Applied Microbiology and Biotechnology

, Volume 98, Issue 15, pp 6739–6750 | Cite as

Enhancement of free fatty acid production in Saccharomyces cerevisiae by control of fatty acyl-CoA metabolism

  • Liwei Chen
  • Jianhua Zhang
  • Jaslyn Lee
  • Wei Ning Chen
Applied genetics and molecular biotechnology

Abstract

Production of biofuels derived from microbial fatty acids has attracted great attention in recent years owing to their potential to replace petroleum-derived fuels. To be cost competitive with current petroleum fuel, flux toward the direct precursor fatty acids needs to be enhanced to approach high yields. Herein, fatty acyl-CoA metabolism in Saccharomyces cerevisiae was engineered to accumulate more free fatty acids (FFA). For this purpose, firstly, haploid S. cerevisiae double deletion strain △faa1△faa4 was constructed, in which the genes FAA1 and FAA4 encoding two acyl-CoA synthetases were deleted. Then the truncated version of acyl-CoA thioesterase ACOT5 (Acot5s) encoding Mus musculus peroxisomal acyl-CoA thioesterase 5 was expressed in the cytoplasm of the strain △faa1△faa4. The resulting strain △faa1△faa4 [Acot5s] accumulated more extracellular FFA with higher unsaturated fatty acid (UFA) ratio as compared to the wild-type strain and double deletion strain △faa1△faa4. The extracellular total fatty acids (TFA) in the strain △faa1△faa4 [Acot5s] increased to 6.43-fold as compared to the wild-type strain during the stationary phase. UFA accounted for 42 % of TFA in the strain △faa1△faa4 [Acot5s], while no UFA was detected in the wild-type strain. In addition, the expression of Acot5s in △faa1△faa4 restored the growth, which indicates that FFA may not be the reason for growth inhibition in the strain △faa1△faa4. RT-PCR results demonstrated that the de-repression of fatty acid synthesis genes led to the increase of extracellular fatty acids. The study presented here showed that through control of the acyl-CoA metabolism by deleting acyl-CoA synthetase and expressing thioesterase, more FFA could be produced in S. cerevisiae, demonstrating great potential for exploitation in the platform of microbial fatty acid-derived biofuels.

Keywords

Saccharomyces cerevisiae Acyl-CoA synthetase Acyl-CoA thioesterase Free fatty acids 

Introduction

Renewable synthesis of microbial fatty acid-derived biofuels and chemicals is a promising approach to cope with the current energy crisis. Through metabolic engineering of the fatty acid synthetic and degradation pathway, fatty acid-derived biofuels and biochemicals can be accumulated in microbes, such as alkanes (Choi and Lee 2013; Howard et al. 2013; Schirmer et al. 2010), alcohol (Steen et al. 2010; Zheng et al. 2012), and biodiesel (Lu et al. 2008; Steen et al. 2010). It has been shown that the profile of free fatty acids (FFA) can be efficiently modified, for application in biofuel production, through overexpressing thioesterase with different chain length acyl-ACPs preference in Escherichia coli (Howard et al. 2013; Torella et al. 2013; Zheng et al. 2012).

Although the number of literature published on fatty acid production using Saccharomyces cerevisiae is far more limited than E. coli, S. cerevisiae has its own advantages which make it an appealing host. It is a robust industrial organism that can grow under low pH and various harsh environmental conditions. It has a fully sequenced genome (Cherry et al. 2012), availability of good genetic tools, and well-characterized metabolic pathways (Krivoruchko et al. 2011). Hence, in recent years, there is increased interest in developing S. cerevisiae as a cell factory for fatty acid-derived biofuel production. Production of biodiesel was engineered in S. cerevisiae by the expression of heterologous lipase 2, which can convert triacylglycerol or FFA to fatty acid ethyl esters (Liu et al. 2013). In another report, S. cerevisiae was transformed into an oleaginous yeast with a high level of fatty acid production through overexpression of the active diacylglycerol acyltransferase Dga1p (Kamisaka et al. 2013). Intracellular long chain fatty acid accumulation was enhanced by disrupting the citrate turnover and overexpressing a heterologous ATP-citrate lyase, which led to a 1.92-fold increase in C16:1 and a 1.77-fold increase in C18:1 (Tang et al. 2013). Moreover, short chain fatty acids were successfully produced in S. cerevisiae by using the heterologous Homo sapiens type I fatty acid synthase (hFAS) with the heterologous short chain thioesterases from Cuphea palustris (CpFatB1) or Rattus orvegicus (TEII) (Leber and Da Silva 2013).

In E. coli, fatty acids are synthesized by a dissociated type II fatty acid synthetase (FAS) system, with several of its enzymes feedback-inhibited by long chain fatty acyl-ACPs (Magnuson et al. 1993). It has been shown that overexpression of acyl-ACP thioesterases can relieve the feedback inhibition (Jiang and Cronan 1994), modify the composition of fatty acid (Voelker and Davies 1994), and lead to an overproduction of significant levels of FFA (Lu et al. 2008). On the other hand, S. cerevisiae uses type I FAS system and only fatty acyl-CoAs can be released from the FAS complex. It has been proposed that the MPT domain of FAS is able to transfer C6–C18 substrates with comparable efficiencies. The chain length distribution of fungal FAS products is regulated by the equilibrium of substrate and product concentrations. However, C16/C18 fatty acyl-CoAs are preferentially synthesized under physiological conditions (Leibundgut et al. 2008). Acyl-CoA esters have been proposed as key regulators of fatty acid synthesis since 1963 (Bortz and Lynen 1963). It has been shown that long chain acyl-CoAs regulate several enzymes involved in lipid synthesis (Faergeman and Knudsen 1997) by feedback inhibition of ACC1 (Kamiryo et al. 1976), FAS (Sumper and Träuble 1973), and OLE1 (Choi et al. 1996). Studies showed that dimyristoyl-lecithin dispersions, E. coli plasma membranes, and BSA relieved the inhibition of acyl-CoAs on yeast FAS (Sumper and Träuble 1973). It is believed that the low intracellular concentration of acyl-CoAs (0.1–200 nM) is tightly controlled by the feedback inhibitory mechanism, buffered by acyl-CoA binding proteins, and regulated by acyl-CoA synthetases, carnitine acyltransferase and acyl-CoA hydrolase (Faergeman and Knudsen 1997). The studies concerning acyl-CoA synthetases and carnitine acyltransferase have been well reviewed (Black and DiRusso 2007; Ramsay et al. 2001). However, knowledge of the acyl-CoA hydrolase in yeast is sparse. The only well-characterized acyl-CoA hydrolase in S. cerevisiae is peroxisomal acyl-CoA thioesterase PTE1, which is involved in fatty acid degradation, rather than fatty acid synthesis (Jones et al. 1999; Maeda et al. 2006). In this regard, the role of cytosolic thioesterase is not well illustrated in S. cerevisiae. So far, it is unclear if the acyl-CoA thioesterase can alleviate the feedback inhibition of long chain acyl-CoAs in a similar fashion as in E. coli.

Assuming that regulating the metabolism of fatty acyl-CoAs can in turn regulate the fatty acid accumulation, herein we engineered a strain of S. cerevisiae defective in acyl-CoA synthetases, and also carrying a heterologous acyl-CoA thioesterase ACOT5s which encodes a short version of Mus musculus peroxisomal acyl-CoA thioesterase 5. Previously, acyl-CoA synthetases have been shown to regulate the fatty acid metabolism (Black and DiRusso 2007). In our study, the FAA1 and FAA4 genes which encode the prominent acyl-CoA synthetases were firstly deleted to block the transformation of FFA to fatty acyl-CoAs. Secondly, ACOT5 (PTE-1c) from M. musculus was chosen to be expressed in the cytoplasm of S. cerevisiae to increase the production of FFA (Fig. 1). ACOT5 is a medium chain acyl-CoA thioesterase acting on C6-CoA to C20-CoA, with the highest activity with C10-CoA. It was shown to produce FFA and also participate in the transportation system in M. musculus peroxisomes (Westin et al. 2004). Then fatty acid and metabolite profiles were investigated to evaluate its potential in biofuel production.
Fig. 1

Engineering S. cerevisiae for high levels of FFA accumulation. Double deletion of FAA1 and FAA4 and expression of cytosolic acyl-CoA thioesterase encoded by Acot5s enhanced the flux to FFA, released the repression of fatty acyl-CoAs on fatty acid synthetase, and accumulated more FFA

Materials and methods

Strains and growth conditions

All yeast strains and plasmids used in this study were listed in Table 1. YPD complete medium [1 % Bacto yeast extract, 2 % Bacto peptone, 2 % dextrose] was used to cultivate the wild-type strain. Drop-out medium (YNBD) comprised of 0.67 % yeast nitrogen base (without amino acids but with ammonium sulfate, Invitrogen), 2 % dextrose, and amino acid drop out (without His or Ura, Clontech) was used to cultivate the modified strains; 200 μg/ml geneticin was added when necessary.
Table 1

Plasmids and strains list

Name

Description

Source

WT

S. cerevisiae wild-type strain BY4741 (Mat a; his3△1; leu2△0; met15△0; ura3△0)

EUROSCARF

△faa1

BY4741; Mat a; his3△1; leu2△0; met15△0; ura3△0; FAA1::His5

Present study

△faa4

BY4741; Mat a; his3△1; leu2△0; met15△0; ura3△0; FAA4::kanMX4

Present study

△faa1△faa4

BY4741; Mat a; his3△1; leu2△0; met15△0; ura3△0; FAA4::kanMX4; FAA1::His5

Present study

WT[pVTU260]

Wild-type strain transformed with pVTU260

Present study

△faa1[pVTU260]

△faa1 transformed with pVTU260

Present study

△faa4[pVTU260]

△faa4 transformed with pVTU260

Present study

△faa1△faa4[pVTU260]

△faa1△faa4 transformed with pVTU260

Present study

WT[Acot5s]

Wild-type strain transformed with pVTU260-Acot5s

Present study

△faa1[Acot5s]

△faa1 transformed with pVTU260-Acot5s

Present study

△faa4[Acot5s]

△faa4 transformed with pVTU260-Acot5s

Present study

△faa1△faa4 [Acot5s]

△faa1△faa4 transformed with pVTU260-Acot5s

Present study

pUG6

loxP-kanMX-loxP gene disruption cassette plasmid

Gueldener et al. (2002)

pUG27

loxP-his5-loxP gene disruption cassette plasmid

Gueldener et al. (2002)

pVTU260

Eukaryotic expression vector with ADH1 promoter and terminator, URA3 maker

EUROSCARF

pVTU260-Acot5s

The mouse Acot5 gene without the nucleotide sequence encoding C-terminal peroxisomal targeting tripeptide of -AKL, cloned into pVTU260

Present study

Plasmid and strain construction

Molecular cloning was performed according to standard procedures. Q5® High-Fidelity DNA Polymerase and restriction enzymes were purchased from New England Biolabs (Singapore). Cold fusion cloning kit was purchased from SBI (Singapore). Oligonucleotide primers (Table 2) were synthesized at 1st BASE Pte Ltd (Singapore).
Table 2

Primers list

Name

Description

Sequence (5′ → 3′)

FAA1-F

Forward deletion primer containing 45 bp of homology upstream of the FAA1 gene

CAATAAAAACTAGAACAAACACAAAAGACAAAAAAAGACAACAATcagctgaagcttcgtacgc

FAA1-R

Reverse deletion primer containing 45 bp of homology downstream of the FAA1 gene

TGCTTTAGTATGATGAGGCTTTCCTATCATGGAAATGTTGATCCAgcataggccactagtggatctg

FAA4-F

Forward deletion primer containing 45 bp of homology upstream of the FAA4 gene

TCTGTTCTTCACTATTTCTTGAAAAACTAAGAAGTACGCATCAAAcagctgaagcttcgtacgc

FAA4-R

Reverse deletion primer containing 45 bp of homology downstream of the FAA4 gene

GTGTTTATGAAGGGCAGGGGGGAAAGTAAAAAACTATGTCTTCCTgcataggccactagtggatctg

FAA1-A

Verification primer for FAA1 gene

TAGAACAAACACAAAAGACA

FAA1-B

Verification primer for FAA1 gene

TTTGGCTCACCTGTAGAA

FAA1-C

Verification primer for FAA1 gene

ATCTGCCCTATGCTTATT

FAA1-D

Verification primer for FAA1 gene

CTTTAGTATGATGAGGCTTT

FAA4-A

Verification primer for FAA4 gene

ACTAAGAAGTACGCATCAA

FAA4-B

Verification primer for FAA4 gene

ATCAACCCACTCAGCAAG

FAA4-C

Verification primer for FAA4 gene

CTTTACCGATGATGGCT

FAA4-D

Verification primer for FAA4 gene

TGTTTATGAAGGGCAGGG

kanr/his5+-S

Verification primer for disruption cassette

GCCACTGAGGTTCTTCTTT

kanr/his5+-A

Verification primer for disruption cassette

GACCAGCATTCACATACGAT

ACOT5s-F

Forward primer for cloning Acot5s into pVTU260

tgcaccatcaccatcaccATGCTAGCCAAAGGTAAGCC

ACOT5s-R

Reverse primer for cloning Acot5s into pVTU260

cctgaaaataaagattctcgctagTCAAGGACTAGGTCTCTTGTCACC

ACOT5s-C-F

Forward colony PCR primer

TGGTCCCTACTGTCTCAT

ACOT5s-C-R

Reverse colony PCR primer

ACCCAAACCTGGCAAT

ADHp

Forward sequencing primer

CGACAAAGACAGCACCAA

ADHt

Reverse sequencing primer

TGCTGCCACTCCTCAA

ACT1-F

Forward RT-PCR primer

ATGGTCGGTATGGGTCA

ACT1-R

Reverse RT-PCR primer

GATTTAGGGTTCATTGGAG

ACC1-F

Forward RT-PCR primer

TTATGAACGCTTCCTTGC

ACC1-R

Reverse RT-PCR primer

AGAACGTGCAACTAACTC

FAS1-F

Forward RT-PCR primer

CCCCAGACAAGGACTA

FAS1-R

Reverse RT-PCR primer

TACGGAGACGAAGAAGGAT

FAS2-F

Forward RT-PCR primer

GACTTCTACAAGAGGGACC

FAS2-R

Reverse RT-PCR primer

CCAATGACGGGATTACC

OLE1-F

Forward RT-PCR primer

AACCGCTTTCGTCATTCC

OLE1-R

Reverse RT-PCR primer

ATGTAATGAGCCAAGGAG

POX1-F

Forward RT-PCR primer

AGTTATACAACGCTTCCT

POX1-R

Reverse RT-PCR primer

CCACCCAGTCGTCATAG

FAA2-F

Forward RT-PCR primer

TTACATAAACCAGACCCA

FAA2-R

Reverse RT-PCR primer

CCACCTCTTGCGGTAAAT

To delete gene FAA1 and FAA4, loxP-marker gene-loxP gene disruption cassettes were generated by PCR as described in Fig. S1 (Gueldener et al. 2002). After purification, loxP-His5-loxP and loxP-KanMX-loxP gene disruption cassettes were transformed into wild-type competent cells, respectively. After screening on YNBD-His agar plate and YPD agar plate containing 200 μg/ml geneticin separately, the deletion strains △faa1 and △faa4 were obtained and verified by colony PCR. Then, loxP-His5-loxP gene disruption cassette for deleting the gene FAA1 was transformed into △faa4-competent cells and screened on YNB-His agar plate containing 200 μg/ml geneticin. The deletion strain △faa4△faa1 was obtained and verified by colony PCR (Fig. S2).

The gene ACOT5 (GenBank accession no. NM_145444.3) which encodes the peroxisomal acyl-CoA thioesterase 5 from M. musculus was synthesized by Genescript (Singapore), with codon optimization. The GenBank accession number for the codon-optimized sequence of ACOT5 is KF573587. In the synthesized ACOT5 gene, a V5-tag was introduced before the start codon. To construct the expression plasmid pVTU260-Acot5s, a truncated version of the ACOT5 gene, which does not contain the nucleotides encoding the C-terminal peroxisomal targeting peptide AKL, was generated by PCR using primers ACOT5s-F and ACOT5s-R. The purified PCR product of ACOT5s was mixed with linearized pVTU260 vector. Then cold fusion reaction and transformation were carried out according to the manual. The resulting plasmid pVTU260-Acot5s was verified by restriction analysis and sequencing (the procedure is illustrated in Fig. S3).

Expression analysis of Acot5s

Cell pellet was collected from 5 ml cell culture by centrifugation at 8,000 rpm. After washing, the cell pellet was resuspended in lysis buffer containing 50 mM HEPES, 5 % glycerol, 1 mM DTT, 1 mM PMSF, and 1 mM EDTA to a final optical density of 50 ~ 100 at 600 nm (OD600). Then 300 μl acid-washed glass beads were added into the resuspended cells, and the cells were broken using a FastPrep®-24 Instrument (6004–500, MP Biomedicals) for 30 s and cooled on ice for 30 s and repeated four times. Next the cells were centrifuged at 12,000 rpm for 10 min at 4 °C. Twenty microliters of cell lysate was combined with SDS-PAGE loading buffer, and the sample was boiled at 95 °C for 5 min and separated on a 10 % SDS-PAGE gel in a Bio-Rad Mini-PROTEAN Tetra Cell. The separated proteins were then transferred to a Turbo PVDF membrane by using a Trans-Blot TurboTM Transfer System (Bio-Rad, Singapore). The primary antibody used was a V5 mouse monoclonal antibody (Invitrogen Life Science Technologies). The secondary antibody was an anti-mouse IgG HRP-conjugated antibody (#31430, Pierce). All dilutions used were as suggested by the manufacturer. The signal was detected with tetramethylbenzidine (TMB) (Sigma T0565).

Sample preparation for metabolite and fatty acid analysis

A single colony of the engineered yeast strain or wild-type strain was inoculated from a fresh agar plate into 5 ml fresh liquid YNBD medium and cultured overnight at 30 °C with shaking. Then the overnight culture was inoculated into a 50 ml liquid YNBD medium with an initial OD600 of 0.2 and incubated by shaking at 250 rpm at 30 °C. Yeast culture samples were collected at different growth time points and centrifuged for 10 min at 10,000 rpm. The supernatant and cell pellet were collected separately for further fatty acid or metabolite analysis.

The lipids were extracted from yeast cells using adjusted chloroform–methanol 2:1 method (Browse et al. 1986; Chen et al. 2014). Cell pellet with an OD of 10 was resuspended in 1,000 μl of 0.9 % NaCl solution and then acidified with 200 μl of acetic acid. Next, 5 μl of 10 mg/ml heptadecanoic acid and heptanoic acid dissolved in ethanol and 10 μl of 2 mg/ml ribitol dissolved in water were added into the extraction solvent as internal standard (IS) to correct for metabolite losses during sample preparation. The cell was disrupted in an ice bath using an ultrasonicator for 120 times. Then 3 ml of chloroform–methanol in a ratio of 2:1 was added, and the samples were inverted several times, vortexed vigorously, and centrifuged at 10,000 rpm for 10 min. The lower chloroform layer was then collected, while an additional 2 ml chloroform was added to the upper aqueous layer to further extract the remaining lipids. Then the chloroform layers were combined and rotary-evaporated to near dryness overnight. For metabolite profiling, 1 ml of the aqueous phase layer was collected and evaporated to dryness too.

To extract FFA in the culture medium, 4 ml of the collected culture supernatant was centrifuged for another 10 min at 10,000 rpm to remove the remaining suspended cells. Next, 500 μl 10 % (wt/vol) NaCl, 500 μl glacial acetic acid, 5 μl of 10 mg/ml heptadecanoic acid and heptanoic acid, and 2 ml ethyl acetate were added to the supernatant. After vortexed for 3 min and rotated for 1 h at room temperature, the mixture was centrifuged at 10,000 rpm for 10 min. Then the ethyl acetate layer was collected. Two milliliters of ethyl acetate was added to the aqueous layer to extract the remaining FFA for another time (Torella et al. 2013). The ethyl acetate layer extracts were then combined and rotary-evaporated overnight to dryness.

Fatty acid analysis

Fatty acid analysis was carried out according to a previous work (Chen et al. 2014; Horak et al. 2009). Fatty acid methyl esters (FAMEs) mix C8–C24 (SUPELCO, 18918) was used as the standard. The dried lipid residue and FFA were each redissolved in 600 μl BF3-methanol (FLUKA, 15716) and incubated in sealed vials at 95 °C oven for 30 min. Six hundred microliters of saturated NaCl was added to stop the reaction, and the FAMEs were extracted with 600 μl of hexane. Then the samples were analyzed using a GC-MS system (Agilent Technologies 7890A-5975C) equipped with a DB-5MS capillary column (30 m × 0.250 mm i.d.; film thickness 0.25 μm; Agilent J&W Scientific, Folsom, CA, USA). GC-MS setup was the same as before (Chen et al. 2014). The presented data are the mean of at least three independent experiments performed in duplicate.

Metabolic profiling

The sample for metabolic profiling was prepared according to a previous work (Chen et al. 2014; Wang et al. 2010). Briefly, the dry residue was redissolved in 50 μl of 20 mg/ml solution of methoxyamine hydrochloride in pyridine and kept at 37 °C for 60 min for carbonyl protection. After that, 100 μl of N-methyl-N-(trimethylsilyl)-trifluoroacetamide (MSTFA) with 1 % trimethylchlorosilane (TMCS) was added to each sample, and silylation was carried out at 70 °C for 30 min. The same GC-MS system and column were used. The oven gradient was as follows: first held for 4 min at 75 °C, then ramped to 280 °C at 4 °C min−1, and held for 2 min at 280 °C. Data were acquired in a full scan mode from 35 to 600 m/z with a scan time of 0.2 s. Chromatogram acquisition and mass spectra identification were performed using the Agilent MSD Chemstation Data Analysis software. Chemical identification of detected metabolite peaks was processed by searching NIST08 mass spectral library. All metabolites were quantified using their peak area relative to IS ribitol.

RT-PCR analysis of gene expression

RNeasy Mini kit (QIAGEN, USA) was used to extract the RNA from the wild-type and engineered strains. The amount of RNA was measured using NanoDrop 2000C system (Thermo scientific, USA). Real-time RT-PCR was performed using the iScript one-step RT-PCR kit (Bio-Rad, USA). The reaction was carried out and analyzed using the IQ5 Real-time PCR detection system (Bio-Rad, USA). The relative gene expression analysis was conducted by the 2−ΔΔCT method (Livak and Schmittgen 2001).

Results

Constructing the genetically engineered S. cerevisiae strains

The engineered fatty acid pathway is based on the deletion of two genes and the expression of one protein. The single and double deletion strains △faa1, △faa4, and △faa1△faa4 were obtained and tested by colony PCR (Fig. S2) using primers described in Table 2 and Fig. S1. To express cytosolic acyl-CoA thioesterase, a short version of ACOT5 (ACOT5s), without peptide AKL, was expressed in the cytoplasm under the control of the constitutive promoter ADH1. Western blotting results showed that the protein ACOT5s with V5-tag is about 48.4 kDa (Fig. S4).

The effect of deletion genes FAA4 and/or FAA1 on fatty acid composition

It has been demonstrated that fatty acyl-CoA synthetases Faa1p and Faa4p take part in activation exogenously supplied fatty acids and intracellular acyl-CoA metabolism, and a deficiency in one or two of them will result in an altered endogenous acyl-CoA pools, but will have no significant effect on intracellular fatty acid levels (Færgeman et al. 2001). In our work, both intracellular fatty acids and extracellular fatty acids were investigated to demonstrate the changes between the wild-type strain and deletion strains. When the engineered strains were cultured in YNBD medium for 24 h, the intracellular total fatty acid (TFA) level of all engineered strains did not show a great change (data not shown), which was consistent with a previous report. Similarly, for extracellular fatty acids as shown in Fig. 2, the single deletion strains △faa1 and △faa4 did not demonstrate evident changes, as compared with the wild-type strain. They accumulated mainly saturated fatty acids (SFA) C14:0, C16:0, and C18:0 in the culture medium, like the wild-type strain. For the double deletion strain △faa1△faa4, there was a clear difference in the fatty acid profile and a significant increase in TFA, including all types of fatty acid. As shown in Fig. 2 and Table 3, the strain △faa1△faa4 had increased levels of medium chain fatty acids (MCFA) (C8:0, C10:0, and C12:0) to 8.26 μg/ml, as compared to trace amounts in the wild type. SFA increased to 193.74 μg/ml, which is about 2.5-fold as compared to the wild-type strain. In addition, unsaturated fatty acids (UFA) increased to 124.74 μg/ml, whereas it could not be detected in the wild-type strain and single deletion strains.
Fig. 2

The effect of deleting both FAA1 and FAA4 on fatty acid production. Differential extracellular fatty acid levels in the wild-type, deletion strains △faa1, △faa4, and △faa1△faa4 were presented. Cells were collected after 24 h of growth in YNBD medium, and the culture medium was separated by centrifugation. The total extracellular fatty acids were extracted and analyzed. Data are the mean values of at least three independent experiments performed in duplicate. The error bar indicates the SD

Table 3

Extracellular fatty acid content in S. cerevisiae wild-type and engineered strains

Fatty acid type

WT

faa1faa4

faa1faa4 [Acot5s]

MCFA

0.129 ± 0.0346

8.258 ± 3.360

4.903 ± 0.941

UFA

0

124.735 ± 30.007

208.224 ± 16.938

SFA

76.374 ± 11.620

193.741 ± 20.703

279.130 ± 19.455

Cells were grown in 50 ml of YNBD medium at 30 °C for 24 h. Total extracellular fatty acids were extracted according to described methods. Data represented are expressed in micrograms per milliliter. They are the means from at least three independent experiments. MCFA: C8:0, C10:0, and C12:0. UFA: C16:1 and C18:1. SFA: C14:0, C16:0, and C18:0

WT wild type

The effect of cytosolic acyl-CoA thioesterase Acot5s on fatty acid composition

It has been proven that acyl-ACP thioesterase can be overexpressed in E. coli to modify the fatty acid profile and relieve the feedback inhibition (Voelker and Davies 1994). However, no similar work has been conducted in yeast cells to illustrate the presence of a similar regulatory mechanism until now. To evaluate if the expression of cytosolic acyl-CoA thioesterase could likewise enhance fatty acid production in yeast cells, we expressed cytosolic acyl-CoA thioesterase in the wild-type strain and deletion strains △faa1, △faa4, and △faa1△faa4. As expected, only the strain △faa1△faa4 containing Acot5s showed an additional significant increase of FFA, while the wild-type or single deletion strain containing Acot5s did not show a significant increase of FFA. As shown in Fig. 3 and Table 3, in the strain △faa1△faa4 [Acot5s], C14:0, C16:1, C16:0, C18:1, C18:0, UFA, and SFA increased by about 20, 54, 42, 100, 55, 66, and 44 %. TFA reached about 500 μg/ml at 24 h, and it is a 6.43-fold increase as compared to the wild-type strain and 1.5-fold increase as compared to the strain △faa1△faa4 (Fig. 4). By comparison, as shown in Fig. 4, extracellular FFA in WT [Acot5s] did not increase as compared with the wild-type strain. Similar results were found in △faa4 [Acot5s] (no more than 30 % increase) and △faa1 [Acot5s] (no increase observed). This indicated that the expression of Acot5s in wild-type or single deletion strain did not result in significant effects on the fatty acid level. The simultaneous deletion of FAA1 and FAA4 was required for ACOT5s to further improve the fatty acid level.
Fig. 3

The effect of Acot5s expression on fatty acid production. Differential extracellular fatty acid levels in WT, WT [Acot5s], △faa1faa4, and △faa1faa4 [Acot5s] were presented. Cells were collected after 24 h of growth in YNBD medium, and the culture medium was separated by centrifugation. The total extracellular fatty acids were extracted and detected. Data are the mean values of at least three independent experiments performed in duplicate. The error bar indicates the SD

Fig. 4

Total extracellular FFA accumulation in the wild-type strain and engineered strains in YNBD medium at 24 h. Cells were collected after 24 h of growth in YNBD medium, and the culture medium was separated by centrifugation. The total extracellular fatty acids were extracted and detected as described in the methods. Data are the mean values of at least three independent experiments performed in duplicate. The error bar indicates the SD

Intracellular metabolite analysis

The data presented above illustrated that modification of acyl-CoA metabolism enhanced FFA accumulation. In addition, there were also differences in growth phenotypes between the wild-type, △faa1△faa4, and △faa1△faa4 [Acot5s] strains. In agreement with previous results, the strain △faa1△faa4 showed slower exponential growth rates and reduced final cell concentrations as compared with the wild-type strain (Fig. 5). It is believed that the FFA-producing strain should be growth defective, because high concentrations of FFA are toxic to the cells, due to its detergent-like character (Oshiro et al. 2003). To our surprise, the better FFA-producing strain △faa1△faa4 [Acot5s] did not show defect in growth, but displayed a similar growth phenotype as the wild-type strain, with higher final cell concentrations than the wild-type strain. The normal growth phenotype of △faa1△faa4 [Acot5s] indicated that FFA was not toxic to cells. Therefore, the observed growth defective in FFA accumulation strain may be due to a metabolism disorder, but not fatty acid inhibition. As discussed in other reports (Hamilton et al. 2002; Kamp and Hamilton 2006), FFA could enter and leave cells freely by diffusion. This mechanism supports our hypothesis that FFA can be increased greatly without inhibiting cell growth, as long as the metabolic pathway is unobstructed.
Fig. 5

Growth curves of the wild-type and engineered strains in YNBD medium

To further understand the changes in the metabolic pathway in the engineered strains, metabolic profiling was conducted to analyze the intracellular metabolites (Fig. 6). The data presented demonstrated that some amino acids were differentially produced in the strains △faa1△faa4 and △faa1△faa4 [Acot5s] as compared with the wild-type strain. Among these amino acids, l-lysine, l-ornithine, l-proline, glycine, and l-alanine showed a decreased level in strains △faa1△faa4 and △faa1△faa4 [Acot5s]. However, the amino acid l-valine showed a decreased level in △faa1△faa4 but an increased level in △faa1△faa4 [Acot5s]. In both engineered strains, the metabolites mannose and butanoic acid showed upregulation, whereas glycerol exhibited a downregulation.
Fig. 6

Metabolic profiling analysis of the wild-type and engineered strains. Intracellular metabolites were extracted from the wild-type and engineered strains, and metabolic profiling was conducted. Differential expression levels of intracellular metabolites were analyzed in the engineered strains as compared to the wild type. The amount of metabolites in the wild-type strain was set as 1. The values are the means from three experiments examining cell extracts at 24 h

Gene expression analysis

As suggested by several reports (Black and DiRusso 2007; Choi et al. 1996; Færgeman et al. 2001; Feddersen et al. 2007), fatty acyl-CoAs regulate gene expression by combining with gene regulatory elements. The fatty acid synthesis genes including ACC1, FAS1, FAS2, and OLE1 were upregulated as a result of the decrease in the levels of acyl-CoA esters in the cell. In our study, the main acyl-CoA synthetases were deleted and acyl-CoA esters were hydrolyzed by thioesterase. Hence, a decrease in the availability of acyl-CoA esters in the cytoplasm and an upregulation in the expression of ACC1, FAS1, FAS2, and OLE1 was logically expected. Since the strains △faa1△faa4 and △faa1△faa4 [Acot5s] were observed to have increased extracellular fatty acid levels, we predicted that there should be an increase in the expression of ACC1, FAS1, FAS2, and OLE1 in the strains △faa1△faa4 and △faa1△faa4 [Acot5s]. To support this hypothesis, RT-PCR was carried out to analyze the relative gene expression of these genes. In addition, the gene POX1 which encodes peroxisomal acyl-CoA oxidase and the gene FAA2 which encodes peroxisomal medium chain acyl-CoA synthetase, both of which are related to fatty acid metabolism, were also analyzed. As presented in Fig. 7, the expressions of genes ACC1, FAS1, FAS2, and OLE1 were all increased, especially OLE1. The expression levels increased about 16 times in the strain △faa1△faa4 and 23 times in △faa1△faa4 [Acot5s]. The difference in the expression levels of the genes POX1 and FAA2 was not so obvious, the expression level of the gene POX1 increased slightly, while a slight decrease was observed in the expression level of FAA2. These data are consistent with the conclusion that the expressions of fatty acid synthesis genes are increased in the strains △faa1△faa4 and △faa1△faa4 [Acot5s]. The large increase in OLE1 expression levels reflected the significant increase in UFA levels.
Fig. 7

Differential expression levels of fatty acid metabolism genes in the engineered strains as compared to the wild type. Real-time RT-PCR analysis of mRNA levels of fatty acid synthesis and degradation proteins was carried out. Three independent experiments were conducted with β-actin as internal standard

Discussion

Fatty acid metabolism is tightly regulated at a delicate systemic level in yeast. In addition to the enzymes involved in both fatty acid synthesis and degradation pathway, we propose that the accumulation of FFA is directly regulated by both intracellular acyl-CoA synthetase and acyl-CoA thioesterase (Fig. 1). In our strategy, we first disrupted acyl-CoA synthetases FAA1 and FAA4 to block the flux from FFA to acyl-CoAs. In our next step, we further expressed acyl-CoA thioesterase ACOT5s to reinforce the flux from acyl-CoAs to FFA. The mechanism of FFA accumulation is discussed below.

Evaluation of FFA production and secretion in the strain △faa1△faa4

There are four acyl-CoA synthetases in S. cerevisiae (Black and DiRusso 2007; Russell Johnson et al. 1994; Knoll et al. 1994, 1995), in which Faa1p and Faa4p are essential enzymes in activating exogenous fatty acids and maintaining endogenous long chain acyl-CoA concentration. Thorough studies have been carried out to show how they affect the acyl-CoA concentration using cells cultured in medium supplied with fatty acids (Færgeman et al. 2001; Li et al. 2007). In our study, the strains containing both FAA1 and FAA4 deletions had extracellular FFA level increased to nearly 4.27-fold as compared to the wild-type strain, whereas a deletion of FAA1 or FAA4 had no obvious increase in extracellular FFA (Fig. 4). This is similar to another report, which showed that the combined deletion of Faa1p and Faa4p is responsible for the secretion of FFA into the culture medium (Scharnewski et al. 2008). As opposed to the observation from Scharnewski et al. (2008), in this study, we detected FFA in the culture medium of all strains, while they could not detect FFA in the medium of their single deletion strain. The discrepancy may be due to the fact that deletion strains were constructed based on different yeast strains, and different extraction and esterification methods were used.

The first question raised about the increased extracellular FFA is the metabolic source. Scharnewski et al. proposed that the FFA in the △faa1△faa4 strain were derived from the lipid turnover processes (Scharnewski et al. 2008). Another report about reduced formation of triacylglycerol (TAG) in the △faa1△faa4 strain supports this view (Sorger and Daum 2002). However, it was also shown in the same report that acyl-CoA-dependent TAG synthesis accounted for only 30 % of total cellular TAG (Sorger and Daum 2002). In our work, no evident changes of intracellular TFA were observed, but extracellular TFA was significantly increased. If TAG is the metabolic origin of FFA, when extracellular FFA is increased, intracellular TFA should decrease, and the intracellular glycerol level should increase due to the lipid hydrolysis process. However, in our study, the analysis of metabolites demonstrated that the strain △faa1△faa4 had lower intracellular glycerol than the wild-type strain and similar intracellular TFA levels. This implied that △faa1△faa4 accumulated lower TAG levels than the wild-type strain as a result of the defective acyl-CoA synthetases, but it could not be considered as the reason of the accumulation of FFA. As illustrated in Fig. 1, the disruption of acyl-CoA synthetases led to less available intracellular acyl-CoA, which resulted in higher levels of FFA and a lower level of TAG at the same time.

Thus, as TAG is not the metabolic source, we attempted to understand the underlying mechanism. After reviewing previous studies regarding the role of acyl-CoAs in gene expression regulation, it was observed that fatty acyl-CoAs instead of fatty acids repress the expression of acetyl-CoA carboxylase or △9-desaturase in yeast (Faergeman and Knudsen 1997). The disruption of both FAA1 and FAA4 completely blocked the repression of OLE1 by UFA (Choi et al. 1996; Martin et al. 2007). The significant increase of UFA in strains deficient in FAA1 and FAA4 is presumably due to the de-repression of acetyl-CoA carboxylase and △9-desaturase by fatty acyl-CoAs. Additionally, it is known that fatty acid overproduction is associated with induction of fatty acid degradation, while FAA1 or FAA4 was required for the transcriptional regulation of the genes POX1 and FAA2. For degradation of exogenously supplied fatty acids, β-oxidation level in the strain △faa1△faa4 was reduced to 25 % of the wild-type strain (Færgeman et al. 2001). Supported by the result of RT-PCR (Fig. 7), the expressions of genes ACC1, FAS1, FAS2, and OLE1 were all increased in the strain △faa1△faa4, whereas the expressions of genes POX1 and FAA2 were not significantly increased. These data demonstrated that the deletion of FAA1 and FAA4 not only relieved the feedback inhibition of acyl-CoA on fatty acid synthesis, but also weakened the link between overproduction of fatty acids and the upregulation of genes in the β-oxidation pathway.

FFA production was further enhanced in the strain △faa1△faa4 [Acot5s]

As stated above, FFA production was enhanced by the disruption of acyl-CoA synthetases FAA1p and FAA4p. Hence, we are interested to further exploit the strain △faa1△faa4 in FFA production. To clarify the role of cytosolic acyl-CoA thioesterase in fatty acid metabolism in S. cerevisiae, we expressed cytosolic acyl-CoA thioesterase ACOT5s in the double deletion strain △faa1△faa4. As expectedly, it turned out to lead to more FFA accumulation. A 50 % increase in TFA was observed in the strain △faa1△faa4 [Acot5s] as compared with the strain △faa1△faa4. In addition, a higher ratio of UFA was achieved, which is preferred in biodiesel production due to the greater monounsaturated content giving a better quality of biodiesel (Ramos et al. 2009). The expression of ACOT5s undoubtedly promoted the generation of product FFA and reinforced the flux toward the FFA. On the other hand, due to less cellular acyl-CoAs, the feedback inhibition on fatty acid synthesis genes was further relieved. As demonstrated in the RT-PCR result (Fig. 7), the expression of genes FAS1, FAS2, and OLE1 was further upregulated in the strain △faa1△faa4 [Acot5s].

On the basis of previous report by others and our present data, we conclude that the increase of FFA levels in the strain △faa1△faa4 [Acot5s] is achieved by the control of acyl-CoA metabolism and de-repression of fatty acid synthesis. We chose to express acyl-CoA thioesterase ACOT5s in the cytoplasm of S. cerevisiae as it has broad substrate activity (acting on C6 to C20-CoA) and highest activity with C10-CoA. We expected to increase the production of FFA and investigate the possibility to modify the fatty acid profile, especially MCFA. However, the obtained strain △faa1△faa4 [Acot5s] only accumulated more long chain fatty acids as compared with the strain △faa1△faa4 (Fig. 3). This might be due to the fact that the MCFA production rate is related to the cellular concentration of medium chain acyl-CoAs, which is similar to E. coli (Torella et al. 2013). Hence, the low levels of MCFA accumulation were probably due to the low cellular concentration of medium chain fatty acyl-CoAs in yeast, since long chain acyl-CoAs are mainly released from FAS.

In summary, the present study exploited the role of acyl-CoA thioesterase ACOT5s in the engineered S. cerevisiae strain deficient in acyl-CoA synthetases FAA1 and FAA4. The extracellular FFA in the constructed strain increased 6.43-fold as compared to the wild type. The UFA ratio in TFA was also greatly improved. This could have great potential in biofuel production. Future work will aim to increase the levels of fatty acid production by increasing the level of the precursor acetyl-CoA. In addition, to identify the detailed metabolic network changes and how the gene modification affects the de novo fatty acid synthesis and FFA secretion, LC-MS-based proteomics analysis and GC-MS-based metabolic flux analysis will be employed to study the engineered strains.

Notes

Acknowledgments

We thank Prof. J. H. Hegemann for kindly providing the plasmids for gene deletion. This research is supported by a Competitive Research Programme (CRP) grant from the National Research Foundation of Singapore.

Supplementary material

253_2014_5758_MOESM1_ESM.pdf (97 kb)
ESM 1(PDF 96 kb)

References

  1. Black PN, DiRusso CC (2007) Yeast acyl-CoA synthetases at the crossroads of fatty acid metabolism and regulation. Biochim Biophys Acta Mol Cell Biol Lipids 1771(3):286–298. doi:10.1016/j.bbalip.2006.05.003 CrossRefGoogle Scholar
  2. Bortz WM, Lynen F (1963) The inhibition of acetyl CoA carboxylase by long chain acyl CoA derivatives. Biochem Z 337:505–509PubMedGoogle Scholar
  3. Browse J, McCourt PJ, Somerville CR (1986) Fatty acid composition of leaf lipids determined after combined digestion and fatty acid methyl ester formation from fresh tissue. Anal Biochem 152(1):141–145. doi:10.1016/0003-2697(86)90132-6 PubMedCrossRefGoogle Scholar
  4. Chen L, Zhang J, Chen WN (2014) Engineering the Saccharomyces cerevisiae β-oxidation pathway to increase medium chain fatty acid production as potential biofuel. PLoS ONE 9(1):e84853. doi:10.1371/journal.pone.0084853 PubMedCentralPubMedCrossRefGoogle Scholar
  5. Cherry JM, Hong EL, Amundsen C, Balakrishnan R, Binkley G, Chan ET, Christie KR, Costanzo MC, Dwight SS, Engel SR, Fisk DG, Hirschman JE, Hitz BC, Karra K, Krieger CJ, Miyasato SR, Nash RS, Park J, Skrzypek MS, Simison M, Weng S, Wong ED (2012) Saccharomyces Genome Database: the genomics resource of budding yeast. Nucleic Acids Res 40(D1):D700–D705. doi:10.1093/nar/gkr1029 PubMedCentralPubMedCrossRefGoogle Scholar
  6. Choi YJ, Lee SY (2013) Microbial production of short-chain alkanes. Nature 502(7472):571–574. doi:10.1038/nature12536 http://www.nature.com/nature/journal/v502/n7472/abs/nature12536.html#supplementary-information
  7. Choi J-Y, Stukey J, Hwang S-Y, Martin CE (1996) Regulatory elements that control transcription activation and unsaturated fatty acid-mediated repression of the Saccharomyces cerevisiae OLE1 gene. J Biol Chem 271(7):3581–3589. doi:10.1074/jbc.271.7.3581 PubMedCrossRefGoogle Scholar
  8. Faergeman NJ, Knudsen J (1997) Role of long-chain fatty acyl-CoA esters in the regulation of metabolism and in cell signalling. Biochem J 323:1–12PubMedCentralPubMedGoogle Scholar
  9. Færgeman NJ, Black PN, Zhao XD, Knudsen J, DiRusso CC (2001) The acyl-CoA synthetases encoded within FAA1 and FAA4 in Saccharomyces cerevisiae function as components of the fatty acid transport system linking import, activation, and intracellular utilization. J Biol Chem 276(40):37051–37059. doi:10.1074/jbc.M100884200 PubMedCrossRefGoogle Scholar
  10. Feddersen S, Neergaard TBF, Knudsen J, Faergeman NJ (2007) Transcriptional regulation of phospholipid biosynthesis is linked to fatty acid metabolism by an acyl-CoA-binding-protein-dependent mechanism in Saccharomyces cerevisiae. Biochem J 407:219–230. doi:10.1042/bj20070315 PubMedCentralPubMedCrossRefGoogle Scholar
  11. Gueldener U, Heinisch J, Koehler GJ, Voss D, Hegemann JH (2002) A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res 30(6):e23PubMedCentralPubMedCrossRefGoogle Scholar
  12. Hamilton J, Guo W, Kamp F (2002) Mechanism of cellular uptake of long-chain fatty acids: do we need cellular proteins? In: Glatz JC (ed) Cellular lipid binding proteins. Dev Mol Cell Biochem vol 38. Springer US, pp 17–23Google Scholar
  13. Horak T, Culik J, Cejka P, Jurkova M, Kellner V, Dvorak J, Haskova D (2009) Analysis of free fatty acids in beer: comparison of solid-phase extraction, solid-phase microextraction, and stir bar sorptive extraction. J Agric Food Chem 57(23):11081–11085. doi:10.1021/jf9028305 PubMedCrossRefGoogle Scholar
  14. Howard TP, Middelhaufe S, Moore K, Edner C, Kolak DM, Taylor GN, Parker DA, Lee R, Smirnoff N, Aves SJ, Love J (2013) Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli. Proc Natl Acad Sci. doi:10.1073/pnas.1215966110 Google Scholar
  15. Jiang P, Cronan JE (1994) Inhibition of fatty acid synthesis in Escherichia coli in the absence of phospholipid synthesis and release of inhibition by thioesterase action. J Bacteriol 176(10):2814–2821PubMedCentralPubMedGoogle Scholar
  16. Jones JM, Nau K, Geraghty MT, Erdmann R, Gould SJ (1999) Identification of peroxisomal acyl-CoA thioesterases in yeast and humans. J Biol Chem 274(14):9216–9223. doi:10.1074/jbc.274.14.9216 PubMedCrossRefGoogle Scholar
  17. Kamiryo T, Parthasarathy S, Numa S (1976) Evidence that acyl coenzyme A synthetase activity is required for repression of yeast acetyl coenzyme A carboxylase by exogenous fatty acids. Proc Natl Acad Sci U S A 73(2):386–390PubMedCentralPubMedCrossRefGoogle Scholar
  18. Kamisaka Y, Kimura K, Uemura H, Yamaoka M (2013) Overexpression of the active diacylglycerol acyltransferase variant transforms Saccharomyces cerevisiae into an oleaginous yeast. Appl Microbiol Biotechnol 97(16):7345–7355. doi:10.1007/s00253-013-4915-9 PubMedCrossRefGoogle Scholar
  19. Kamp F, Hamilton JA (2006) How fatty acids of different chain length enter and leave cells by free diffusion. Prostaglandins Leukot Essent Fat Acids 75(3):149–159. doi:10.1016/j.plefa.2006.05.003 CrossRefGoogle Scholar
  20. Knoll LJ, Johnson DR, Gordon JI (1994) Biochemical studies of three Saccharomyces cerevisiae acyl-CoA synthetases, Faa1p, Faa2p, and Faa3p. J Biol Chem 269(23):16348–16356PubMedGoogle Scholar
  21. Knoll LJ, Johnson DR, Gordon JI (1995) Complementation of Saccharomyces cerevisiae strains containing fatty acid activation gene (FAA) deletions with a mammalian acyl-CoA synthetase. J Biol Chem 270(18):10861–10867. doi:10.1074/jbc.270.18.10861 PubMedCrossRefGoogle Scholar
  22. Krivoruchko A, Siewers V, Nielsen J (2011) Opportunities for yeast metabolic engineering: lessons from synthetic biology. Biotechnol J 6(3):262–276. doi:10.1002/biot.201000308 PubMedCrossRefGoogle Scholar
  23. Leber C, Da Silva NA (2013) Engineering of Saccharomyces cerevisiae for the synthesis of short chain fatty acids. Biotechnol Bioeng. doi:10.1002/bit.25021 PubMedGoogle Scholar
  24. Leibundgut M, Maier T, Jenni S, Ban N (2008) The multienzyme architecture of eukaryotic fatty acid synthases. Curr Opin Struct Biol 18(6):714–725. doi:10.1016/j.sbi.2008.09.008 PubMedCrossRefGoogle Scholar
  25. Li H, Melton EM, Quackenbush S, DiRusso CC, Black PN (2007) Mechanistic studies of the long chain acyl-CoA synthetase Faa1p from Saccharomyces cerevisiae. Biochim Biophys Acta Mol Cell Biol Lipids 1771(9):1246–1253. doi:10.1016/j.bbalip.2007.05.009 CrossRefGoogle Scholar
  26. Liu J-F, Nie K-L, Fan L-H, Wang F, Tan T-W, Deng L (2013) Increased production of FAEEs for biodiesel with lipase enhanced Saccharomyces cerevisiae. Process Biochem 48(8):1212–1215. doi:10.1016/j.procbio.2013.06.003 CrossRefGoogle Scholar
  27. Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25(4):402–408. doi:10.1006/meth.2001.1262 PubMedCrossRefGoogle Scholar
  28. Lu XF, Vora H, Khosla C (2008) Overproduction of free fatty acids in E. coli: implications for biodiesel production. Metab Eng 10(6):333–339. doi:10.1016/j.ymben.2008.08.006 PubMedCrossRefGoogle Scholar
  29. Maeda I, Delessert S, Hasegawa S, Seto Y, Zuber S, Poirier Y (2006) The peroxisomal acyl-CoA thioesterase Pte1p from Saccharomyces cerevisiae is required for efficient degradation of short straight chain and branched chain fatty acids. J Biol Chem 281(17):11729–11735. doi:10.1074/jbc.M511762200 PubMedCrossRefGoogle Scholar
  30. Magnuson K, Jackowski S, Rock CO, Cronan JE (1993) Regulation of fatty acid biosynthesis in Escherichia coli. Microbiol Rev 57(3):522–542PubMedCentralPubMedGoogle Scholar
  31. Martin CE, Oh C-S, Jiang Y (2007) Regulation of long chain unsaturated fatty acid synthesis in yeast. Biochim Biophys Acta Mol Cell Biol Lipids 1771(3):271–285CrossRefGoogle Scholar
  32. Oshiro T, Aiba H, Mizuno T (2003) A defect in a fatty acyl-CoA synthetase gene, lcf1+, results in a decrease in viability after entry into the stationary phase in fission yeast. Mol Gen Genomics 269(4):437–442. doi:10.1007/s00438-003-0841-3 CrossRefGoogle Scholar
  33. Ramos MJ, Fernández CM, Casas A, Rodríguez L, Pérez Á (2009) Influence of fatty acid composition of raw materials on biodiesel properties. Bioresour Technol 100(1):261–268. doi:10.1016/j.biortech.2008.06.039 PubMedCrossRefGoogle Scholar
  34. Ramsay RR, Gandour RD, van der Leij FR (2001) Molecular enzymology of carnitine transfer and transport. Biochim Biophys Acta Protein Struct Mol Enzymol 1546(1):21–43CrossRefGoogle Scholar
  35. Russell Johnson D, Knoll LJ, Levin DE, Gordon JI (1994) Saccharomyces cerevisiae contains four fatty acid activation (FAA) genes: an assessment of their role in regulating protein N-myristoylation and cellular lipid metabolism. J Cell Biol 127(3):751–762CrossRefGoogle Scholar
  36. Scharnewski M, Pongdontri P, Mora G, Hoppert M, Fulda M (2008) Mutants of Saccharomyces cerevisiae deficient in acyl-CoA synthetases secrete fatty acids due to interrupted fatty acid recycling. FEBS J 275(11):2765–2778. doi:10.1111/j.1742-4658.2008.06417.x PubMedCrossRefGoogle Scholar
  37. Schirmer A, Rude MA, Li XZ, Popova E, del Cardayre SB (2010) Microbial biosynthesis of alkanes. Science 329(5991):559–562. doi:10.1126/science.1187936 PubMedCrossRefGoogle Scholar
  38. Sorger D, Daum G (2002) Synthesis of triacylglycerols by the acyl-coenzyme A: diacyl-glycerol acyltransferase Dga1p in lipid particles of the yeast Saccharomyces cerevisiae. J Bacteriol 184(2):519–524. doi:10.1128/jb.184.2.519-524.2002 PubMedCentralPubMedCrossRefGoogle Scholar
  39. Steen EJ, Kang YS, Bokinsky G, Hu ZH, Schirmer A, McClure A, del Cardayre SB, Keasling JD (2010) Microbial production of fatty-acid-derived fuels and chemicals from plant biomass. Nature 463(7280):559–562. doi:10.1038/nature08721
  40. Sumper M, Träuble H (1973) Membranes as acceptors for palmitoyl CoA in fatty acid biosynthesis. FEBS Lett 30(1):29–34. doi:10.1016/0014-5793(73)80612-X PubMedCrossRefGoogle Scholar
  41. Tang X, Feng H, Chen WN (2013) Metabolic engineering for enhanced fatty acids synthesis in Saccharomyces cerevisiae. Metab Eng 16:95–102. doi:10.1016/j.ymben.2013.01.003 PubMedCrossRefGoogle Scholar
  42. Torella JP, Ford TJ, Kim SN, Chen AM, Way JC, Silver PA (2013) Tailored fatty acid synthesis via dynamic control of fatty acid elongation. Proc Natl Acad Sci 110(28):11290–11295. doi:10.1073/pnas.1307129110 PubMedCentralPubMedCrossRefGoogle Scholar
  43. Voelker TA, Davies HM (1994) Alteration of the specificity and regulation of fatty acid synthesis of Escherichia coli by expression of a plant medium-chain acyl-acyl carrier protein thioesterase. J Bacteriol 176(23):7320–7327PubMedCentralPubMedGoogle Scholar
  44. Wang MX, Bai J, Chen WN, Ching CB (2010) Metabolomic profiling of cellular responses to carvedilol enantiomers in vascular smooth muscle cells. PLoS ONE 5(11):e15441. doi:10.1371/journal.pone.0015441 PubMedCentralPubMedCrossRefGoogle Scholar
  45. Westin MAK, Alexson SEH, Hunt MC (2004) Molecular cloning and characterization of two mouse peroxisome proliferator-activated receptor α (PPARα)-regulated peroxisomal acyl-CoA thioesterases. J Biol Chem 279(21):21841–21848. doi:10.1074/jbc.M313863200 PubMedCrossRefGoogle Scholar
  46. Zheng Y-N, Li L-L, Liu Q, Yang J-M, Wang X-W, Liu W, Xu X, Liu H, Zhao G, Xian M (2012) Optimization of fatty alcohol biosynthesis pathway for selectively enhanced production of C12/14 and C16/18 fatty alcohols in engineered Escherichia coli. Microb Cell Factories 11(1):65CrossRefGoogle Scholar

Copyright information

© Springer-Verlag Berlin Heidelberg 2014

Authors and Affiliations

  • Liwei Chen
    • 1
  • Jianhua Zhang
    • 1
  • Jaslyn Lee
    • 1
  • Wei Ning Chen
    • 1
  1. 1.School of Chemical and Biomedical EngineeringNanyang Technological UniversitySingaporeSingapore

Personalised recommendations