Advertisement

Current Microbiology

, Volume 70, Issue 1, pp 85–90 | Cite as

Detection and Analysis of CRISPRs of Shigella

  • Xiangjiao Guo
  • Yingfang Wang
  • Guangcai DuanEmail author
  • Zerun Xue
  • Linlin Wang
  • Pengfei Wang
  • Shaofu Qiu
  • Yuanlin Xi
  • Haiyan Yang
Article

Abstract

The recently discovered CRISPRs (Clustered regularly interspaced short palindromic repeats) and Cas (CRISPR-associated) proteins are a novel genetic barrier that limits horizontal gene transfer in prokaryotes and the CRISPR loci provide a historical view of the exposure of prokaryotes to a variety of foreign genetic elements. The aim of study was to investigate the occurrence and distribution of the CRISPRs in Shigella. A collection of 61 strains of Shigella were screened for the existence of CRISPRs. Three CRISPR loci were identified among 61 shigella strains. CRISPR1/cas loci are detected in 49 strains of shigella. Yet, IS elements were detected in cas gene in some strains. In the remaining 12 Shigella flexneri strains, the CRISPR1/cas locus is deleted and only a cas3’ pseudo gene and a repeat sequence are present. The presence of CRISPR2 is frequently accompanied by the emergence of CRISPR1. CRISPR3 loci were present in almost all strains (52/61). The length of CRISPR arrays varied from 1 to 9 spacers. Sequence analysis of the CRISPR arrays revealed that few spacers had matches in the GenBank databases. However, one spacer in CRISPR3 loci matches the cognate cas3 genes and no cas gene was present around CRISPR3 region. Analysis of CRISPR sequences show that CRISPR have little change which makes CRISPR poor genotyping markers. The present study is the first attempt to determine and analyze CRISPRs of shigella isolated from clinical patients.

Keywords

Bacillary Dysentery Chromosomal Sequence Shigella Strain Pseudo Gene GeneBank Database 
These keywords were added by machine and not by the authors. This process is experimental and the keywords may be updated as the learning algorithm improves.

Notes

Acknowledgments

Our study was funded by the Important National Science & Technology Specific Projects (2013ZX10004607).

Supplementary material

284_2014_683_MOESM1_ESM.pdf (10 kb)
Supplementary material 1 (PDF 9 kb)
284_2014_683_MOESM2_ESM.pdf (8 kb)
Supplementary material 2 (PDF 7 kb)
284_2014_683_MOESM3_ESM.pdf (4 kb)
Supplementary material 3 (PDF 4 kb)
284_2014_683_MOESM4_ESM.docx (16 kb)
Supplementary material 4 (DOCX 16 kb) There were two errors in this file. The primer of cas3 rev ‘GCCCCCTGATCGTATGGATG’ should be ‘GTCATTCCTGCTTCCAGCCT’. In addition, we should revise the length of PCR product of CRISPR, since the length of CRISPRs varied because the number of repeats/spacers changed among the different strains analyzed.

References

  1. 1.
    Ashkenazi S, Cleary KR, Pickering LK, Murray BE, Cleary TG (1990) The association of Shiga toxin and other cytotoxins with the neurologic manifestations of shigellosis. J Infect Dis 161:961–965PubMedCrossRefGoogle Scholar
  2. 2.
    Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero DA, Horvath P (2007) CRISPR provides acquired resistance against viruses in prokaryotes. Science 315:1709–1712PubMedCrossRefGoogle Scholar
  3. 3.
    Bikard D, Hatoum-Aslan A, Mucida D, Marraffini LA (2012) CRISPR interference can prevent natural transformation and virulence acquisition during in vivo bacterial infection. Cell Host Microbe 12:177–186PubMedCrossRefGoogle Scholar
  4. 4.
    Bateman A, Rawlings ND (2003) The CHAP domain: a large family of amidases including GSP amidase and peptidoglycan hydrolases. Trends Biochem Sci 28:234–237PubMedCrossRefGoogle Scholar
  5. 5.
    Bennish ML, Harris JR, Wojtyniak BJ, Struelens M (1990) Death in shigellosis: incidence and risk factors in hospitalized patients. J Infect Dis 161:500–506PubMedCrossRefGoogle Scholar
  6. 6.
    Diez-Villasenor C, Almendros C, Garcia-Martinez J, Mojica FJ (2010) Diversity of CRISPR loci in Escherichia coli. Microbiology 156:1351–1361PubMedCrossRefGoogle Scholar
  7. 7.
    Horvath P, Barrangou R (2010) CRISPR/Cas, the immune system of bacteria and archaea. Science 327:167–170PubMedCrossRefGoogle Scholar
  8. 8.
    Haft DH, Selengut J, Mongodin EF, Nelson KE (2005) A guild of 45 CRISPRassociated (Cas) protein families and multiple CRISPR/Cas subtypes exist inprokaryotic genomes. PLoS Comput Biol 1:e60PubMedCentralPubMedCrossRefGoogle Scholar
  9. 9.
    Horvath P, Romero DA, Coute-Monvoisin AC, Richards M, Deveau H, Moineau S, Boyaval P, Fremaux C, Barrangou R (2008) Diversity, activity, and evolution of CRISPR loci in Streptococcus thermophilus. J Bacteriol 190:1401–1412PubMedCentralPubMedCrossRefGoogle Scholar
  10. 10.
    Jin Q, Yuan Z, Xu J, Wang Y, Shen Y, Lu W, Wang J, Liu H, Yang J, Yang F et al (2002) Genome sequence of Shigella flexneri 2a: insights into pathogenicity through comparison with genomes of Escherichia coli K12 and O157. Nucleic Acids Res 30:4432–4441PubMedCentralPubMedCrossRefGoogle Scholar
  11. 11.
    Makarova KS, Grishin NV, Shabalina SA, Wolf YI, Koonin EV (2006) A putative RNA-interference-based immune system in prokaryotes: computational analysis of the predicted enzymatic machinery, functional analogies with eukaryotic RNAi, and hypothetical mechanisms of action. Biol Direct 1:7PubMedCentralPubMedCrossRefGoogle Scholar
  12. 12.
    Touchon M, Rocha EP (2010) The small, slow and specialized CRISPR and anti-CRISPR of Escherichia and Salmonella. PLoS ONE 5:e11126PubMedCentralPubMedCrossRefGoogle Scholar
  13. 13.
    Makarova KS, Haft DH, Barrangou R, Brouns SJ, Charpentier E, Horvath P, Moineau S, Mojica FJ, Wolf YI, Yakunin AF (2011) Evolution and classification of the CRISPR/Cas systems. Nat Rev Microbiol 9:467–477PubMedCrossRefGoogle Scholar
  14. 14.
    Marraffini LA, Sontheimer EJ (2008) CRISPR interference limits horizontal gene transfer in staphylococci by targeting DNA. Science 322:1843–1845PubMedCentralPubMedCrossRefGoogle Scholar
  15. 15.
    Payne SM (1989) Iron and virulence in Shigella. Mol Microbiol 3:1301–1306PubMedCrossRefGoogle Scholar
  16. 16.
    Pleckaityte M, Zilnyte M, Zvirbliene A (2012) Insights into the CRISPR/Cas system of Gardnerella vaginalis. BMC Microbiol 12:301PubMedCentralPubMedCrossRefGoogle Scholar
  17. 17.
    Sneath PH, Mair NS, Sharpe ME, Holt JG (1986) Bergey’s manual of systematic bacteriology, vol 2. Williams & Wilkins, BaltimoreGoogle Scholar
  18. 18.
    Sorek R, Kunin V, Hugenholtz P (2008) CRISPR—a widespread system that provides acquired resistance against phages in bacteria and archaea. Nat Rev Microbiol 6:181–186PubMedCrossRefGoogle Scholar
  19. 19.
    Van Der Oost J, Jore MM, Westra ER, Lundgren M, Brouns SJ (2009) CRISPR-based adaptive and heritable immunity in prokaryotes. Trends Biochem Sci 34:401–407PubMedCrossRefGoogle Scholar
  20. 20.
    Wei J, Goldberg MB, Burland V, Venkatesan MM, Deng W, Fournier G, Mayhew GF, Plunkett G 3rd, Rose DJ, Darling A et al (2003) Complete genome sequence and comparative genomics of Shigella flexneri serotype 2a strain 2457T. Infect Immun 71:2775–2786PubMedCentralPubMedCrossRefGoogle Scholar
  21. 21.
    Xia S, Xu B, Huang L, Zhao J-Y, Ran L, Zhang J, Chen H, Pulsrikarn C, Pornruangwong S, Aarestrup FM (2011) Prevalence and characterization of human Shigella infections in Henan Province, China, in 2006. J Clin Microbiol 49:232–242PubMedCentralPubMedCrossRefGoogle Scholar

Copyright information

© Springer Science+Business Media New York 2014

Authors and Affiliations

  • Xiangjiao Guo
    • 1
  • Yingfang Wang
    • 2
  • Guangcai Duan
    • 1
    • 3
    Email author
  • Zerun Xue
    • 1
  • Linlin Wang
    • 1
  • Pengfei Wang
    • 1
  • Shaofu Qiu
    • 4
  • Yuanlin Xi
    • 1
  • Haiyan Yang
    • 1
  1. 1.College of Public HealthZhengzhou UniversityZhenghouChina
  2. 2.Henan University of Science and TechnologyLuoyangChina
  3. 3.Xinxiang Medical UniversityXinxiangChina
  4. 4.Academy of Military Medical SciencesBeijingChina

Personalised recommendations