Current Microbiology

, Volume 62, Issue 4, pp 1245–1252 | Cite as

Molecular Characterization of Morchella Species from the Western Himalayan Region of India

  • Harpreet Kaur Kanwal
  • Karan Acharya
  • G. Ramesh
  • M. Sudhakara Reddy
Article

Abstract

The molecular diversity of thirty-two different Morchella cultures/fruiting bodies, collected from the Western Himalayan region was studied in this investigation. Considerable taxonomic confusion exists regarding many species of Morchella. Although classical taxonomy is helpful in identification for many ascomycetes, morels exhibit considerable morphological diversity and there is disagreement in the identification of morel species. Phylogenetic analyses based on DNA sequences could help in sorting out morel taxonomy which is essential to better define the morel diversity. In this study, sequence analysis revealed that in the Western Himalayan region of India, both yellow (M. crassipes, M. spongiola) and black morels (M. elata, M. angusticeps, and M. gigas) were prominent along with two Verpa species. Phylogenetic analysis by maximum parsimony, maximum likelihood and Bayesian inference revealed two different clades and a clear distinction between yellow and black morels.

Introduction

True morels (Morchella spp.) belonging to ascomycetous fungi are highly prized for their edibility and appearance, which is similar to “a sponge on a stick”. Due to their unique flavor and rich nutritional value, these morels have been used in soups and gravies, as a source of medicinal adaptogens, immunostimulants, and antitumor agents [15]. Morels occur in different types of forest, with different mycelial dynamics, alternating between saprotrophic and symbiotic behaviors [24]. In India, morels are commonly known by the name of “Guchhi” and these grow abundantly in Jammu and Kashmir, Himachal Pradesh, and Uttaranchal during March to May and August to September [13, 20, 26]. Black fleshed fruit bodies are produced by M. angusticeps Peck, M. elata Fr., and M. conica Pers. While M. esculenta (L) Pers., M. crassipes (Vent.) Pers., and M. deliciosa Fr. produce yellow/white fruiting bodies [30].

Differentiating between the different species of morels has been the principal focus of recent molecular phylogenetic studies on morels [5, 24, 29, 30]. Berthet [2] used the criterion of total number of nuclei per spore to distinguish four families within the operculate discomycetes and to separate Morchellaceae as the group with highest number of nuclei per spore (coenosity level). Based on the morphological features, some researchers divide the genus Morchella into as high as 50 [8] and some into 3–6 species [27]. Based on the morphology, studies have revealed that there are three types of morels: yellow (Sectio adnate), black (Sectio distantes), and half-free [4]. Identification keys are based on shape, size, and colour change of ascocarp during developmental process may be highly polymorphic among species. Environmental and climatic factors along with the changes in the developmental process may induce the high degree of variability in the ascocarps [31]. So apart from the morphological features, molecular techniques are employed to assist the traditional taxonomy of fungi. For conducting phylogenetic studies, sequencing of ITS region consisting of 5.8S rRNA gene alongwith flanking ITS regions, LSU, SSU, RNA polymerase, and RAPD-PCR analysis have been found to be the most reliable tools in identification of fungi [3, 4, 6, 14, 19]. Recent reports have confirmed the identification of morels using these techniques [12, 16, 24].

Genetic studies such as amplification and sequencing of the whole of ITS/5.8S rRNA gene region in morels have confirmed the separation of the black and yellow morels exhibiting ITS/5.8S rRNA gene region lengths of 740–760 bp and 1150–1220 bp, respectively [29, 30]. Based on the morphological features, six species of morels have been reported from India: M. deliciosa Fr. (delicious morels), M. esculenta (L) Pers. ex Fr. (Common morel), M. conica Pers. (conical morels), M. crassipes (Vent.) Pers. (thick stemmed morel), M. angusticeps Peck., (Black morel), and M. hybrida Pers. (hybrid morel) [26].

A study has not been carried out for the genetic diversity and identity of morels occurring in the Western Himalayan region. In this study, the authors have examined the diversity of Morchella spp. from the Western Himalayan region of India by collecting the fruit bodies and studying the lengths of ITS/5.8S regions of rRNA. Inter and intraspecific polymorphism among these putative species of Morchella was observed based on the analysis of RFLP of ITS/5.8S rRNA gene regions and phylogenetic relationships of different Morchella spp.

Materials and Methods

Sampling, DNA Extraction, and PCR Amplification

Thirty-two distinct morphotypes of fruit bodies of Morchella (MR 1 to MR 29, F1, F2, and FK) were collected during the period from March 2005 to October 2009 from various geographical regions from Srinagar, Palampur, Narkanda, Solan, and other regions of the Western Himalayas (Fig. 1). These fruiting bodies were separated based on their morphological characters. Some of the dried fruit bodies were procured from the tribes local to these regions. A few cultures of morels available at Directorate of Mushroom Research, ICAR, Solan, India were also procured and used in this study (Table 1). Macroscopic morphological details of specimens such as size, shape, color were recorded. Microscopic features were determined from rehydrated sections of fruiting bodies mounted in 5% KOH and stained with 2% congo red. The spore measurements were recorded on twenty-five randomly selected spores using Nikon 50i eclipse microscope at a magnification of 40×. The macro and microscopic observations were performed according to the methods of Waraitch [26]. A scatter plot with the measurements of length and width of spores of different fruit bodies was performed. Linear regressions were performed to predict the value of spore length and width and different species of Morchella examined in this study. Voucher specimens were deposited in the Herbarium of Department of Botany, Punjabi Uninversity, Patiala, Punjab, India, with the voucher numbers PUN4117 to PUN4125.
Fig. 1

Map of Himachal Pradesh and Jammu and Kashmir, India, showing the distribution of morel collection sites

Table 1

A list of Morchella species and their collection locations from different regions of Himachal Pradesh and Jammu and Kashmir region of Western Himalayas, India

S. No.

Culture code

Location

State/province

Collection origin (N Latitude/E longitude)

1

MR 1

Sirmour

Himachal Pradesh

30.2230N, 77.0112E

2

MR 2, MR 5, MR 6, MR 7

Rohru

Himachal Pradesh

31.2167N, 77.7500E

3

MR 3, MR 15, MR 16, MR 17, MR 18

Chambaghat

Himachal Pradesh

30.923506N, 77.098768E

4

MR 4

Mandi

Himachal Pradesh

31.71119N, 76.952362E

5

MR 9, MR 10

Solan

Himachal Pradesh

30.924532N, 77.121277E

6

MR 19, MR 20

Narkanda

Himachal Pradesh

31.257772N, 77.460158E

7

MR 25, MR 26, MR 27, MR 28, MR 29

Shimla

Himachal Pradesh

31.097473N, 77.184448E

8

MR 8, MR 11, MR 12, MR 13, MR 14, F1, F2, FK

Palampur

Himachal Pradesh

32.114528N, 76.567841E

9

MR 21, MR 22, MR 23, MR 24

Srinagar

Jammu and Kashmir

34.068436N, 74.833374E

Fruiting bodies/cultures were crushed in liquid nitrogen and genomic DNA was extracted as described by Vankan et al. [25]. The isolated DNA was used as a template to amplify ITS regions together with the 5.8S rRNA gene through PCR, using universal primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) [28]. The 50 μl reaction mixture for PCR amplification contained: 10 ng DNA, 1× PCR buffer, 1.5 mM MgCl2, 0.2 mM of each dNTPs, 0.5 μM of each primer and 2.5 units of Taq DNA polymerase (Fermentas, USA). Amplifications were performed in a GeneAmp thermal cycler (Applied Biosystems, USA) with an initial denaturation step of 94°C for 3 min followed by 35 cycles of 94°C for 1 min., 50°C for 1 min., and 72°C for 1.5 min., and a final extension of 72°C for 8 min. ITS products of similar length were digested with different restriction enzymes (TaqI, HinfI, AluI, and MboI), as per the instructions of the manufacturer (Fermentas, USA), to study the RFLP patterns. Representative ITS/5.8S products of RFLP analysis and different-sized ITS products were used for cloning and sequencing. The representative cultures corresponding to groups of RFLP pattern were deposited at Microbial Type Culture Collection, Institute of Microbial Technology, Chandigarh, India (Accession Nos. MTCC10160–MTCC10170).

Cloning, Sequencing and Sequence Analysis

Prior to sequencing, PCR products were purified and subcloned using Ins T/A clone PCR cloning kits (Fermentas, USA) according to the manufacturer’s instructions and incorporated into transformed E. coli DH5α cells. Transformants were screened for the ITS insert and sequenced (DNA sequencing facility, South campus, University of Delhi, Delhi, India). The ITS/5.8 rRNA gene sequences were submitted to the GenBank NCBI database under the accession numbers GQ228461 to GQ228477, GQ249054, GQ281276, and GQ281277. A BLASTN [1] search was performed to find similar sequences in the NCBI database and the sequences having 98% and above similarity were used further for analyses. Because large insertions/deletions occur within Morchella, Verpa, and Gyromitra ITS sequences [24], phylogenetic analyses were based on the last part of ITS1 section (154 bp), the complete 5.8S (155 bp) and the first and last parts of the ITS2 section (256 bp). The sequences were edited with BioEdit 5.0.6 [7] and aligned using MAFFT v 6.240 [10] with other sequences obtained from GenBank. The alignment acquired from MAFFT was submitted to TreeBASE (http://www.treebase.org) and obtained the submission ID of 10765. Phylogenetic analysis was performed by a Maximum likelihood method. A Maximum likelihood Rapid Bootstrapping algorithm was implemented on the data set for 1000 replicates in the program RAxML v7.03 [21, 22, 23], using the GTRMIX model with parameters optimized for each partition. In addition, Bayesian phylogenetic analysis was carried out using the Metropolis-coupled Markov chain Monte Carlo method (MCMCMC), in MrBayes v3.04 [17], performing two runs each using four chains and 5,000,000 generations. To implement the optimal model in Bayesian analyses, the GTR model was specified. The substitution rate matrix, transition/transversion rate ratio, character state frequencies, gamma shape parameter α, and the proportion of invariant sites were unlinked across the ITS partitions. Trees were sampled every 100th generation. The proportion of burn-in trees sampled before reaching equilibrium was estimated by plotting likelihood scores as a function of the number of generations. Only Bayesian posterior probabilities (PP) greater than or equal to 0.95 are considered significant and shown on tree. The output tree was evaluated with the program TREEVIEW (http://taxonomy.zoology.gla.ac.uk/rod/rod.html).

Results

The morphological characters of the fruit bodies are represented in Table 2. Fruit bodies of MR 1 had yellow colored apothecium (15.2–18.5 cm) and spore sizes of 21.13–28 × 11.95–15.5 μm (mean value, 24.39 × 13.82 μm), Q (length/width ratio) = 1.76. Fruit bodies of MR 8 and MR 20, too, had yellow colored apothecia with spore sizes of 21–27.49 × 12.95–15.32 μm (mean value, 24.12 × 14.47 μm), Q = 1.67 and spore sizes of 22–27.5 × 11.05–14.58 μm (mean value, 25.21 × 12.8), Q = 1.96, respectively. Black colored apothecia were observed in MR 3, FK, and MR 6. Fruit bodies of MR 3 had spore sizes of 22.4–28 × 10.47–15.25 μm (mean value, 25.96 × 12.9 μm), Q = 1.9. FK fruit bodies had spore sizes of 21–27.94 × 11.58–17.3 μm (mean value, 25.13 × 15 μm), Q = 1.67 whereas MR 6 fruit bodies had spore sizes of 21–28 × 12.22–19.22 μm (mean value, 25.1 × 16.7 μm), Q = 1.5. The results of scatter plot revealed that there are variations in the spores of different fruit bodies (Fig. 2).
Table 2

Morphological characteristics of Morchella spp. collected from different regions of the Western Himalayas, India

Culture code

Nearest match

Fruit body colour

Apothecia (cm)

Pileus (cm)

Stipe (cm)

Ascus length/width (μm)

Spore morpholgy/size

MR 1

M. crassipes

Yellow

15.2–18.5

10.3–11.6 × 4.8–5.5

9–11.5 × 1.9–2.4

245–350 × 17.3–22.2

21.1–28 × 11.9–15.5 μm, uniseriate, subhyaline, ellipsoid, smooth, oil droplets present at each end

MR 8

M. crassipes

Yellow

15–17.8

10.3–11.7 × 4–5

10–12.5 × 1.4–2.1

255–289 × 16.8–26.2

21–27.5 × 12.9–15.32 μm, uniseriate, subhyaline, ellipsoid, smooth, oil droplets present at each end

MR 20

M.crassipes

Yellow

15–18.4

9.5–11.4 × 3.8–5.21

10–12 × 1.8–2

263–338 × 17.7–25.34

22–27.5 × 11–14.6 μm, uniseriate, subhyaline, ellipsoid, smooth, oil droplets present at each end

MR 3

M. elata

Black

7.5–12.5

7.5–10 × 4.8–5.2

6.3–8.0 × 2.5–3.8

250–380 × 18–26

22.4–28 × 10.5–15.2 μm, uniseriate, subhyaline, ellipsoid, smooth, oil droplets present at each end

FK

M. elata

Black

5.5–11.9

7.2–9.8 × 4.2–5.5

6.5–8.5 × 2.3–3.5

262–371 × 17.4–25.4

21–27.9 × 11.6–17.3 μm, uniseriate, subhyaline, ellipsoid, smooth, oil droplets present at each end

MR 6

M. elata

Black

6.3–10.6

6.3–9.4 × 4.5–5.5

7–8.2 × 2.1–4

272–363 × 18.35–26

21–28 × 12.2–19.2 μm, uniseriate, subhyaline, ellipsoid, smooth, oil droplets present at each end

Fig. 2

Scatter plot and line of best fit showing the relationship between a length and b width of spores of different Morchella isolates

Amplification of ITS/5.8S rRNA region of morels using ITS1 and ITS4 primers resulted in different size products ranging from 700 bp to 1,200 bp. Sequence data from BLAST results showed that out of thirty-two morel species studied, thirty belonged to Morchella species and the two were Verpa species (MR 22 and FK). Among the Morchella spp., sixteen isolates showed ITS size of ~1.2 kbp (MR1, MR 5, MR 8, MR 9, MR 11, MR 12, MR 13, MR 14, MR 18, MR 20, MR21, MR 25, MR 26, MR 27, MR 28, and MR 29), eleven showed a size of ~750 bp (MR 3, MR 4, MR 6, MR 10, MR 15, MR 16, MR 19, MR 23, MR 24, F1, and FK), and each showed sizes of ~1000 bp (MR 17), ~950 bp (MR 2), and ~800 bp (MR 7). RFLP analyses of all 16 isolates using the 1.2 kbp ITS region with restriction enzymes showed five different restriction patterns comprising Group I with MR 1, MR 9, MR 11, MR 12, MR 13, and MR 14; group II with MR 5, MR 25, MR 26, MR 27, MR 28, and MR 29; group III with MR 8; group IV with MR 18, MR 20, and group V with MR 21. Restriction digestion of 11 isolates having ITS size of 750 bp showed similar banding patterns. The ITS products of the representative fruit bodies from each group of 1.2 kbp (MR 1, MR 5, MR 8, MR 12, MR 18, MR 20, and MR 21) and 750 bp (MR 3, MR 4, MR 6, MR 10, MR 23, MR 24, F1, and FK) were then cloned and sequenced. Similarly, different-sized ITS products of the fruit bodies (MR 2, MR 7, and MR 17) were also cloned and sequenced.

Sequence analysis using BLASTN revealed that the sequences of seven fruit bodies (MR1, MR 5, MR 8, MR 12, MR 18, MR 20, and MR 21) having an ITS size of 1.2 kbp showed close similarity (97–99%) with M. crassipes. The sequence of MR 17 showed very close similarity (99%) with M. spongiola. The sequences of MR 3, MR 4, MR 6, MR 10, MR 23, F1, and FK having an ITS size of 750 bp showed close similarity (98–99%) with M. elata and MR 24 showed very close similarity (99%) with M. angusticeps. Sequence analysis of MR 7 showed similarity to M. gigas; MR 2 (ITS of 955 bp) did not correspond to any similar sequence in the NCBI databases indicating this might be a new species of Morchella.

The ML and BI analyses resulted in nearly identical phylogenetic trees (Fig. 3). The phylogenetic reconstructions clustered all Morchella sequences into two clades differentiating yellow and black morles. Verpa spp. (MR 22 and FK) of this study were excluded while analyzing. Sequences of Verpa bohemica (GQ304945, AJ698479) were used as an outgroup taxa to root the tree. The clade of yellow morels was further divided into different groups; crassipes group, spongiola group, rufobrunnea, and esculenta group, whereas the black morels were divided into elata, conica, gigas, tomentosa, costata, and angusticeps groups. The tree showed the yellow morels- M. spongiola, M. esculenta, M. rufobrunnea and M. crassipes grouped into a cluster and supported by high bootstrap and PP values. Several sequences, namely MR 1, MR 5, MR 8, MR 12, MR 18, MR 20, and MR 21, belonged to the crassipes group, while MR 17 belonged to the spongiola group. Black morels, namely, M. elata, M. angusticeps, M.costata, M. tomentosa and M. gigas clustered into one clade. Sequences such as F1, FK, MR 4, MR 3, MR 10, MR 6, and MR 23 were grouped with M. elata, MR 24 was clustered with angusticeps group, and MR 7 clustered to the gigas group. All of the groups were strongly supported by high bootstrap and PP values. The sequence of MR 2 clustered with M. tomentosa group and separated with tomentosa branch, indicating it might be a new species from India.
Fig. 3

The best ML tree based on the analyses of ITS/5.8S rRNA gene sequences, resulting from a 1,000 replicates Rapid Bootstrapping algorithm and a ML search in RAxML. The number within parentheses indicates the GenBank accession number. Different clades and groups have been marked and their significance is referred to in the text. BP value followed by PP values is shown at the nodes

Discussion

This study showed that in the Western Himalayan region of India, both yellow (M. crassipes, M. spongiola) and black morels (M. elata, M. angusticeps, and M. gigas) are present. Among the yellow morels, species differentiation between M. crassipes and M. esculenta is very difficult, as there are minute variations in their morphology. Morphologically, these two are similar in color, but the size of apothecia (15–18.5 cm), stipe (10–12.5 × 1.8–2.2 cm), pileus (10–12 × 4.5–5.5 cm), ascus (255–325 × 18–25 μm), ascospores (21–26 × 12–15.5 μm) of M. crassipes differs from M. esculenta (the size of apothecia 15–19 cm, stipe 8.5–10 × 3.2–5.4 cm, pileus 7–8.6 × 5–6.2 cm, ascus 215–355 × 16.5–25 μm, ascospores 17–25 × 11–13.5 μm) [26, 27]. Further, the differences between M. crassipes and M. esculenta at the molecular level were even less evident from the reported NCBI databases. Kellner et al. [11] differentiated M. crassipes,M. spongiola, and M. esculenta based on the RFLP pattern of ITS fragments with different enzymes, such as AluI, TaqI, MboI, BsuRI, and MspI. But the restriction patterns of M. crassipes and M. spongiola in this study were different for the same species reported by Kellner et al. [11]. Among the cultures having ITS size of 1.2 kbp, showing homology to M. crassipes, no AluI site is reported except in MR 21. These results suggest that in yellow morels, species differentiation using restriction enzyme analysis in the ITS region does not consistently perform for morels at the species level. These results are contrary to those reported by Kellner et al. [11].

A BLAST search using the 1.2 kbp ITS sequence from our collections has shown close similarity with M. crassipes, but not with M. esculenta. There are a few reports of the occurrence of M. esculenta from North India [9, 26], but the identification is entirely based on the external morphological features and not supported with molecular taxonomy. Hence the identification of M. esculenta (which might be M. crassipes) might be incorrect, as morphologically there are very small differences exist between M. crassipes and M. esculenta. According to the available literature, six species of Morchella have been reported in India: M. deliciosa, M. esculenta, M. conica, M. crassipes, M. angusticeps, and M. hybrida [26]. Morphological variability of ascomata development is influenced by climatic and biogeographical conditions. Nevertheless, this study revealed six different (putative) species of Morchella and two different species of Verpa in the Western Himalayan region.

The phylogenetic trees (Fig. 3) separated the yellow (M. crassipes and M. spongiola) and black morels (M. elata, M. angusticeps, M. conica, and M. gigas) into distinct clades. This data supports the findings of some researchers [3, 4, 18, 24]. The phylogenetic tree did not resolve the relationships of some of the Morchella species of this study with other morel clades. Within the crassipes groups, little intraspecific variation was found. Slight variation was found in M. crassipes MR 21 versus the other collections corresponding to M. crassipes. The variation could be due to geographical isolation of different areas. More variation may occur between geographically isolated populations of the same species of Morchella than between two putatively distinct species [31]. Black morels were grouped together into a single clade containing M. conica, Morchella sp. MR 2, M. elata, M. gigas, and M. angusticeps. In this study, M. crassipes and M. elata were found to be cryptic species. As suggested by Stefani et al. [24], phylogenetic analyses of a well- identified morels based on coding genes are required to better resolve the relationships of the different morel clades and to increase understanding of their ecology.

Conclusion

In conclusion, it is proposed that in the Western Himalayan region of India, there are mainly two types of morels; yellow morels comprising M. crassipes and M. spongiola; and black morels comprising M. elata, M. angusticeps, Morchella sp. (MR 2), and M. gigas. Sequence analysis in this study showed that out of thirty-two morel species studied, thirty belonged to Morchella species and two were found to be of false morels Verpa species (MR 22 and FK).

References

  1. 1.
    Altschul SF, Gish W, Miller W, Myers FW, Lipman DJ (1990) Basic local alignment serach tool. J Mol Biol 215:403–410PubMedGoogle Scholar
  2. 2.
    Berthet P (1964) Essai biotaxonomique sur les discomyce`tes. PhD Thesis, Faculte′ des Sciences de l’Universite′ de Lyon, LyonGoogle Scholar
  3. 3.
    Bunyard BA, Nicholson MS, Royse DJ (1994) A systematic assessment of Morchella using RFLP analysis of the 28S ribosomal RNA gene. Mycologia 86:762–772CrossRefGoogle Scholar
  4. 4.
    Bunyard BA, Nicholson MS, Royse DJ (1995) Phylogenetic resolution of Morchella, Verpa and Disciotis [Pezizales: Morchellaceae] based on restriction enzyme analysis of the 28S ribosomal gene. Exp Mycol 19:223–233PubMedCrossRefGoogle Scholar
  5. 5.
    Buscot FD, Wipf C, Battista DI, Munch JC, Botton B, Martin F (1996) DNA polymorphism in morels. I. PCR/RFLP analysis of the ribosomal DNA spacers and microsatellite primed PCR. Mycol Res 100:63–71CrossRefGoogle Scholar
  6. 6.
    Diez J, Manjo JL, Martin F (2002) Molecular phylogeny of the mycorrhizal desert truffles (Terfezia and Tirmania), host specificity and edaphic tolerance. Mycologia 94:247–259PubMedCrossRefGoogle Scholar
  7. 7.
    Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucl Acids Symp Ser 41:95–98Google Scholar
  8. 8.
    Jacquetant E (1984) Les morilles. Plantanida, Lausanne, SwitzerlandGoogle Scholar
  9. 9.
    Jandaik CL, Sharma SR (1995) Present status of Morchella in India. In: Chadha KL, Sharma SR (eds) Advances in Horticulture, pp 171–194Google Scholar
  10. 10.
    Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence alignment program. Brief Bioinfo 9:286–298CrossRefGoogle Scholar
  11. 11.
    Kellner H, Renker C, Buscot F (2005) Species diversity within the Morchella esculenta group (Ascomycota: Morchellaceae) in Germany and France. Org divers Evol 5:101–107CrossRefGoogle Scholar
  12. 12.
    Kuo M (2009) Morchella tomentosa, a new species from Western North America, and notes on M. rufobrunnea. Mycotaxon 105:441–446Google Scholar
  13. 13.
    Lakhanpal TN, Shad OS (1986) Studies on wild edible mushrooms of Himachal Pradesh (N.W.Himalayas). II. Ecological relationships of Morchella species. Indian J of Mushrooms 12:15–20Google Scholar
  14. 14.
    Nilsson RH, Kristiansson E, Ryberg M, Larsson KH (2005) Approaching the taxonomic affiliation of unidentified sequences in public databases—an example from the mycorrhizal fungi. BMC Bioinfo 6:178CrossRefGoogle Scholar
  15. 15.
    Nitha B, Meera CR, Janardhanan KK (2007) Anti-inflammatory and antitumour activities of cultured mycelium of morel mushroom, Morchella esculenta. Curr Sci 92:235–239Google Scholar
  16. 16.
    Pilz D, Weber N, Carter M, Parks C, Molina R (2004) Productivity and diversity of morel mushrooms in healthy, burned and insect-damaged forests of northeastern Oregon. For Ecol Manag 198:367–386CrossRefGoogle Scholar
  17. 17.
    Ronquist F, Huelsenbeck JP (2003) MRBAYES3: bayesian phylogenetic inference under mixed models. Bioinfo 19:1572–1574CrossRefGoogle Scholar
  18. 18.
    Royse DJ, May B (1990) Interspecific allozyme variation among Morchella spp. and its interferences for systematics within the genus. Biochem Syst Ecol 18:475–479CrossRefGoogle Scholar
  19. 19.
    Ryber M, Nilsson RH, Kristiansson E, Topel M, Jacobsson S, Larsson E (2008) Mining metadata from unidentified ITS sequences in GenBank: a case study in Inocybe (Basidiomycota). BMC Evol Biol 8:50CrossRefGoogle Scholar
  20. 20.
    Sohi HS, Kumar S, Seth PK (1965) Some interesting fleshy fungi from Himachal Pradesh. J Indian Bot Soc 54:69–73Google Scholar
  21. 21.
    Stamatakis A (2006a) Phylogenetic models of rate heterogeneity: a high performance computing perspective. In: Proceedings of IPDPS 2006. Rhodos, p 8Google Scholar
  22. 22.
    Stamatakis A (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinfo 22:2688–2690CrossRefGoogle Scholar
  23. 23.
    Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap algorithm for the RAxML Web Servers. Syst Biol 57:758–771PubMedCrossRefGoogle Scholar
  24. 24.
    Stefani OPF, Sokolski S, wurtz T, Piche Y, Hamelin R, Fortin A, Berube JA (2010) Morchella tomentosa: a unique belowground structure and a new clade of morels. Mycologia 102:1082–1088PubMedCrossRefGoogle Scholar
  25. 25.
    VanKan JAL, van den Ackerveken GFJM, de Wit PJGM (1991) Cloning and characterization of the cDNA of avirulence avr9 pathogen Cladosporium fulvum, the causative agent of tomato leaf mild. Mol Plant Microbe Interact 4:52–59CrossRefGoogle Scholar
  26. 26.
    Waraitch KS (1976) The genus Morchella in India. Kavaka 4:69–76Google Scholar
  27. 27.
    Weber NS (1988) A morel hunters companion. Twopeninsula, LansingGoogle Scholar
  28. 28.
    White TJ, Bruns T, Lee S, Taylor J (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds) PCR protocols: a guide to methods and applications. Academic, San Diego, pp 315–322Google Scholar
  29. 29.
    Wipf D, Fribourg A, Munch JC, Botton B, Buscot F (1999) Diversity of the internal transcribed spacer of rDNA in morels. Can J Micro 45:769–778CrossRefGoogle Scholar
  30. 30.
    Wipf D, Munch JC, Botton B, Buscot F (1996) DNA polymorphism in morels: complete sequences of the internal transcribed spacer of genes coding for rRNA in Morchella esculenta (yellow morel) and Morchella conica (black morel). Appl Environ Microbiol 62:3541–3543PubMedGoogle Scholar
  31. 31.
    Yoon CS, Gessner RV, Romano MA (1990) Population genetics and systematics of the Morchella esculenta complex. Mycologia 82:227–235CrossRefGoogle Scholar

Copyright information

© Springer Science+Business Media, LLC 2010

Authors and Affiliations

  • Harpreet Kaur Kanwal
    • 1
  • Karan Acharya
    • 1
  • G. Ramesh
    • 1
  • M. Sudhakara Reddy
    • 1
  1. 1.Department of BiotechnologyThapar UniversityPatialaIndia

Personalised recommendations