Current Genetics

, 49:341 | Cite as

Gene disruption in Cryptococcus neoformans and Cryptococcus gattii by in vitro transposition

Technical Note

Abstract

Cryptococcus neoformans and Cryptococcus gattii are basidiomycetous fungi that infect immunocompromised and immunocompetent people. We developed an insertional mutagenesis strategy for these species based on in vitro transposition and we tested the method by disrupting the URA5 gene in a strain of C. neoformans and the CAP10 gene in three strains of C. gattii. We targeted plasmid DNA containing the URA5 gene or plasmid DNA containing the CAP10 gene from genomic libraries from the shotgun sequencing project for the C. gatti strain WM276. In the latter case, the availability of the end sequences of the clones from the assembled genomic sequence allows rapid selection of target genes for disruption. Modified transposons containing the nourseothricin (NAT) or neomycin (Neo) resistance cassettes were randomly inserted into the target DNA by in vitro transposition. The disrupted genes were used for biolistic transformation and homologous integration was subsequently confirmed by PCR and Southern blot analysis. These results demonstrate that the emerging genomic resources, combined with in vitro transposition into plasmid DNAs from shotgun sequencing libraries or cloned PCR products, will facilitate high-throughput genetic analysis in Cryptococcus species.

Keywords

Gene disruption Transposon Basidiomycetes Virulence factors 

Introduction

The basidiomycete fungal pathogens Cryptococcus neoformans and Cryptococus gattii infect both immunocompetent and immunocompromised individuals to cause cryptococcosis. Cryptococcus strains infect the central nervous system and cause meningioencephalitis that can be fatal if not aggressively treated. Five different serotypes (A, B, C, D and AD) have been classified based on antigenic differences in the capsule of the fungus. Strains of the B and C serotypes have recently been recognized as a separate species called C. gattii, while serotypes A and D are considered different varieties called C. neoformans var. grubii and C. neoformans var. neoformans, respectively (Kwon-Chung et al. 2002). Serotype A is the most clinically prevalent in cryptococcosis patients in North America, followed by serotype D. Serotype B isolates (C. gattii) were considered to be limited to tropical and subtropical environments (Casadevall and Perfect 1998) but this idea has been called into question by the emergence of infections caused by C. gattii in immunocompetent individuals on Vancouver Island (Hoang et al. 2004).

The fungus produces a polysaccharide capsule that is a well-characterized virulence factor for the pathogen. Other virulence factors include the ability to grow at 37°C, melanin synthesis, and production of urease and phospholipase (Casadevall and Perfect 1998; Cox et al. 2000, 2001; Kwon-Chung and Rhodes 1986). There is considerable interest in determining the genetic and biochemical basis of capsule formation in C. neoformans and C. gattii because the capsule is antiphagocytic and exerts a negative influence on the host immune response (Buchanan and Murphy 1998). By isolating and complementing acapsular mutants, Kwon-Chung and colleagues identified four genes (CAP10, CAP59, CAP60 and CAP64) involved in capsule biosynthesis (Chang et al. 1996; Chang and Kwon-Chung 1994, 1998, 1999). These CAP genes are essential for capsule formation and for virulence in the murine model. Further studies demonstrated that the CAP10 gene product was located in the cytoplasm while Cap60 was located at the nuclear membrane (Chang and Kwon-Chung 1998, 1999). CAP10 is expressed at high levels in late-stationary-phase cells, and the expression level is modulated by the transcriptional factor STE12alpha (Chang and Kwon-Chung 1999). Other genes, such as the CAS genes, also play a role in capsule synthesis (Moyrand et al. 2002).

C. neoformans is an excellent model to study fungal pathogenesis. The fungus has a well-defined sexual cycle, it is predominantly haploid, and congenic alpha- and a mating-type strains are available (Hull and Heitman 2002; Lodge et al. 1994; Sia et al. 2000). The fungus is amenable to a variety of genetic and molecular techniques. For example, gene disruption is readily accomplished by biolistic transformation (Davidson et al. 2000), electroporation (Edman and Kwon-Chung 1990) or Agrobacterium-mediated transformation (Idnurm et al. 2004) to introduce deletion constructs. The reported rates of homologous recombination range from 0.008% to 50% depending on the parameters involved in the experiment (Fox et al. 2001; Salas et al. 1996; Nelson et al. 2003). Selectable markers, such as ADE2 and URA5, have been developed for transformation of auxotrophic recipient strains. Dominant antibiotic resistance markers for hygromycin, noursethricin, and G418 (neomycin) are also available (Cox et al. 1996; Hua et al. 2000). In addition, several animal models to study virulence have been developed (Hull and Heitman 2002; Perfect 2005). These approaches and tools have only recently been applied to the analysis of strains of C. gattii.

Genomic resources are rapidly accumulating for C. neoformans and C. gattii. Specifically, two genome sequences have been described for serotype D strains (Loftus et al. 2005), and sequences have been obtained for a serotype A strain and two serotype B strains (http://www.fungal.genome.duke.edu/; http://www.bcgsc.ca; http://www.broad.mit.edu/annotation/fgi/). In addition, a serial analysis gene expression (SAGE) program is in progress to characterize the transcriptomes of C. neoformans strains under different conditions related to virulence (Steen et al. 2002, 2003; Lian et al. 2004). Microarrays have also recently become available to the research community to allow rapid analysis of gene expression (http://www.genome.wustl.edu/activity/ma/cneoformans/).

Given the accumulating genomic sequence and expression data, it is clear that simple and efficient gene disruption approaches are needed to explore the functions of Cryptococcal genes. Gene disruption by homologous recombination after biolistic transformation has proven successful in C. neoformans and C. gattii. Davidson et al. (2002) developed an overlapping PCR strategy to make constructs with large regions of homology for gene disruption without cloning. Nelson et al. (2003) examined the minimum sequence requirements for efficient homologous recombination and found that symmetric or asymmetrical constructs with 300 bp or more of flanking sequence on each side of the construct were efficiently targeted for gene disruption in C. neoformans var. grubii. In the context of their findings, these authors also proposed that an in vitro transposition strategy coupled with PCR amplification of target genes would facilitate the preparation of deletion constructs. Here we describe the development and application of such a transposon-based strategy to generate disruption constructs without overlapping PCR and cloning in order to rapidly disrupt genes of interest, particularly in C. gattii. This approach was motivated by access to a large bank of plasmid clones with known end sequences from our shotgun sequencing project for the serotype B strain WM276 of C. gattii. Relatively few genes have been disrupted in this species and the combination of in vitro transposition with the genome project should allow high-throughput genetic analysis. To test this approach, plasmids carrying the CAP10 gene were identified from the libraries and the gene was disrupted in three different strains of C. gattii. We also disrupted the well-characterized URA5 gene in the serotype A strain H99 of C. neoformans to confirm the applicability of the protocol in this better characterized serotype.

Materials and methods

Fungal strains, plasmids and media

Serotype A strain H99 (C. neoformans var. grubii) and serotype B strains WM276, NIH444 and A1MR265 (C. gattii) were used in the study. WM276 belongs to subtype VGI of C. gattii, NIH444 and A1MR265 are both in subtype VGII by molecular typing (Kidd et al. 2004, 2005). All strains were maintained on YPD medium (1% yeast extract, 2% peptone, 2% dextrose, and 2% agar). Plasmid pGPS3 was purchased from New England Biolabs, USA Plasmids pJAF1 containing a neomycin resistance cassette, pCH233 containing a noursethricin resistance cassette, and pJMN97-3 carrying a URA5 gene fragment were generously provided by Dr. J. Heitman (Duke University). YPD plates containing neomycin (200 μg/ml) were used for selecting CAP10 disruption transformants and YPD plates containing noursethricin (100 μg/ml) were used to select URA5 disruption transformants.

Modification of the GPS3 transposon

We initially modified the commercial GPS3 transposon vector to carry three different selectable markers for Cryptococcus transformation (Fig. 1a). Plasmid pGPS3-NAT was produced by inserting a 1.7 kb XbaI/SpeI fragment from pCH233, containing the nourseothricin resistance cassette, into the SpeI restriction site within the transprimer of pGPS3 (New England Biolabs). Plasmid pGPS3-Neo was created by inserting a 1.7 kb XbaI/SpeI fragment from pJAF1, which contains a neomycin resistance cassette, into the SpeI restriction site within the transprimer of pGPS3. To complete the vector set, pGPS3-Hyg was produced by inserting a 2.6 kb NotI/SnaBI fragment of pHyg7-kb into a NotI/StuI double digested GPS3-transposon (note that this plasmid was not used in the present study). All plasmids were transformed into electro-competent DH10B/r cells of Escherichia coli.
Fig. 1

a Diagrams of the modified GPS3 transposons: pGPS-NEO, pGPS-NAT, and pGPS-HYG.b Disruption construct for the CAP10 gene. A cap10::Neo disruption allele was created by random insertion of the transposon from pGPS3-Neo into the CAP10 fragment of pCN23E63cH10 in an in vitro transposition reaction. The cap10::Neo disruption cassette in plasmid pCAP10-Neo9 is shown, and the insertion site is 175 nt downstream of the putative start codon of CAP10. Insertion positions in CAP10 by the other transposons are also indicated by the symbol ⇓. Arrows indicate the location of primer pairs in both negative and positive colony PCR screen test. EEcoRV, PPvuII, SScaI

Targets for gene disruption

Two targets chosen for disruption, CAP10 (in serotype B) and URA5 (in serotype A), are easily screened for a phenotype (by India ink staining and growth on 5-FOA, respectively). A stand-alone local BLAST was performed with the end sequence datasets of the WM276 shotgun sequencing libraries CN022 and CN23E to identify the clones containing inserts with the largest portion of CAP10. Both libraries had an average insert size of approximately 2 kb: CN022 contains 35,328 sequenced clones and CN23E contains 24,096 sequenced cloned. In the present study, the clone CN23E63cH10 that contains the full-length CAP10 gene was selected for gene disruption. The plasmid pJMN97-3 carrying the URA5 gene was used to generate the URA5 disruption construct for the serotype A strain H99.

In vitro transposition

In vitro transposition reactions were performed according to the NEB pGPS3 protocol. Briefly, 20 ng of the modified pGPS vectors (donor vectors: pGPS3-Neo or pGPS3-NAT) and 80 ng of target plasmid DNA (either pCN23E63cH10 or pJMN97-3) were incubated with the TnsABC transposase complex (New England Biolabs). In the present study, pGPS3-Neo was incubated with pCN23E63cH10 and pGPS3-NAT was mixed with pJMN97-3. The reaction mixture was subsequently digested with the PI-SceI restriction enzyme to destroy remaining donor vectors. The products of the transposition reaction were transformed into E. coli. Resulting colonies were selected on LB plates with ampicillin (100 μg/ml) and kanamycin (50 μg/ml) and screened for transposon insertions in the genes of interest by either colony PCR or restriction enzyme digestion. This analysis determined whether the transposon had inserted into the plasmid backbone or the gene insert. For the WM276 shotgun sequencing libraries, colony PCR was performed with Platinum Taq polymerase (Invitrogen) to screen for CAP10 disruption constructs, using either primers GPS3-N and BR194-F, or primers GPS3-S and BR194-F (Table 1). The presence of a PCR product revealed the transposon location and orientation in the plasmid. PCR reactions were carried out in a BioRad MyCycler® thermal cycler. The amplification reaction consisted of 35 cycles of 15 s at 96°C, 30 s at 55°C, and 3.5 min at 72°C with an initial denaturation of 2 min at 96°C and a final extension of 5 min at 72°C. The exact transposon insertion site was further determined by sequencing the clones using primers homologous to the ends of the transposon (either GPS3-S or GPS3-N, Table 1). To select the URA5 disruption constructs in the plasmid pJMN97-3 from a transposition reaction with pGPS3-NAT, a restriction enzyme digestion of the plasmid DNA was performed to estimate the approximate location of the transposon in URA5.
Table 1

Primers used in the study

Primers

Sequences (5′–3′)

GPS3-N

CACAGCATAACTGGACTGA

BR194-F

CTGTGCTAGGATGGTCAC

GPS3-S

GCTTACGACGCTACACCCAGT

CAP10intR

CGACGCGTCTAGGTCCATCT

CAP10intF

CTGCCATGAGCTTGGGAAT

CAP10-outR

GCCAAGAGCTTAAGGACCAT

Transformation, screening and phenotype studies

Biolistic transformation was performed using linear DNA by the method described by Davidson et al. (2000). Transformants were selected on YPD plates containing either nourseothricin (100 μg/ml for ura5 mutants) or neomycin (G418; 200 μg/ml for cap10 mutants). Colony PCR was performed with Extaq polymerase (Takara) to screen for the putative disruptants. The PCR reaction consisted of 30 cycles of 15 s at 94°C, 15 s at 55°C, and 3 min at 72°C with an initial denaturation of 12 min at 94°C and a final extension of 7 min at 72°C. For serotype B strains (WM276, NIH444 and A1MR265), colony PCR was first performed with primers, CAP10intR and CAP10intF (Table 1), and the presence of a PCR band of 240 bps indicated the wild-type genotype (“negative” screening). Those transformants that did not produce a band of 240 bps were subjected to a second round of PCR (“positive” screening) with primers GPS-N and a primer from the genomic sequence of CAP10 gene flanking region (CAP10-outR, Table 1). Putative CAP10 disruptants were verified by Southern blot analysis. Capsule production was induced by growth in low-iron medium (LIM) overnight at 30°C, and the capsule was examined by differential interference contrast (DIC) microscopy after India ink negative staining. For the URA5 disruption, transformants on YPD plates containing nourseothricin (100 μg/ml) were screened for growth on 5-FOA (1 mg/ml), and on YNB minimal medium without uracil (drop-out test), and confirmed by Southern blot analysis.

Southern blot analysis

Genomic DNA from each strain was isolated following the protocol as described by Perkin et al. (1988), and approximately 10 μg of genomic DNA was digested to completion. The fragments were separated by agarose gel electrophoresis and transferred to nylon filters using 10× SSC. Probes were produced using a Random Priming Kit (Amersham Pharmacia Biotech) by incorporation of 32P-dCTP according to the manufacturer’s protocol. The 1.7 kb CAP10 gene-specific probe DNA was produced by digestion of plasmid pCN23E63cH10 with EcoRV. The ~470 bp fragment of URA5 gene was produced by digestion of pJMN97-3 with EcoRV.

Results

We demonstrated the applicability of the in vitro transposition-based strategy by disrupting the CAP10 gene in the serotype B strains WM276, A1MR265 and NIH444, and the URA5 gene in the serotype A strain H99. Two shotgun sequencing libraries, CN022 and CN23E, containing ~2 kb inserts in the BstX1 site of pBR194c and pBR194e, respectively, were available for serotype B strain WM276. These libraries were constructed for the whole genome sequencing project of the C. gattii strain WM276 and paired sequencing reads were obtained for approximately 60,000 clones. The assembled genome sequence including the paired end reads for each clone is available in the public domain (http://www.bcgsc.ca). By stand-alone local BLAST using the CAP10 gene from a serotype D strain B-4500 (Chang and Kwon-Chung 1999) as query sequence, four clones in the CN022 library (CN02275dA10, CN02262cG04, CN02225cD02 and CN02295bG12) and four clones in CN023 library (CN23E63cH10, CN23E31bE10, CN23E19aG11 and CN23E21dD08) were identified to contain the CAP10 gene. Clone CN23E63cH10 contained the full length CAP10 gene (2,586 bp insert) and was selected for further study.

An in vitro transposition reaction was performed by mixing the modified transposon vector pGPS3-Neo and the target DNA (pCN23E63cH10) in the presence of TnsABC transposase. Following E. coli transformation, the resulting colonies were screened by colony PCR; clones with putative insertions in the CAP10 gene produced a PCR band (<2.6 kb) in one of two PCR reactions, using either primers BR194-F and GPS-N, or primers BR194-F and GPS-S (data not shown). The presence of a PCR product also provided information on the orientation of the transposon insertion. Among 20 colonies screened, 12 colonies appeared to have a transposon insertion in the CAP10 gene while the remaining insertions occurred in the vector. The insert in pCN23E63cH10 is 2,586 bps and contained sequences from −557 to 2,029 nt of the CAP10 gene in WM276 (the open reading frame extends from 558 to 2,563 nt in the insert). To confirm the results from the PCR screen that indicated CAP10 disruption, plasmid DNA from four of the 12 colonies (pCAP10-Neo4, pCAP10-Neo9, pCAP10-Neo11, and pCAP10-Neo14) was used for sequence analysis of the insertion site. Transposon insertion sites 15 nt (pCAP10-Neo4), 175 nt (pCAP10-Neo9), 1,233 nt (pCAP10-Neo14), and 1,455 nt (pCAP10-Neo11) were present downstream from the putative start codon, respectively (Fig. 1b). pCAP10-Neo9 was chosen to transform three C. gattii strains.

The three strains of C. gattii used for this study, WM276, A1MR265 and NIH444, belong to serotype B but have two different molecular subtypes based on PCR fingerprinting methods (Kidd et al. 2004, 2005). The WM276 strain represents the VGI subtype and the other strains represent the VGIIa subtype. These strains were each transformed biolistically with the pCAP10-Neo9 disruption construct and 120–200 transformants were obtained for each strain. Two rounds of colony PCR were performed to screen the transformants after selection on YPD plates containing G418 (neomycin). In the “negative” screening test, PCR with the gene-specific primers CAP10intR and CAP10intF produced a 240 bp band, which indicated the presence of the wild-type genotype if the construct was not integrated at the CAP10 locus, or a ~3.7 kb band for the disruptant if the construct had integrated at the CAP10 locus (Fig. 2). Colonies that did not yield a 240 bp band were subjected to a second round (“positive”) of PCR screening with one primer, GPS-S, from the transposon vector, and the other, CAP10-outR, from the flanking region of the construct. In this screen a 630 bp product was produced if the construct was integrated at the CAP10 locus (Fig. 2). Representative Southern blots demonstrating homologous integration at the CAP10 locus are shown in Fig. 2 for all three strains. The Southern blot results matched the colony PCR results: 30 out of 50 transformants were found to be positive by PCR for WM276, 6 out of 29 were found for A1MR265, and 10 out of 48 were found for NIH444. In addition, an acapsular phenotype was observed in all of the CAP10 mutants (Fig. 2). The acapsular cells typically formed larger clusters in low-iron medium (Fig. 2) as described for the CAP10 mutants in a serotype D strain (Chang and Kwon-Chung 1999). The efficiency of targeting at CAP10 appeared higher for WM276 than in the other serotype B strains (A1MR265 and NIH444): in WM276, up to 60% of transformants showed homologous integration of the construct, whereas approximately 21% of transformants in both A1MR265 and NIH444 showed homologous integration. Alignment of the CAP10 genomic sequences between WM276 and A1MR265 revealed that the regions that would potentially participate in recombination events during transformation shared 95% similarity. This may explain the difference in the efficiency of homologous recombination between these two strains. The efficiency of transformation in NIH444 was similar to that of A1MR265 and this is consistent with the shared molecular subtype of these two strains and their identity by sequence analysis of four genes (Kidd et al. 2005). We also attempted to use the CAP10 construct pCAP10-Neo9, derived from WM276 DNA, to disrupt CAP10 alleles in strains of serotypes A and D. Specifically, we transformed the construct into strains H99 (serotype A) and JEC21 (serotype D), but no homologous integrants were obtained among the colonies screened (32 colonies in H99 and 49 colonies in JEC21). This result is consistent with the lower sequence similarity for the CAP10 flanking regions: the similarity is 90% between WM276 and JEC21, and 89% between WM276 and H99.
Fig. 2

Disruption of the CAP10 gene in three strains of C. gattii. a Disruption of CAP10 in WM276. A Colony PCR was performed to demonstrate the disruption of the target gene. The left gel shows an example of the negative screen in which a band of 240 bp indicates the presence of wild-type locus (a sample of 22 transformants is shown); the right gel shows a positive screen in which a band of 630 bp indicates the replacement of the wild-type locus with the disruption cassette (a sample of 20 transformants that passed the negative screen test is shown). b Confirmation of CAP10 disruption by Southern blot analysis of the wild-type strain and a representative cap10 mutant strain. Genomic DNA was digested with either PvuII or ScaI and hybridized with a 1.7 kb fragment of the CAP10 gene. The DNA size markers are shown on the left. In each blot, the DNA in the left lane was from the wild-type strain (WT) and the DNA in the right lane was from a cap10 mutant strain (KO). Replacement of the wild-type locus with the disruption cassette results in a larger band. c Capsule phenotypes associated with CAP10 disruption. Cells were grown in low-iron medium and viewed by India ink staining. Mutant cells are acapsular and form clusters. B Disruption of CAP10 in strain A1MR265. The gel on the left shows the negative PCR screen of nine transformants in which a band of 240 bp indicates the presence of wild-type locus. The gel on the right shows the presence of the 630 bp band in seven positive disruption strains (in a sample of 11 transformants). C Disruption of CAP10 in strain NIH444. The gel on the left shows the negative PCR screen of 21 transformants in which a band of 240 bp indicates the presence of wild-type locus. The gel on the right shows the presence of the 630 bp band in 20 positive disruption strains (in a sample of 11 transformants). For B and C, the organization of parts b and c of the figures is as described for A above

To demonstrate that the transposon-based protocol was useful in C. neoformans, we disrupted the URA5 gene in H99 (serotype A). A transposition reaction was performed between the plasmid pJMN97-3 that contains a cloned URA5 gene and the modified donor vector pGPS3-NAT. Insertion sites in the URA5 gene fragment were identified by analysis of restriction enzyme digests of the plasmids from E. coli transformants (Fig. 3a). Three plasmids with different insertion sites in pJMN97-2 were selected and pooled for biolistic transformation into H99 cells. Colonies of the resulting transformants were screened phenotypically by initially plating on YPD plates containing nourseothricin (YPD-NAT). Those transformants that grew on YPD-NAT plates were transferred on to 5-fluoro-orotic acid (5-FOA) medium, and YNB minimal medium without uracil (Fig. 3c). Those putative URA5 disruptants that grew on 5-FOA and YPD-NAT plates, but not on the dropout test plates, were verified by Southern blot analysis (Fig. 3b). Among 58 colonies screened by the phenotypic tests, three were found to have the disruption mutation in URA5.
Fig. 3

Disruption of the URA5 gene in the serotype A strain H99 by biolistic transformation with pooled constructs generated from the transposon-based strategy. a Determination of insertion sites in pJMN97-3 (carrying the URA5 gene cloned in pUC119) for the modified transposon pGPS3-NAT using NheI /BamHI digestion of the plasmid DNA. Symbol asterisk indicates candidate clones with insertion sites in the URA5 gene. b Verification of disruption by Southern blot hybridization. Replacement of the URA5 wild-type locus with the construct resulted in hybridization to a larger band of 5.6 kb. DNA in the left lane was from the H99 wild-type strain and DNA in the right lane was from a representative mutant. Genomic DNA was digested with BclI and hybridized with a 470 bp URA5 gene fragment. c Phenotypic analysis of the H99 ura5::NAT mutants. Mutants grew on both YPD-NAT and 5-FOA plates but did not grow in synthetic medium lacking uracil, while the wild-type strain grew only in the synthetic medium lacking uracil

Discussion

C. neoformans and C. gattii are important pathogens of humans and experimentally tractable model systems to study fungal pathogenesis. The genomes of five representative strains from different serotypes have been sequenced, including JEC21 and B3501a (D), H99 (A), A1MR265 and WM276 (B). Such advances will enable extensive comparative genomics studies among C. neoformans, C. gattii and the other fungal species. In addition, gene expression studies by SAGE, microarrays, and subtractive hybridization, as well as proteomic studies, are identifying many interesting genes for subsequent genetic investigation. Rapid and high-throughput protocols to test gene function are therefore essential for the efficient use of the completed genomes and the expression data. In C. neoformans and C. gattii, cloning and/or PCR strategies have been previously used to make the disruption/deletion constructs of targeted alleles. However, such strategies can be time-consuming, expensive and technically challenging. The in vitro transposition-based strategy described here is relatively rapid and straightforward in its implementation, and it is cost effective. It does not require multiple cloning and/or PCR steps to generate the constructs for targeted alleles, although cloned PCR products can serve as templates. In addition, the primers used in the colony PCR steps to identify disruption constructs (either GPS-S and BR194-F, or GPS-N and BR194-F) were designed from the transposon and vector sequences, and therefore can be universally used for screening insertions in all targeted genes presented in the WM276 shotgun sequencing libraries. The transposon strategy also has the advantage of potentially identifying clones with different insertion sites within a gene to generate alleles with potentially novel phenotypic effects. Finally, the procedure is useful for introducing selectable markers into cloned DNA fragments to facilitate complementation of mutations during genetic reconstitution studies and into large insert DNA clones (e.g., BAC clones) for transformation into Cryptococcus cells. The latter approach may be useful for studying the functions of larger genomic elements such as centromeres, or for the complementation of large deletion mutations.

The Tn7-based transposition system is known to randomly generate single, simple insertions into target DNA (Biery et al. 2001), which makes in vitro transposition useful to initiate genome-wide mutagenesis studies in filamentous fungi (Hamer et al. 2001). The GPS3-based protocol has been used in other fungal species, such as Aspergillus fumigatus (Jadoun et al. 2004), the plant pathogenic fungi Mycosphaerella graminicola (Zwiers and DeWaard 2001) and Stagonospora nodorum (Solomon et al. 2004), and the human pathogen, Candida glabrata (Castano et al. 2003). Similarly, TAGKO (transposon-arrayed gene knockout), a technique developed based on the random insertion of transposons, was successfully used to disrupt targeted genes in Magnaporthe grisea (Hamer et al. 2001) and M. graminicola (Adachi et al. 2002). Unfortunately, such studies have been limited to ascomyceteous fungi. A previous investigation in M. graminicola suggested that an increase in gene-targeting frequency might be achieved if the transposon-based strategy is combined with the Agrobacterium-mediated transformation (Adachi et al. 2002). Agrobacterium-mediated transformation has been recently applied to C. neoformans (Idnurm et al. 2004) and it will be interesting to see if the gene-targeting frequency could be improved by combination of Agrobacterium-mediated transformation and disruption construct generation by the GPS3 transposon-based strategy.

The CAP10 disruption construct derived from the DNA of strain WM276 was successfully used to disrupt the gene in the different subtype strains A1MR265 and NIH444. The cap10 mutants from three serotype B strains (WM276, A1MR265 and NIH444) demonstrated an acapsular phenotype that was similar to that described for a serotype D strain (Chang and Kwon-Chung 1999). The efficiencies of homologous recombination in all serotype B strains are generally high (20–60%), although both NIH444 and A1MR265 were lower than WM276. This was likely due to sequence divergence among the subtype strains, which is known to affect gene targeting in C. neoformans. Global comparison of genome content revealed that the similarity between the two recent sequenced genomes, WM276 and A1MR265, is only around 95% and alignment of the CAP10 sequences showed that the similarity between WM276 and A1MR265 is 96%. There is limited genome information available for NIH444. The present study reveals that the VGI disruption construct can disrupt genes in the different subtype VGII strain, even though the similarity between the subtypes is only around 95–96%, but not in a different serotype (A or D) with a similarity of 92–96%. It is interesting to note that previous studies revealed that approximately 4–8% divergence of intragenic regions from serotype A to D may hinder gene targeting, thus preventing homologous recombination (Davidson et al. 2000). It was suggested that the same strain background should be used for the gene disruption construct and the recipient (Davidson et al. 2000). In general, the successful disruption of the CAP10 allele in A1MR265 by a disruption construct from a cross-subtype allele of WM276 indicates that it will be possible to use the easily accessible WM276 shotgun sequence libraries as a resource to knock out genes in other serotype B strains (including A1MR265). The finding that the disruption construct for the CAP10 gene of WM276 is applicable to generate knockout strains for the cross-subtype alleles in strains A1MR265 and NIH444 is intriguing given that gene disruption alleles for serotype A did not prove to be applicable to serotype D, and vice versa (e.g., Davidson et al. 2000). For the serotype B strains, it is not known whether the region where CAP10 is located is a “hot spot” for recombination, or whether the DNA recombination machinery (e.g., the DNA mismatch repair system) is different between the serotype A, B, and D strains. In Saccharomyces cerevisiae, E. coli, and Salmonella sp., it is known that the DNA mismatch repair system contributes to the requirement of identical sequences for high-efficiency homologous recombination (Earley and Crouse 1998; Rayssiguier et al. 1989).

Additional advantages of the transposon-based strategy are that it works in a variety of strain backgrounds, as indicated by URA5 disruption in the serotype A strain H99, and it can be modified for other fungi. Shotgun sequencing libraries, such as those constructed for the genome sequencing projects for the different strains of Cryptococcus, provide a valuable resource for the high-throughout gene-function tests. Future sequencing projects for fungi could similarly couple the in vitro transposition strategy with sequencing libraries to facilitate subsequent genetic analysis. For C.neoformans, homologous recombination requires a large region of homology, and the minimal flanking region of similarity was proposed to be larger than 300 bps (Nelson et al. 2002). Plasmid libraries included in shotgun sequencing programs normally contain inserts that are 2 kb and larger, which means that suitable disruption constructs can easily be selected after the in vitro transposition reaction. In addition, the sequences of all clones in shotgun sequencing libraries are easily accessible by bioinoformatics analysis. Thus, the high coverage of libraries should allow selection of any gene(s) of interest for disruption. Of course, access to the clone libraries is not essential for the procedure because cloned PCR fragments carrying genes of interest also serve as substrates for in vitro transposition.

Notes

Acknowledgements

Funding was provided by the National Institute of Allergy and Infectious Disease (5RO1AI053721) and the Canadian Institutes of Health Research (CIHR) to JWK. WM276 shotgun sequencing was completed at the Michael Smith Genome Science Centre (GSC) with funding from Genome Canada to JWK. We thank the sequencing group at the GSC for construction of the libraries.

References

  1. Adachi K, Nelson GH, Peoples KA, Frank SA, Montenegro-Chamorro MV, DeZwaan TM, Ramamurthy L, Shuster JR, Hamer L, Tanzer MM (2002) Efficient gene identification and targeted gene disruption in the wheat blotch fungus Mycosphaerella graminicola using TAGKO. Curr Genet 42:123–127PubMedCrossRefGoogle Scholar
  2. Biery MC, Stewart FJ, Stellwagen AE, Raleigh EA, Craig NL (2000) A simple in vitro Tn7-based transposition system with low target site selectivity for genome and gene analysis. Nucleic Acids Res 28:1067–1077PubMedCrossRefGoogle Scholar
  3. Buchanan K, Murphy JW (1998) What makes Cryptococcus neoformans a pathogen? Emerg Infect Dis 4:71–83PubMedGoogle Scholar
  4. Casadevall A, Perfect JR (1998) Cryptococcus neoformans. ASM Press, WashingtonGoogle Scholar
  5. Castano I, Kaur R, Pan S, Cregg R, De Las Penas A, Guo N, Biery MC, Craig NL, Cormack BP (2003) Tn7-based genome-wide random insertional mutagenesis in Candida glabrata. Genome Res 13:905–915PubMedCrossRefGoogle Scholar
  6. Chang YC, Kwon-Chung KJ (1994) Complementation of a capsule-deficient mutation of Cryptococcus neoformans restores its virulence. Mol Cell Biol 14:4912–4919PubMedGoogle Scholar
  7. Chang YC, Kwon-Chung KJ (1998) Isolation of the third capsule-associated gene, CAP60, required for virulence in Cryptococcus neoformans. Infect Immun 66:2230–2236PubMedGoogle Scholar
  8. Chang YC, Kwon-Chung KJ (1999) Isolation, characterizatiom, and localization of a capsule-associated gene, CAP10, of Cryptococcus neoformans. J Bacteriol 181:5636–5643PubMedGoogle Scholar
  9. Chang YC, Penoyer L, Kwon-Chung KJ (1996) The second capsule gene of Cryptococcus neoformans CAP64 is essential for virulence. Infect Immun 64:1977–1983PubMedGoogle Scholar
  10. Cox GM, McDade HC, Chen SC, Tucker SC, Gottfredsson M, Wright LC, Sorrell TC, Leidich SD, Casadevall A, Ghannoum MA, Perfect JR (2001) Extracellular phospholipase activity is a virulence factor for Cryptococcus neoformans. Mol Microbiol 39:166–175PubMedCrossRefGoogle Scholar
  11. Cox GM, Mukherjee J, Cole GT, Casadevall A, Perfect JR (2000) Urease as a virulence factor in experimental cryptococcosis. Infect Immun 68:443–448PubMedCrossRefGoogle Scholar
  12. Cox GM, Toffaletti DL, Perfect JR (1996) Dominant selection system for use in Cryptococcus neoformans. J Med Vet Mycol 34:385–391PubMedCrossRefGoogle Scholar
  13. Davidson RC, Cruz MC, Sia RA, Allen B, Alspaugh JA, Heitman J (2000) Gene disruption by biolistic transformation in serotype D strains of Cryptococcus neoformans. Fungal Genet Biol 29:38–48PubMedCrossRefGoogle Scholar
  14. Davidson RC, Blankenship JR, Kraus PR, Berrios MDJ, Hull CM, D’Souza C, Wang P, Heitman J (2002) A PCR-based strategy to generate integrative targeting alleles with large regions of homology. Microbiology 148:2607–2615PubMedGoogle Scholar
  15. Earley MC, Crouse GF (1998) The role of mismatch repair in the prevention of base pair mutations in Saccharomyces cerevisiae. Proc Natl Acad Sci USA 95:15487–15491PubMedCrossRefGoogle Scholar
  16. Edman JC, Keon-Chung KJ (1990) Isolation of the URA5 gene from Cryptococcus neoformans var. neoformans and its use as a selective marker for transformation. Mol Cell Biol 10:4538–4544PubMedGoogle Scholar
  17. Fox DS, Cruz MC, Sia RA, Ke H, Cox GM, Cardenas ME, Heitman J (2001) Calcinurin regulatory subunit is essential for virulence and mediates interactions with FKBP12-FK506 in Cryptococcus neoformans. Mol Microbiol 39:835–849PubMedCrossRefGoogle Scholar
  18. Hamer L, Adachi K, Montenegro-Chamorro MV, Tanzer MM, Mahanty SK, Lo C, Tarpey RW, Skalchunes AR, Heiniger RW, Frank SA, Darveaux BA, Lampe DJ, Slater TM, Ramamurthy L, DeZwaan TM, Nelson GH, Shuster JR, Woessner J, Hamer JE (2001) Gene discovery and gene function assignment in filamentous fungi. Proc Natl Acad Sci USA 98:5110–5115PubMedCrossRefGoogle Scholar
  19. Hoang LM, Maguire JA, Doyle P, Fyfe M, Roscoe DL (2004) Cryptococcus neoformans infections at vancouver hospital and health sciences centre (1997–2002): Epidemiology, microbiology and histopathology. J Med Microbiol 53:935–940PubMedCrossRefGoogle Scholar
  20. Hua J, Meyer JD, Lodge JK (2000) Development of positive selectable markers for the fungal pathogen Cryptococcus neoformans. Clin Diagn Lab Immunol 7:125–128PubMedGoogle Scholar
  21. Hull CM, Heitman J (2002) Genetics of Cryptococcus neoformans. Annu Rev Genet 36:557–615PubMedCrossRefGoogle Scholar
  22. Idnurm A, Reedy JL, Nussbaum JC, Heitman J (2004) Cryptococcus neoformans virulence gene discovery through insertional mutagenesis. Eukaryot Cell 3:420–429PubMedCrossRefGoogle Scholar
  23. Jadoun J, Shadkchan Y, Osherov N (2004) Disruption of the Aspergillus fumigatus argB gene using a novel in vitro transposon-based mutagenesis approach. Curr Genet 45:235–241PubMedCrossRefGoogle Scholar
  24. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, Macdougall L, Boekhout T, Kwon-Chung KJ, Meyer W (2004) A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc Natl Acad Sci USA 101:17258–17263PubMedCrossRefGoogle Scholar
  25. Kidd SE, Guo H, Bartlett KH, Xu J, Kronstad JW (2005) Comparative gene genealogies indicate that two clonal lineages of Cryptococcus gattii in British Columbia resemble strains from other geographical areas. Eukaryot Cell 10:1629–1638CrossRefGoogle Scholar
  26. Kwon -Chung KJ, Boekhout T, Fell JW, Diaz M (2002) Proposal to conserve the name Cryptococcus gatti against C. hondurianus and C. bacillisporus (Basidiomycoto, Hymenomycetes, Tremellomycetiadae) Taxon 51:804–806CrossRefGoogle Scholar
  27. Kwon-Chung KJ, Rhodes JC (1986) Ecapsulation and melanin formation as indicators of virulence in Cryptococcus neoformans. Infect Immun 51:218–223PubMedGoogle Scholar
  28. Lodge JK, Jackson-Machelski E, Toffaletti DL, Perfect JR, Gordon JI (1994) Targeted gene replacement demonstrates that myristoyl-CoA: protein N-myristoyltransferase is essential for viability of Cryptococcus neoformans. Proc Natl Acad Sci USA 91:12008–12012PubMedCrossRefGoogle Scholar
  29. Loftus BJ, Fung E, Roncaglia P, Rowley D, Amedeo P, Bruno D, Vamathevan J, Miranda M, Anderson IJ, Fraser JA, Allen JE, Bosdet IE, Brent MR, Chiu R, Doering TL, Donlin MJ, D’Souza CA, Fox DS, Grinberg V, Fu J, Fukushima M, Haas BJ, Huang JC, Janbon G, Jones SJ, Koo HL, Krzywinski MI, Kwon-Chung JK, Lengeler KB, Maiti R, Marra MA, Marra RE, Mathewson CA, Mitchell TG, Pertea M, Riggs FR, Salzberg SL, Schein JE, Shvartsbeyn A, Shin H, Shumway M, Specht CA, Suh BB, Tenney A, Utterback TR, Wickes BL, Wortman JR, Wye NH, Kronstad JW, Lodge JK, Heitman J, Davis RW, Fraser CM, Hyman RW (2005) The genome of the basidiomycetous yeast and human pathogen Cryptococcus neoformans Science 307:1321–1324PubMedCrossRefGoogle Scholar
  30. Moyrand F, Klaproth B, Himmerlreich U, Dromer F, Janbon G (2002) Isolation and characterization of capsule structure mutant strains of Cryptococcus neoformans. Mol Microbiol 45:837–849PubMedCrossRefGoogle Scholar
  31. Nelson RT, Pryor BA, Lodge JK (2003) Sequence length required for homologous recombination in Cryptococcus neoformans. Fungal Genet Biol 38:1–9PubMedCrossRefGoogle Scholar
  32. Lian TS, Simmer MI, D’Souza CA, Steen BR, Zuyderduyn SD, Jone SJM, Marra MA, Kronstad JW (2004) Iron-regulated transcription and capsule formation in the fungal pathogen Cryptococcus neoformans. Mol Microbiol 55:1452–1472CrossRefGoogle Scholar
  33. Perfect JR (2005) Cryptococcus neoformans: a sugar-coated killer with designer genes. FEMS Immunol Med Microbiol 45:395–404PubMedCrossRefGoogle Scholar
  34. Pitkin JW, Panaccione DG, Walton JD (1996) A putative cyclic peptide efflux pump encoded by the TOXA gene of the plant-pathogenic fungus Cochliobolus carbonum. Microbiology 142:1557–1565PubMedCrossRefGoogle Scholar
  35. Rayssiguier C, Thaler DS, Radma (1989) The barrier to recombination between Escherichia coli and Salmonella typhimurium is disrupted in mismatch-repair mutants. Nature 23:396–401CrossRefGoogle Scholar
  36. Salas SD, Bennet JE, Kwon-Chung KJ, Perfect JR, Williamson PR (1996) Effect of the laccase gene, CNLAC1, on virulence of Cryptococcus neoformans. J Exp Med 184:377–386PubMedCrossRefGoogle Scholar
  37. Sia RA, Lengeler KB, Heitman J (2000) Diploid strains of the pathogenic basidiomycete Cryptococcus neoformans are thermally dimorphic. Fungal Genet Biol 29:153–163PubMedCrossRefGoogle Scholar
  38. Solomon PS, Lee RC, Greer Wilson TJ, Oliver RP (2004) Pathogenicity of Stagonospora nodorum requires malate synthase. Mol Microbiol 53:1065–1073PubMedCrossRefGoogle Scholar
  39. Steen BR, Lian T, Zuyderduyn S, MacDonald WK, Marra M, Jones SJ, Kronstad JW (2002) Temperature-regulated transcription in the pathogenic fungus Cryptococcus neoformans. Genome Res 12:1386–1400PubMedCrossRefGoogle Scholar
  40. Steen BR, Zuyderduyn S, Toffaletti DL, Marra M, Jones SJ, Perfect JR, Kronstad JW (2003) Cryptococcus neoformans gene expression during experimental cryptococcal meningitis. Eukaryot Cell 2:1336–1349PubMedCrossRefGoogle Scholar
  41. Zwiers L, De Waard MA (2001) Efficient Agrobacterium tumefaciens-mediated gene disruption in the phytopathogen Mycosphaerella graminicola. Curr Genet 39:388–393PubMedCrossRefGoogle Scholar

Copyright information

© Springer-Verlag 2005

Authors and Affiliations

  1. 1.The Michael Smith LaboratoriesThe University of British ColumbiaVancouverCanada

Personalised recommendations