well as from Europe, Asia, and North and South America (Ramazzotti and Maucci 1983). However, given the limited original description, the exact geographic range of the species cannot be confidently outlined. For example, a recent study by Gąsiorek et al. (2016) on Mesocrista spitzbergensis (Richters, 1903), a tardigrade originally described from Spitsbergen and subsequently reported from numerous Holarctic localities, suggested that the species might have a much more limited geographic range than was previously assumed. Detailed morphological and molecular analyses showed that specimens collected from several European localities represented, in fact, a new species, Mesocrista revelata Gąsiorek et al., 2016. Thus, it is plausible that a modern redescription of P. recamieri could also reveal more than one species hiding under a single name, thereby limiting the geographic range of P. recamieri.

In this paper, we integratively redescribe P. recamieri from its terra typica in the Svalbard Archipelago. In addition to classic morphometry and imaging by light microscopy, we also reveal fine morphological traits by using scanning electron microscopy and provide sequences for three nuclear and one mitochondrial DNA marker. We also analyzed paratypes of Pilatobius secchii (Bertolani and Rebecchi, 1996), a species that is morphologically most similar to P. recamieri. It is hoped that this study, by setting a reference point for future records of P. recamieri, will enable a verification of the true geographic range of the species.

Materials and methods

Samples and specimens

We analyzed a total of 48 individuals of P. recamieri from a neotypic population in a sample collected from terra typica by the second author on the 29th July 2013 (79°50′N, 11°18′E; 40 m above sea level; Fuglesangen, Svalbard, Norway; tundra, moss from rock; see Fig. 1a, b). The sample was processed following a protocol described in detail in Stec et al. (2015). Isolated specimens were divided into four groups, destined for different analyses: (i) imaging of entire individuals by light microscopy (external and internal morphology and morphometry; 35 specimens), (ii) imaging of entire individuals by scanning electron microscopy (SEM, fine external morphology; 5 specimens), (iii) buccopharyngeal apparatus extraction and imaging by SEM (fine morphology of the apparatus; 4 specimens), and (iv) DNA extraction (including new molecular data for Pilatobius; 4 specimens).
Fig. 1

Study area: a Svalbard Archipelago; b northern Spitsbergen and nearby islands, with Fuglesangen in a close-up (inset). Scale bars in km

Additionally, we examined by light microscopy four paratypes of P. secchii mounted in polyvinyl lactophenol, kindly loaned to us by Lorena Rebecchi (University of Modena and Reggio Emilia, Italy).

Microscopy and imaging

Specimens for light microscopy and morphometry were mounted on microscope slides in a small drop of Hoyer’s medium prepared according to Morek et al. (2016) and examined under a Nikon Eclipse 50i phase-contrast microscope (PCM) associated with a Nikon Digital Sight DS-L2 digital camera. Specimens for SEM imaging were prepared according to Stec et al. (2015) and examined under high vacuum in a Versa 3D DualBeam SEM at the ATOMIN facility of Jagiellonian University. Buccopharyngeal apparatuses were extracted following a protocol by Eibye-Jacobsen (2001) with modifications described thoroughly in Gąsiorek et al. (2016), and examined under high vacuum in a Versa 3D DualBeam SEM at the ATOMIN facility of Jagiellonian University. All figures were assembled in Corel Photo-Paint X6 (version 16.4.1.1281). For deep structures that could not be fully focused in a single photograph, a series of 2–18 images were taken every ca. 0.2 μm then assembled into a single deep-focus image (using Corel).

Morphometrics

Sample size for morphometrics was chosen following recommendations by Stec et al. (2016). All measurements are given in micrometers (μm) and were performed under PCM using Nikon Digital Sight DS-L2 software. Structures were measured only if their orientations were suitable. Body length was measured from the anterior to the posterior end of the body, excluding the hind legs. Macroplacoid length sequence is given according to Kaczmarek et al. (2014). Claws were measured following Beasley et al. (2008). Buccopharyngeal tubes were measured following Pilato and Binda (1999). The pt ratio is the ratio of the length of a given structure to the length of the buccal tube, expressed as a percentage (Pilato 1981), presented herein in italics. Morphometric data were handled using the “Parachela” version 1.2 template available from the Tardigrada Register (Michalczyk and Kaczmarek 2013).

Establishing the neotype series

Given that the vast majority of the Richters’ collection no longer exists (Dastych 1991), we designated all examined individuals as the neotype series.

Genotyping

DNA was extracted from individual animals following a Chelex® 100 resin (Bio-Rad) extraction method by Casquet et al. (2012) with modifications described in detail in Stec et al. (2015). We attempted to sequence four DNA fragments differing in effective mutation rate: the small and large ribosome subunit (18S rRNA and 28S rRNA, respectively), nuclear markers typically used for phylogenetic inference at high taxonomic level (e.g., Bertolani et al. 2014); the internal transcribed spacer (ITS-2), a noncoding nuclear fragment with high evolution rate, suitable for intraspecific comparisons as well as comparisons between closely related species (e.g., Gąsiorek et al. 2016); and finally, the cytochrome oxidase subunit I (COI), a protein-coding mitochondrial marker, widely used as a standard barcode gene with intermediate effective mutation rate (e.g., Bertolani et al. 2011). All fragments were amplified and sequenced according to the protocols described in Stec et al. (2015); primers and original references for specific polymerase chain reaction (PCR) programs are listed in Table 1. Sequencing products were read with the ABI 3130xl sequencer at the Molecular Ecology Lab, Institute of Environmental Sciences of Jagiellonian University, Kraków, Poland. Sequences were processed in BioEdit version 7.2.5 (Hall 1997).
Table 1

Primers and references for specific protocols for amplification of the four DNA fragments sequenced in the study

DNA fragment

Primer name

Primer direction

Primer sequence (5′–3′)

Primer source

PCR programa

18S rRNA

SSU01_F

Forward

AACCTGGTTGATCCTGCCAGT

Sands et al. (2008)

Zeller (2010)

SSU82_R

Reverse

TGATCCTTCTGCAGGTTCACCTAC

Sands et al. (2008)

28S rRNA

28SF0001

Forward

ACCCVCYNAATTTAAGCATAT

Mironov et al. (2012)

Mironov et al. (2012)

28SR0990

Reverse

CCTTGGTCCGTGTTTCAAGAC

Mironov et al. (2012)

COI

LCO1490

Forward

GGTCAACAAATCATAAAGATATTGG

Folmer et al. (1994)

Michalczyk et al. (2012)

HCO2198

Reverse

TAAACTTCAGGGTGACCAAAAAATCA

Folmer et al. (1994)

ITS-2

ITS3

Forward

GCATCGATGAAGAACGCAGC

White et al. (1990)

Wełnicz et al. (2011)

ITS4

Reverse

TCCTCCGCTTATTGATATGC

White et al. (1990)

aAll PCR programs are also provided in Stec et al. (2015)

Genetic distances

Given that our 28S rRNA, ITS-2, and COI sequences are the first molecular data for the subfamily Pilatobiinae, we could use only the 18S rRNA marker for genetic delineation of P. recamieri. We used all published 18S rRNA sequences for Pilatobius available from GenBank, i.e., Pilatobius nodulosus (Ramazzotti, 1957) HQ604934, Pilatobius patanei (Binda and Pilato, 1971) HQ604935–6, and Pilatobius ramazzottii (Robotti, 1970) HQ604939 (all by Bertolani et al. 2014). Sequences were aligned using the ClustalW Multiple Alignment tool (Thompson et al. 1994) implemented in BioEdit. The aligned sequences were then trimmed to 777 bp. Uncorrected pairwise distances were calculated using MEGA6 (Tamura et al. 2013).

Data repository

The raw data underlying the redescription of P. recamieri are deposited in the Tardigrada Register (Michalczyk and Kaczmarek 2013) under www.tardigrada.net/register/0036.htm. DNA sequences were submitted to GenBank (www.ncbi.nlm.nih.gov/genbank; accession numbers KX347526–31).

Results

Taxonomic account of the species

Phylum: Tardigrada Doyère, 1840

Class: Eutardigrada Richters, 1926

Order: Parachela Schuster, Nelson, Grigarick and Christensen, 1980

Superfamily: Hypsibioidea Pilato, 1969 (in Marley et al. 2011)

Family: Hypsibiidae Pilato, 1969

Subfamily: Pilatobiinae Bertolani, Guidetti, Marchioro, Altiero, Rebecchi and Cesari, 2014

Genus: Pilatobius Bertolani, Guidetti, Marchioro, Altiero, Rebecchi and Cesari, 2014

Pilatobius recamieri (Richters, 1911)

Diphascon recamieri; terra typica: Spitsbergen, Advent Fjord (ca. 78°14′N, 15°36′E), Hopen (ca. 76°34′N, 25°13′E); Richters (1911)

Hypsibius (Diphascon) recamieri; Spitsbergen; Marcus (1936)

H. (D.) recamieri; Spitsbergen, Hornsund Fjord: Ariekammen (ca. 77°00′N, 15°32′E), Rotjesfjellet (ca. 77°00′N; 15°24′E), Torbjørnsenfjellet (ca. 77°02′N, 15°18′E); Węglarska (1965)

D. recamieri; Spitsbergen, Hornsund Fjord: Tsjebysjovfjellet (ca. 76°56′N, 15°59′E) and Ariekammen, Albert I Land—Björnbukta (ca. 79°39′N, 12°24′E), Ny Friesland—Sör Glacier, Åsryggen (ca. 78°54′N; 18°01′E), Atomfjella—Tryggve Glacier (ca. 79°07′N, 16°42′E), Bünsow Land—Ebba Valley (ca. 78°42′N; 16°43′E) and Ebba Glacier (ca. 78°42′N; 16°47′E); Dastych (1985)

D. recamieri; Spitsbergen, Hornsund Fjord: Hyrne Glacier (77°03′N, 16°14′E); De Smet and Van Rompu (1994)

D. recamieri; Spitsbergen, Isbjörnhamna (vicinity of Polish Polar Station, ca. 77°00′N, 15°33′E); Janiec (1996)

D. recamieri; Spitsbergen, Ny Ålesund (ca. 78°55′N, 11°54′E) and Hornsund Fjord (Skrål Pynten); Maucci (1996)

D. recamieri; Hopen; Van Rompu and De Smet (1996)

D. recamieri; Spitsbergen, Rev Valley (ca. 77°01′N, 15°23′E) and Rotjesfjellet (ca. 77°00′N; 15°23′E); Kaczmarek et al. (2012)

D. recamieri; Spitsbergen, Ariekammen (77°00′N, 15°32′E); Zawierucha (2013)

D. recamieri; Prins Karls Forland (78°06′N, 14°51′E) and Edgeøya (78°53′N; 10°28′E); Zawierucha et al. (2013)

Material examined: Neotype and 39 neoparatypes from Fuglesangen, Svalbard, Norway (terra typica). Neotype and 26 neoparatypes (neotype and 21 neoparatypes on slides NO.022.01–4, and 5 neoparatypes on SEM stubs) are deposited together with extracted buccopharyngeal apparatuses in the Institute of Zoology and Biomedical Research, Jagiellonian University, Kraków, Poland; 13 neoparatypes (slides SV. Fug 00.02/1–3, 5–6) are deposited in the Department of Animal Taxonomy and Ecology, Institute of Environmental Biology, Adam Mickiewicz University in Poznań, Poland.

Integrative redescription

Animals (see Table 2for measurements): Body elongated, whitish, covered with smooth cuticle (Fig. 2a). Eyes usually present in live animals, but weakly developed or even absent in some specimens (Fig. 2a). Buccopharyngeal apparatus strongly elongated (Fig. 2b, c). The oral cavity armature, visible only under SEM, consists of 4–5 rows of minute conical teeth located in the rear of the oral cavity (Fig. 3a). Two distinct porous areas on the lateral sides of the crown visible by SEM only. Stylet furcae of the Hypsibius type (Fig. 2c; see Pilato and Binda 2010 for definitions of furca types). A prominent, dorsally placed, oval drop-like thickening on the border between the buccal and the pharyngeal tube present (Figs. 2b, c, 3b, c). Annulation regular, singular dorsally and ventrally, and net-like laterally; i.e., dorsal rings fork on the lateral walls of the tube and join with the neighboring forks into single rings that fork again into ventral rings, creating an interconnected network of thickenings (Figs. 3d, e). A short, very posterior part of the pharyngeal tube without annulation (Fig. 2c, arrowhead). Bulbus with two macroplacoids and a septulum (Fig. 2b). Macroplacoid length sequence 2 < 1; macroplacoids bar-shaped, arranged diagonally (i.e., forming a rhomb). The first macroplacoid with an evident mid-constriction (Fig. 3f), in some specimens the constriction being so strong that the placoid may seem to be divided into two parts (Fig. 3g). The second macroplacoid with a slight subterminal constriction (Fig. 3g). An obvious drop-shaped or round septulum present (Fig. 3f, g). Claws of the Hypsibius type, with widened bases and with apparent accessory points on the primary branches (Fig. 4). Internal and anterior claws with two clear septa dividing the claw into the basal portion, the secondary branch, and the primary branch (Fig. 4a, b). External and posterior claws without septa. The base of the posterior claw extends towards the base of the anterior claw, forming a small cuticular bar (Fig. 4b, d, arrowhead). Anterior claws with pseudolunulae at their bases (Fig. 4b, d, empty arrow); pseudolunulae also sometimes weakly visible at the bases of internal claws I–III. External and posterior claws without pseudolunulae. No cuticular bars on legs I–III present.
Table 2

Measurements (in µm) of selected morphological structures of representatives of Pilatobius recamieri (Richters, 1911) mounted in Hoyer’s medium

Character

N

Range

Mean

SD

Neotype

µm

pt

µm

pt

µm

pt

µm

pt

Body length

27

205–406

10301625

306

1299

49

160

322

1425

Buccopharyngeal tube

         

 Buccal tube length

30

19.8–28.2

23.6

1.8

22.6

 Pharyngeal tube length

30

35.3–56.8

175.6231.3

47.5

200.9

5.1

13.5

47.5

210.2

 Buccopharyngeal tube length

30

55.4–85.0

275.6331.3

71.1

300.9

6.6

13.5

70.1

310.2

 Buccal/pharyngeal tube length ratio

30

43–57%

50%

3%

48%

 Stylet support insertion point

30

12.9–18.0

62.868.8

15.6

66.1

1.2

1.3

15.2

67.3

 Buccal tube external width

30

1.6–2.5

6.610.0

2.0

8.7

0.2

0.7

1.8

8.0

 Buccal tube internal width

29

0.5–1.2

2.54.7

0.9

3.7

0.2

0.5

0.9

4.0

Placoid lengths

         

 Macroplacoid 1

30

3.9–7.3

18.829.2

5.6

23.5

0.8

2.3

5.2

23.0

 Macroplacoid 2

30

2.5–5.5

12.121.6

4.0

16.8

0.7

2.2

3.6

15.9

 Septulum

30

2.0–3.3

9.214.0

2.6

11.2

0.3

1.0

2.5

11.1

 Macroplacoid row

30

6.9–13.7

33.354.8

10.5

44.4

1.6

4.8

10.0

44.2

Claw 1 lengths

         

 External base

17

2.7–5.6

11.020.8

4.0

16.6

0.8

2.8

3.3

14.6

 External primary branch

14

5.2–10.1

22.940.4

8.0

32.8

1.3

4.6

8.2

36.3

 External secondary branch

17

3.6–6.6

15.726.4

5.4

22.2

0.8

2.8

5.5

24.3

 Internal base

14

2.4–4.6

10.519.5

3.8

15.9

0.7

2.8

2.4

10.6

 Internal primary branch

11

4.3–6.8

18.128.0

6.0

24.4

0.7

2.7

5.8

25.7

 Internal secondary branch

13

3.0–4.9

13.020.8

3.9

16.3

0.7

2.2

?

?

Claw 2 lengths

         

 External base

27

2.9–6.5

14.627.2

4.5

19.0

1.0

3.5

4.2

18.6

 External primary branch

27

5.0–11.8

21.045.6

9.0

38.2

1.8

5.8

9.7

42.9

 External secondary branch

27

3.6–7.3

17.636.1

5.8

24.4

1.1

3.8

4.8

21.2

 Internal base

19

2.2–4.9

10.621.4

3.9

16.6

0.9

3.3

3.5

15.5

 Internal primary branch

18

4.4–9.1

19.636.4

6.7

28.0

1.3

4.5

6.9

30.5

 Internal secondary branch

19

3.5–6.2

16.124.8

4.6

19.6

0.8

2.5

5.4

23.9

Claw 3 lengths

             

 External base

27

2.8–6.0

12.225.9

4.5

18.8

0.9

3.2

3.9

17.3

 External primary branch

26

7.1–11.5

35.345.6

9.9

41.4

1.0

2.8

9.9

43.8

 External secondary branch

26

4.1–7.2

18.929.8

5.9

24.7

0.8

2.6

5.5

24.3

 Internal base

22

2.7–5.4

11.823.2

4.1

17.4

0.9

3.3

3.3

14.6

 Internal primary branch

18

4.3–9.6

19.938.4

6.7

28.7

1.4

5.0

?

?

 Internal secondary branch

20

3.5–5.8

15.623.6

4.7

20.2

0.6

2.1

5.2

23.0

Claw 4 lengths

             

 Anterior base

21

2.6–5.4

12.921.1

4.3

18.5

0.8

2.5

3.6

15.9

 Anterior primary branch

20

4.4–9.1

21.736.4

6.6

28.3

1.3

3.8

6.7

29.6

 Anterior secondary branch

21

3.3–5.6

15.624.8

4.5

19.1

0.7

2.3

5.6

24.8

 Posterior base

25

2.8–6.0

13.925.0

4.7

20.1

0.8

2.6

4.3

19.0

 Posterior primary branch

23

7.1–13.6

34.354.4

10.8

45.2

1.7

5.0

10.6

46.9

 Posterior secondary branch

25

3.9–7.5

19.429.2

6.0

25.6

1.0

2.7

6.3

27.9

N number of specimens/structures measured, “Range” indicates the smallest and largest structure among all measured specimens, SD standard deviation

Fig. 2

Pilatobius recamieri (Richters, 1911): a habitus, lateroventral view (PCM, neotype); b, c buccopharyngeal apparatus, dorsolateral view: b PCM (neotype), c SEM; arrowhead indicates the nonannulated posterior portion of the pharyngeal tube (neoparatype). Scale bars in μm

Fig. 3

Pilatobius recamieri (Richters, 1911), details of the buccopharyngeal apparatus (all neoparatypes in SEM): a oral cavity armature; b, c drop-like thickening on the buccopharyngeal tube (dorsal and lateral view, respectively); d annulation of the anterior portion of the pharyngeal tube (lateral view); e annulation of the posterior portion of pharyngeal tube (dorsolateral view); f a typical pharyngeal structures; g a slightly aberrant pharyngeal structures in which the septulum is crooked and resembles a microplacoid. Scale bars in μm

Fig. 4

Pilatobius recamieri (Richters, 1911), claws: a, b claws III and IV, respectively, seen in PCM; empty arrow points at the pseudolunula under the anterior claw base, arrowhead indicates the small cuticular bar at the posterior claw base (neotype); c, d claws III and IV, respectively, seen in SEM; empty arrow points at the pseudolunula under the anterior claw base, arrowhead indicates the cuticular bar protruding towards the pseudolunula (neoparatype). Scale bars in μm

Eggs: Roundish and smooth, deposited in exuviae (up to eight per clutch).

Molecular markers: The sequences for all four DNA markers were of good quality, however for a single individual the 28S rRNA fragment did not aplifyl. The sequenced fragments were of the following length: 1732 bp (18S rRNA; KX347526), 447 bp (28S rRNA; KX347527), 481 bp (ITS-2; KX347528), and 664 bp (COI; KX347529–31). The nuclear markers were represented by a single haplotype, whereas COI exhibited three haplotypes, all with minor p-distances between them (0.3–0.9%). The p-distances between the 18S haplotypes of all available Pilatobius species and P. recamieri varied between 1.2% (P. patanei) and 2.3% (P. ramazzottii), with the average distance of 1.7% (Table 3).
Table 3

p-Distances (in %) between all currently published Pilatobius spp. 18S rRNA sequences

Species (sequence)

1

2

3

4

1. P. nodulosus (HQ604934)

    

2. P. patanei #1 (HQ604935)

2.8

   

3. P. patanei #2 (HQ604936)

2.7

0.1

  

4. P. ramazzottii (HQ604939)

2.3

1.8

1.7

 

5. P. recamieri (KX347526)

2.1

1.3

1.2

2.3

Etymology: Richters (1911) named the species after Joseph Récamier, a French zoologist.

Discussion

Comparison with earlier descriptions of P. recamieri

The original description by Richters (1911) is extremely limited and mentions only that animals can be up to 416 μm long, they are equipped with eyes, the buccal tube is approximately 2 μm wide, there are two macroplacoids in the bulbus, of which the first is longer than the second, and there is also an additional small structure posterior to the macroplacoids, termed “virgule,” i.e., “a comma,” meaning either a microplacoid or a septulum. All these traits are indeed present in the neotype population, but alone are not sufficient to differentiate P. recamieri from other Pilatobius species. Twenty-five years later, Marcus (1936) analyzed specimens from Spitsbergen and noted that they have a microplacoid and that P. recamieri can be differentiated from P. oculatus (Murray, 1906) by the length of the pharyngeal tube (which is longer in P. recamieri), and internal claw morphology. However, pharyngeal tubes in the two species can be of an almost equal length in specimens of a similar body size (pers. obs. based on an analysis of numerous individuals from Norway, Poland, and Scotland), and “internal claw morphology” is not a meaningful trait if not accompanied by more detail. In a faunistic survey, Węglarska (1959) described a population of P. recamieri from Southern Poland, in which some specimens had a septulum, whereas others a microplacoid. However, according to current knowledge on the morphological variability in eutardigrades, traits such as microplacoids and septulae are constant within species (e.g., Pilato 1975, 1981; Kosztyła et al. 2016). Therefore, either Węglarska (1959) found two similar Pilatobius species in one locality (but see also below) or her observation was erroneous. Given that, in some specimens, the septulum may be slightly crooked or twisted (e.g., compare Fig. 3f, g), it can be mistaken for a microplacoid. Ramazzotti and Maucci (1983) stated that P. recamieri can be distinguished from P. oculatus by the bulbus shape (less versus more spherical, respectively) and by the similarity of the external and internal claw shape (claws of a dissimilar shape in P. oculatus). Although it is now recognized that the bulbus is prone to deformation under cover slip pressure and slight differences in bulbus shape should not be used for species differentiation (Pilato 1981), the second trait seems valid. The most comprehensive record of P. recamieri to date was by Dastych (1985), who analyzed numerous specimens from different parts of Spitsbergen (i.e., the terra typica). He noted that the first macroplacoid is 1.2–1.4 times longer than the second one (which is consistent with our measurements, see Table 2), and that the majority of individuals have a small thickening at the end of the second macroplacoid (also present in almost all individuals from the neotype series). Unfortunately, Dastych (1985) did not address the microplacoid versus septulum issue, although he described the thin cuticular extension of the bases of the posterior claws that we also show in the present study (Fig. 3b, d, arrowhead). In the most recent description of P. recamieri, based on specimens collected from Poland, Dastych (1988) did note the microplacoid. Thus, similarly to the earlier record by Węglarska (1959), either his record did not represent P. recamieri but a similar species or he misinterpreted the septulum as the microplacoid.

Differential diagnosis

The great majority of currently known Pilatobius species exhibit a sculptured cuticle. Apart from P. recamieri, there are only three other congeners with smooth cuticle: P. brevipes (Marcus, 1936), P. borealis (Biserov, 1996), and P. secchii (Bertolani and Rebecchi, 1996). Although P. oculatus (Murray, 1906) has a sculptured cuticle, it can be misidentified as P. recamieri given that the cuticular sculpturing in the former species, composed of small polygons limited to the caudal cuticle, may sometimes be poorly visible under low magnification.

Of all Pilatobius species, P. recamieri is definitely most similar to P. secchii. At the time of description of P. secchii, no detailed information on the morphology of P. recamieri was available and Bertolani and Rebecchi (1996) assumed that the cuticular bar on hind legs and pseudolunulae under internal and anterior claws were characteristic for P. secchii and absent in P. recamieri. However, we have now shown that these traits are, in fact, present in P. recamieri (see Fig. 3), meaning that the two species are morphologically indistinguishable. Thus, morphometric or/and molecular data are needed to test whether P. secchii is a valid species or a synonym of P. recamieri. Unfortunately, Bertolani and Rebecchi (1996) did not provide a complete set of morphometric data, and the limited measurements available for the holotype do not allow a confident differentiation of the two species. Thus, we measured four P. secchii paratypes, kindly loaned to us by Lorena Rebecchi, according to modern morphometric standards. We found that the ranges for all 71 absolute and relative traits of P. secchii overlap with those for P. recamieri (compare Tables 2, 4). Importantly, Bertolani and Rebecchi (1996) reported a higher pt value for the stylet support insertion point compared with our measurements (73.9 % versus 63.6–66.0 %, respectively). If the pt value provided by Bertolani and Rebecchi (1996) is true, then it would constitute a clear morphometric difference between these two taxa. However, the higher pt reported by Bertolani and Rebecchi (1996) is most likely a result of a different method of buccal tube measurement compared to that adopted by us. Three years after the description of P. secchii, Pilato and Binda (1999) proposed that, in taxa with a drop-like thickening, the buccal tube length should be measured down to the posterior end of the drop. Previously, some authors measured the buccal tube length to the anterior end of the drop, which translates to a shorter measurement and ultimately to overestimated pt values. In other words, currently there are no morphological or morphometric differences between P. recamieri and P. secchii and a molecular investigation is needed to verify the status of the latter species. Therefore, taking into account the evidence described above, we must designate P. secchii as nomen inquirendum until DNA sequences become available for this taxon.
Table 4

Measurements (in µm) of selected morphological structures of four paratypes of Pilatobius secchii (Bertolani and Rebecchi, 1996) mounted in polyvinyl lactophenol

Character

N

Range

Mean

SD

µm

pt

µm

pt

µm

pt

Body length

4

149–277

7561365

214

1025

52

253

Buccopharyngeal tube

       

 Buccal tube length

4

19.7–22.0

20.8

1.0

 Pharyngeal tube length

2

33.1–47.6

150.5234.5

40.4

192.5

10.3

59.4

 Buccopharyngeal tube length

2

55.1–67.9

250.5334.5

61.5

292.5

9.1

59.4

Buccal/pharyngeal tube length ratio

2

43–66 %

55 %

17 %

 Stylet support insertion point

4

13.0–14.0

63.666.0

13.5

64.8

0.6

1.2

 Buccal tube external width

4

1.7–1.9

8.09.4

1.8

8.8

0.1

0.6

 Buccal tube internal width

4

0.9–1.3

4.66.4

1.1

5.3

0.2

0.8

Placoid lengths

       

 Macroplacoid 1

4

4.8–5.9

24.429.1

5.5

26.2

0.5

2.1

 Macroplacoid 2

4

3.3–4.2

16.820.2

3.9

18.6

0.4

1.4

 Septulum

4

1.9–2.8

9.412.7

2.2

10.4

0.4

1.6

 Macroplacoid row

4

8.6–11.3

43.751.4

10.1

48.4

1.1

3.3

Claw 1 lengths

       

 External base

4

2.5–3.1

11.714.8

2.8

13.3

0.3

1.4

 External primary branch

1

?

?

6.5

30.5

?

?

 External secondary branch

4

3.8–4.7

17.723.2

4.2

20.0

0.4

2.3

 Internal base

2

2.6–3.0

13.214.8

2.8

14.0

0.3

1.1

 Internal primary branch

0

?

?

?

?

?

?

 Internal secondary branch

0

?

?

?

?

?

?

Claw 2 lengths

       

 External base

4

3.0–4.2

14.120.7

3.6

17.2

0.5

2.7

 External primary branch

2

7.7–8.6

36.242.4

8.2

39.3

0.6

4.4

 External secondary branch

4

4.5–5.1

21.125.1

4.8

22.9

0.3

1.9

 Internal base

4

2.7–4.1

13.120.2

3.2

15.3

0.6

3.3

 Internal primary branch

2

5.3–5.9

26.929.1

5.6

28.0

0.4

1.5

 Internal secondary branch

1

?

?

4.6

22.7

?

?

Claw 3 lengths

       

 External base

4

3.3–4.6

16.822.7

4.0

19.2

0.6

2.7

 External primary branch

2

7.5–7.6

35.736.9

7.6

36.3

0.1

0.9

 External secondary branch

4

4.7–5.4

23.025.6

5.1

24.3

0.3

1.1

 Internal base

3

3.7–3.9

16.819.2

3.8

17.8

0.1

1.3

 Internal primary branch

2

5.5–5.7

25.828.1

5.6

27.0

0.1

1.6

 Internal secondary branch

3

3.8–4.5

17.821.2

4.2

19.8

0.4

1.8

Claw 4 lengths

           

 Anterior base

4

3.4–4.4

17.320.0

3.9

18.6

0.4

1.5

 Anterior primary branch

3

5.0–5.2

22.726.4

5.1

24.9

0.1

1.9

 Anterior secondary branch

2

3.7–4.3

18.821.2

4.0

20.0

0.4

1.7

 Posterior base

4

4.2–4.9

20.024.1

4.6

21.9

0.3

1.7

 Posterior primary branch

4

7.3–8.5

33.239.9

7.8

37.7

0.5

3.1

 Posterior secondary branch

4

5.3–5.7

24.927.4

5.5

26.3

0.2

1.2

N number of specimens/structures measured, “Range” indicates the smallest and largest structure among all measured specimens, SD standard deviation

In contrast to P. secchii, P. recamieri is readily distinguishable from the other three above-mentioned species and differs specifically from:
  • P. brevipes, known from various localities in the Palearctic and from some Nearctic habitats (Ramazzotti and Maucci 1983), by the lack of bars under claws I–III and by a longer pharyngeal tube (35.3–56.8 μm in 205–406-μm-long specimens of P. recamieri versus around 30 μm in a 350-μm-long specimen of P. brevipes). We must underline that this difference may result from the use of a different measurement technique, as in the case of P. secchii (see above).

  • P. borealis, recorded only from the type locality in the sub-Arctic Taimyr Peninsula (Biserov, 1996), by a more anterior stylet support insertion point (pt 62.868.8 % in P. recamieri versus 68.873.3 % in P. borealis), and a significantly longer buccal and pharyngeal tube (respectively 19.8–28.2 μm and 35.3–56.8 μm in P. recamieri versus 14–16 μm and 22–26 μm in P. borealis).

  • P. oculatus, reported from various localities in the Holarctic (Ramazzotti and Maucci 1983), by the internal morphology of external primary branches (a uniform structure from base to tip in P. recamieri versus a light-refracting unit within the base of the branch) (Dastych 1988), and caudal polygonal sculpture (absent in P. recamieri versus present in P. oculatus).

Although Bertolani and Rebecchi (1996) described the structure under the anterior claw of P. secchii as the “lunula,” we think that the term “pseudolunula” is more appropriate, since well-defined lunulae, present in numerous genera of the superfamilies Macrobiotoidea (Thulin 1928) and Eohypsibioidea (Bertolani & Kristensen 1987), are connected with the claw base via a peduncle, whereas the structures under claws in Hypsibioidea (Pilato 1969) and Isohypsibioidea (Sands et al. 2008) are placed directly at the claw base and are usually thin-edged, making them difficult to identify in some cases. In fact, macrobiotoid and eohypsibioid lunulae are always evident under SEM, whereas pseudolunulae in the hypsibioid and isohypsibioid taxa are never identifiable in SEM and appear as widened claw bases rather than separate structures (e.g., see Fig. 3).

Geographic distribution of the species

Pilatobius recamieri has been reported from a number of Holarctic localities, being found most often in mountainous habitats and only rarely in lowlands (Dastych 1988). It was recorded from various northern areas, such as the Svalbard Archipelago (Dastych 1985; Maucci 1996; Zawierucha et al. 2013), Greenland (Petersen 1951), Taimyr Peninsula and Novaya Zemlya (Biserov 1996, 1999), Vancouver Island (Kathman 1990), and Colorado (Beasley 1990). Another group of records constitute mountain populations (possibly postglacial relicts), e.g., Töw Province in Mongolia (Iharos 1965, 1968) or the Elburz Range in Iran (Dastych 1972). If P. secchii turns out to be synonymous with P. recamieri, the Tusco-Emilian Apennine population should be added to the mountainous reports of the species. There are also some lowland European records from eastern Italy (Durante Pasa and Maucci 1975) and southern Hungary (Vargha 1998). Finally, the species was reported from Southern Argentina (Iharos 1963; Rossi and Claps 1991), but these records are considered questionable and most likely belong to a different species, as hypothesized by Dastych (1988) and Kaczmarek et al. (2015). However, given the limited original description of P. recamieri, even the Holarctic records outside of the terra typica should be treated with caution and verified against the morphological and molecular data provided herein, as some of the more distant reports may belong to similar species rather than to P. recamieri. A recent study by Gąsiorek et al. (2016) suggested that Mesocrista spitzbergensis, another species originally described from Svalbard and later reported from numerous localities throughout the Holarctic, probably does not occur in Continental Europe. This was possible thanks to a thorough redescription of M. spitzbergensis from the type locality and an integrative comparison with several European populations of Mesocrista that revealed a new species (Gąsiorek et al. 2016). Therefore, it would not be surprising if at least some of the non-Arctic records of P. recamieri represented other Pilatobius species, only superficially similar to P. recamieri. Our integrative redescription makes such evaluations possible.

Conclusions

An integrative approach to the redescription of P. recamieri allowed us to establish three important morphological traits that characterize the species and that were uncertain or unknown to date: the presence of the septulum instead of the microplacoid, the presence of pseudolunulae at the internal and anterior claw bases, and the presence of cuticular bars next to the bases of posterior claws. DNA sequencing provided neotype barcodes for species delimitation that will enable confident verification of future records of the species as well as phylogenetic analyses of the genus Pilatobius. Given that we found no morphological or morphometric differences between P. recamieri and P. secchii, a species described from Italy 85 years after P. recamieri, the taxonomic status of P. secchii must be considered uncertain, pending future verification contingent on molecular data for the type population. Because of the ambiguities concerning earlier P. recamieri records, no sound conclusions on the geographic range of the species can be drawn at the moment, but it is possible that P. recamieri is an Arctic or a Palaearctic/Holarctic mountainous species, meaning that the alleged lowland records and reports from other zoogeographic realms should be treated with caution.

Notes

Acknowledgements

We would like to express our gratitude to Lorena Rebecchi (Modena, Italy) for the loan of P. secchii paratypes and we also acknowledge three anonymous reviewers for their valuable remarks. The study was supported by the Polish Ministry of Science and Higher Education via the “Diamond Grant” programme (grant no. DI2011 035241) and a National Science Centre scholarship (grant no. 2015/16/T/NZ8/00017) to K.Z., and by the Foundation for Polish Science via the “Homing Plus” programme, cofunded by the European Union’s Regional Development Fund (grant “Species delimitation—combining morphometric, molecular and experimental approaches” to Ł.M.). Morphometry was funded by the Polish–Norwegian Research Programme operated by the National Centre for Research and Development under the Norwegian Financial Mechanism 2009–2014 in the frame of project contract no. Pol-Nor/201992/93/2014. K.Z. was supported by the Academy of Sciences of the Czech Republic (project no. RVO 67985904). This research was carried out partially with equipment purchased thanks to the financial support of the European Regional Development Fund in the framework of the Polish Innovation Economy Operational Program (contract no. POIG.02.01.00-12-023/08). Sampling was conducted by K.Z. (2013) under RIS permit no. 6390.

References

  1. Altiero T, Giovannini I, Guidetti R, Rebecchi L (2015) Life history traits and reproductive mode of the tardigrade Acutuncus antarcticus under laboratory conditions: strategies to colonize the Antarctic environment. Hydrobiologia. doi:10.1007/s10750-015-2315-0 Google Scholar
  2. Beasley CW (1990) Tardigrada from Gunnison Co., Colorado, with the description of a new species of Diphascon. Southwest Nat 35(3):302–304CrossRefGoogle Scholar
  3. Beasley CW, Kaczmarek Ł, Michalczyk Ł (2008) Doryphoribius mexicanus, a new species of Tardigrada (Eutardigrada: Hypsibiidae) from Mexico (North America). Proc Biol Soc Wash 121:34–40. doi:10.2988/07-30.1 CrossRefGoogle Scholar
  4. Bertolani R, Kristensen RM (1987) New records of Eohypsibius nadjae Kristensen, 1982, and revision of the taxonomic position of two genera of Eutardigrada (Tardigrada). In: Biology of Tardigrades. Selected symposia and monographs U.Z.I. 1, pp. 359–372Google Scholar
  5. Bertolani R, Rebecchi L (1996) The tardigrades of Emilia (Italy). II. Monte Rondinaio. A multihabitat study on a high altitude valley of the northern Apennines. Zool J Linn Soc 116:3–12. doi:10.1006/zjls.1996.0002 CrossRefGoogle Scholar
  6. Bertolani R, Biserov V, Rebecchi L, Cesari M (2011) Taxonomy and biogeography of tardigrades using integrated approach: new results on species of Macrobiotus hufelandi group. Invertebr Zool 8:23–36Google Scholar
  7. Bertolani R, Guidetti R, Marchioro T, Altiero T, Rebecchi L, Cesari M (2014) Phylogeny of Eutardigrada: new molecular data and their morphological support lead to the identification of new evolutionary lineages. Mol Phylogenet Evol 76:110–126. doi:10.1016/j.ympev.2014.03.006 CrossRefPubMedGoogle Scholar
  8. Binda MG, Pilato G (1971) Nuove osservazioni sui Tardigradi delle Isole Eolie. Boll Accad Gioenia Sci Nat 10(9):766–774Google Scholar
  9. Biserov VI (1996) Tardigrades of the Taimyr peninsula with descriptions of two new species. Zool J Linn Soc 116:215–237. doi:10.1006/zjls.1996.0018 CrossRefGoogle Scholar
  10. Biserov VI (1999) A review of the Tardigrada from Novaya Zemlya, with descriptions of three new species, and an evaluation of the environment in this region. Zool Anz 238(3–4):169–182Google Scholar
  11. Callaghan TV, Björn LO, Chernov Y, Chapin T, Christensen TR, Huntley B, Ims RA, Johansson M, Jolly D, Jonasson S, Matveyeva N, Panikov N, Oechel W, Shaver G, Elster J, Henttonen H, Laine K, Taulavuori K, Taulavuori E, Zöckler Ch (2004) Biodiversity, distributions and adaptations of arctic species in the context of environmental change. Ambio 33(7):404–417CrossRefPubMedGoogle Scholar
  12. Casquet J, Thebaud C, Gillespie RG (2012) Chelex without boiling, a rapid and easy technique to obtain stable amplifiable DNA from small amounts of ethanol-stored spiders. Mol Ecol Resour 12:136–141. doi:10.1111/j.1755-0998.2011.03073.x CrossRefPubMedGoogle Scholar
  13. Coulson SJ, Midgley NG (2012) The role of glacier mice in the invertebrate colonisation of glacial surfaces: the moss balls of the Falljökull, Iceland. Polar Biol 35:1651–1658. doi:10.1007/s00300-012-1205-4 CrossRefGoogle Scholar
  14. Dastych H (1972) An annotated list of Tardigrada from Mts. Elburs, Iran. Fragm Faun 18(4):47–54CrossRefGoogle Scholar
  15. Dastych H (1985) West Spitsbergen Tardigrada. Acta Zool Cracov 28(3):169–214Google Scholar
  16. Dastych H (1988) The Tardigrada of Poland. Mon Faun Pol 16:1–255Google Scholar
  17. Dastych H (1991) Redescription of Hypsibius antarcticus (Richters, 1904), with some notes on Hypsibius arcticus (Murray, 1907) (Tardigrada). Mitt Hamb Zool Mus Inst 88:141–159Google Scholar
  18. De Smet WH, Van Rompu EA (1994) Rotifera and Tardigrada from some cryoconite holes on a Spitsbergen (Svalbard) glacier. Belg J Zool 124:27–37Google Scholar
  19. Doyère ML (1840) Mémorie sur les Tardigrades. Ann Sci Nat Zool 14:269–362Google Scholar
  20. Durante Pasa MV, Maucci W (1975) Tardigradi muscicoli dell’Istria con descrizione di due specie nuove. Mem Ist Ital Idrobiol 32:69–91Google Scholar
  21. Eibye-Jacobsen J (2001) A new method for making SEM preparations of the tardigrade buccopharyngeal apparatus. Zool Anz 240:309–319. doi:10.1078/0044-5231-00038 CrossRefGoogle Scholar
  22. Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299PubMedGoogle Scholar
  23. Gąsiorek P, Stec D, Morek W, Zawierucha K, Kaczmarek Ł, Lachowska-Cierlik D, Michalczyk Ł (2016) An integrative revision of Mesocrista Pilato, 1987 (Tardigrada: Eutardigrada: Hypsibiidae). J Nat Hist 50(45–46):2803–2828. doi:10.1080/00222933.2016.1234654 CrossRefGoogle Scholar
  24. Guidetti R, Rizzo AM, Altiero T, Rebecchi L (2012) What can we learn from the toughest animals of the Earth? Water bears (tardigrades) as multicellular model organisms in order to perform scientific preparations for lunar exploration. Planet Space Sci 74:97–102. doi:10.1016/j.pss.2012.05.021 CrossRefGoogle Scholar
  25. Hall TA (1997) BIOEDIT: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser 41:95–98Google Scholar
  26. Hodkinson ID (2013) Terrestrial and freshwater invertebrates. In: Meltofte H (ed) Arctic biodiversity assessment. Status and trends in arctic biodiversity. Conservation of Arctic Flora and Fauna, Akureyri, pp 194–223Google Scholar
  27. Iharos G (1963) The zoological results of Gy. Topal’s collectings in South Argentina 3. Tardigrada. Ann Hist Nat Mus Nat Hung 55:293–299Google Scholar
  28. Iharos G (1965) Ergebnisse der zoologischen Forschungen von Dr. Z. Kaszab in der Mongolei 028. Tardigrada. Folia Entomol Hung 18(11):179–183Google Scholar
  29. Iharos G (1968) Ergebnisse der zoologischen Forschungen von Dr. Z. Kaszab in der Mongolei 162. Tardigrada II. Opusc Zool Budapest 8(1):31–35Google Scholar
  30. Janiec K (1996) The comparison of freshwater invertebrates of Spitsbergen (Arctic) and King George Island (Antarctic). Pol Polar Res 17:173–202Google Scholar
  31. Johansson C, Miller WR, Linder ET, Adams BJ, Boreliz-Alvarado E (2013) Tardigrades of Alaska: distribution patterns, diversity and species richness. Polar Res. doi:10.3402/polar.v32i0.18793 Google Scholar
  32. Kaczmarek Ł, Zawierucha K, Smykla J, Michalczyk Ł (2012) Tardigrada of the Revdalen (Spitsbergen) with the descriptions of two new species: Bryodelphax parvuspolaris (Heterotardigrada) and Isohypsibius coulsoni (Eutardigrada). Polar Biol 35:1013–1026. doi:10.1007/s00300-011-1149-0 CrossRefGoogle Scholar
  33. Kaczmarek Ł, Cytan J, Zawierucha K, Diduszko D, Michalczyk Ł (2014) Tardigrades from Peru (South America), with descriptions of three new species of Parachela. Zootaxa 3790(2):357–379. doi:10.11646/zootaxa.3790.2.5 CrossRefPubMedGoogle Scholar
  34. Kaczmarek Ł, Michalczyk Ł, McInnes SJ (2015) Annotated zoogeography of non-marine Tardigrada. Part II: South America. Zootaxa 3923:1–107. doi:10.11646/zootaxa.3923.1.1 CrossRefPubMedGoogle Scholar
  35. Kathman D (1990) Eutardigrada from Vancouver Island, British Columbia, Canada, including a description of Platicrista cheleusis n. sp. Can J Zool 68:1880–1895. doi:10.1139/z90-268 CrossRefGoogle Scholar
  36. Kosztyła P, Stec D, Morek W, Gąsiorek P, Zawierucha K, Michno K, Ufir K, Małek D, Hlebowicz K, Laska A, Dudziak M, Frohme M, Prokop ZM, Kaczmarek Ł, Michalczyk Ł (2016) Experimental taxonomy confirms the environmental stability of morphometric traits in a taxonomically challenging group of microinvertebrates. Zool J Linn Soc 178:765–775. doi:10.1111/zoj.12409 CrossRefGoogle Scholar
  37. Marcus E (1936) Tardigrada. 66. Das Tierreich, de Gruyter & Co., BerlinGoogle Scholar
  38. Marley NJ, McInnes SJ, Sands CJ (2011) Phylum Tardigrada: a re-evaluation of the Parachela. Zootaxa 2819:51–64Google Scholar
  39. Maucci W (1996) Tardigrada of the Arctic tundra with descriptions of two new species. Zool J Linn Soc 116:185–204. doi:10.1111/j.1096-3642.1996.tb02343.x CrossRefGoogle Scholar
  40. McInnes SJ, Ellis-Evans JC (1990) Micro-invertebrate community structure within a maritime Antarctic lake. Proc NIPR Symp Polar Biol 3:179–189Google Scholar
  41. Michalczyk Ł, Kaczmarek Ł (2013) The Tardigrada Register: a comprehensive online data repository for tardigrade taxonomy. J Limnol 72:175–181. doi:10.4081/jlimnol.2013.s1.e22 CrossRefGoogle Scholar
  42. Michalczyk Ł, Wełnicz W, Frohme M, Kaczmarek Ł (2012) Redescriptions of three Milnesium Doyère, 1840 taxa (Tardigrada: Eutardigrada: Milnesiidae), including the nominal species for the genus. Zootaxa 3154:1–20Google Scholar
  43. Mironov SV, Dabert J, Dabert M (2012) A new feather mite species of the genus Proctophyllodes Robin, 1877 (Astigmata: Proctophyllodidae) from the Long-tailed Tit Aegithalos caudatus (Passeriformes: Aegithalidae)—morphological description with DNA barcode data. Zootaxa 3253:54–61. doi:10.11646/%25x Google Scholar
  44. Morek W, Stec D, Gąsiorek P, Schill RO, Kaczmarek Ł, Michalczyk Ł (2016) An experimental test of tardigrade preparation methods for light microscopy. Zool J Linn Soc 178:785–793. doi:10.1111/zoj.12457 CrossRefGoogle Scholar
  45. Murray J (1906) The Tardigrada of the Forth Valley. Ann Scott Nat Hist 60:214–217Google Scholar
  46. Nelson DR, Guidetti R, Rebecchi L (2015) Phylum Tardigrada. In: Thorp and Covich’s freshwater invertebrates, vol 1, Chap 17. Academic, Cambridge, pp 347–380Google Scholar
  47. Petersen B (1951) The tardigrade fauna of Greenland. Meddelelser om Grønland 150(5):1–94Google Scholar
  48. Pilato G (1969) Evoluzione e nuova sistemazione degli Eutardigrada. Boll Zool 36:327–345CrossRefGoogle Scholar
  49. Pilato G (1975) On the taxonomic criteria of the Eutardigrada. Mem Ist Ital Idrobiol 32:277–303Google Scholar
  50. Pilato G (1981) Analisi di nuovi caratteri nello studio degli eutardigradi. Animalia 8:51–57Google Scholar
  51. Pilato G, Binda MG (1999) Three new species of Diphascon of the pingue group (Eutardigrada, Hypsibiidae) from Antarctica. Polar Biol 21:335–342CrossRefGoogle Scholar
  52. Pilato G, Binda MG (2010) Definition of families, subfamilies, genera and subgenera of the Eutardigrada, and keys to their identification. Zootaxa 2404:1–54. doi:10.5281/zenodo.194138 Google Scholar
  53. Ramazzotti G (1957) Due nuove specie di Tardigradi extra-Europei. Atti Soc Ital Sci Nat Mus Civ Stor Nat Milano 96(3–4):188–191Google Scholar
  54. Ramazzotti G, Maucci W (1983) Il Phylum Tardigrada. Terza edizione riveduta e aggiornata. Mem Ist Ital Idrobiol 41:1–1012Google Scholar
  55. Richters F (1903) Nordische Tardigraden. Zool Anz 27:168–172Google Scholar
  56. Richters F (1911) Faune des mousses: Tardigrades. Duc d’Orleans Campagne arctique de 1907, BruxellesGoogle Scholar
  57. Richters F (1926) Tardigrada. In: III. Handbuch der Zoologie. de Gruyter, Berlin, pp 58–61Google Scholar
  58. Robotti C (1970) Hypsibius (D.) ramazzottii spec. nov. e Macrobiotus aviglianae spec. nov. Primo contributo alla conoscenza dei tardigradi del Piemonte. Atti Soc Ital Sci Nat Mus Civ Stor Nat Milano 110(3):251–255Google Scholar
  59. Rossi GC, Claps MC (1991) Tardigrados dulceacuicolas de la Argentina. 19. Fauna de aqua dulce de la Republica Argentina, La Plata, Buenos AiresGoogle Scholar
  60. Sands CJ, McInnes SJ, Marley NJ, Goodall-Copestake WP, Convey P, Linse K (2008) Phylum Tardigrada: an “individual” approach. Cladistics 24:1–11. doi:10.1111/j.1096-0031.2008.00219.x CrossRefGoogle Scholar
  61. Schuster RO, Nelson DR, Grigarick AA, Christenberry D (1980) Systematic criteria of the Eutardigrada. Trans Am Microsc Soc 99:284–303CrossRefGoogle Scholar
  62. Scourfield DJ (1897) Contributions to the non-marine fauna of Spitsbergen. Part I. Preliminary notes, and reports on the Rhizopoda, Tardigrada, Entomostraca, etc. Proc Zool Soc Lond 65(3):784–792CrossRefGoogle Scholar
  63. Stec D, Smolak R, Kaczmarek Ł, Michalczyk Ł (2015) An integrative description of Macrobiotus paulinae sp. nov. (Tardigrada: Eutardigrada: Macrobiotidae: hufelandi group) from Kenya. Zootaxa 4052(5):501–526. doi:10.11646/zootaxa.4052.5.1 CrossRefPubMedGoogle Scholar
  64. Stec D, Gąsiorek P, Morek W, Kosztyła P, Zawierucha K, Michno K, Kaczmarek Ł, Prokop ZM, Michalczyk Ł (2016) Estimating optimal sample size for tardigrade morphometry. Zool J Linn Soc 178:776–784. doi:10.1111/zoj.12404 CrossRefGoogle Scholar
  65. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729. doi:10.1093/molbev/mst197 CrossRefPubMedPubMedCentralGoogle Scholar
  66. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680. doi:10.1093/nar/22.22.4673 CrossRefPubMedPubMedCentralGoogle Scholar
  67. Thulin G (1928) Über die phylogenie und das system der tardigraden. Hereditas 11:207–266CrossRefGoogle Scholar
  68. Tumanov DV (2007) Three new species of Macrobiotus (Eutardigrada, Macrobiotidae, tenuis-group) from Tien Shan (Kirghizia) and Spitsbergen. J Limnol 66:40–48CrossRefGoogle Scholar
  69. Van Rompu EA, De Smet WH (1996) Freshwater tardigrades from Hopen, Svalbard (76°31′N). Fauna Norv Ser A 17:1–9Google Scholar
  70. Vargha B (1998) Adatok a Duna-Dráva Nemzeti Park medveállatka (Tardigrada) faunájához. Dunántúli Dolg Term tud Sorozat 9:73–80Google Scholar
  71. Węglarska B (1959) Tardigraden Polens II. Teil. Acta Soc Zool Bohemoslov 23(4):354–357Google Scholar
  72. Węglarska B (1965) Die Tardigraden (Tardigrada) Spitzbergens. Acta Zool Cracov 11:43–51Google Scholar
  73. Wełnicz W, Grohme M, Kaczmarek Ł, Schill RO, Frohme M (2011) ITS-2 and 18S rRNA data from Macrobiotus polonicus and Milnesium tardigradum (Eutardigrada: Tardigrada). J Zool Sys Evol Res 49:34–39. doi:10.1111/j.1439-0469.2010.00595.x CrossRefGoogle Scholar
  74. White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M, Gelfand D, Sninsky J, White T (eds) PCR protocols: a guide to methods and applications. Academic, Orlando, pp 315–322Google Scholar
  75. Zawierucha K (2013) Tardigrada from Arctic tundra (Spitsbergen) with a description of Isohypsibius karenae sp. n. (Isohypsibiidae). Pol Polar Res 34:351–364. doi:10.2478/popore-2013-0016 Google Scholar
  76. Zawierucha K, Coulson SJ, Michalczyk Ł, Kaczmarek Ł (2013) Current knowledge of the Tardigrada of Svalbard with the first records of water bears from Nordaustlandet (High Arctic). Polar Res. doi:10.3402/polar.v32i0.20886 Google Scholar
  77. Zawierucha K, Smykla J, Michalczyk Ł, Gołdyn B, Kaczmarek Ł (2015) Distribution and diversity of Tardigrada along altitudinal gradients in the Hornsund, Spitsbergen (Arctic). Polar Res. doi:10.3402/polar.v34.24168 Google Scholar
  78. Zawierucha K, Ostrowska M, Vonnahme TR, Devetter M, Nawrot AP, Lehmann S, Kolicka M (2016a) Diversity and distribution of Tardigrada in Arctic cryoconite holes. J Limnol 75(3):545–559Google Scholar
  79. Zawierucha K, Zmudczyńska-Skarbek K, Kaczmarek Ł, Wojczulanis-Jakubas K (2016b) The influence of a seabird colony on abundance and species composition of water bears (Tardigrada) in Hornsund (Spitsbergen, Arctic). Polar Biol 39:713–723. doi:10.1007/s00300-015-1827-4 CrossRefGoogle Scholar
  80. Zeller C (2010) Untersuchung der Phylogenie von Tardigraden anhand der Genabschnitte 18S rDNA und Cytochrom c Oxidase Untereinheit 1 (COX I). Master thesis, Technische Hochschule WildauGoogle Scholar

Copyright information

© The Author(s) 2017

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.

Authors and Affiliations

  1. 1.Institute of Zoology and Biomedical ResearchJagiellonian UniversityKrakówPoland
  2. 2.Department of Animal Taxonomy and EcologyAdam Mickiewicz UniversityPoznanPoland
  3. 3.Laboratory of Fish Genetics, Institute of Animal Physiology and GeneticsAcademy of Sciences of the Czech RepublicLibechovCzech Republic

Personalised recommendations