Applied Microbiology and Biotechnology

, Volume 94, Issue 2, pp 425–435 | Cite as

Overexpression of the PHO84 gene causes heavy metal accumulation and induces Ire1p-dependent unfolded protein response in Saccharomyces cerevisiae cells

  • Augustin Minel Ofiteru
  • Lavinia Liliana Ruta
  • Codruta Rotaru
  • Ioana Dumitru
  • Cristian Dumitru Ene
  • Aurora Neagoe
  • Ileana Cornelia Farcasanu
Applied genetics and molecular biotechnology

Abstract

Pho84p, the protein responsible for the high-affinity uptake and transport of inorganic phosphate across the plasma membrane, is also involved in the low-affinity uptake of heavy metals in the Saccharomyces cerevisiae cells. In the present study, the effect of PHO84 overexpression upon the heavy metal accumulation by yeast cells was investigated. As PHO84 overexpression triggered the Ire1p-dependent unfolded protein response, abundant plasma membrane Pho84p could be achieved only in ire1Δ cells. Under environmental surplus, PHO84 overexpression augmented the metal accumulation by the wild type, accumulation that was exacerbated by the IRE1 deletion. The pmr1Δ cells, lacking the gene that encodes the P-type ATPase ion pump that transports Ca2+ and Mn2+ into the Golgi, hyperaccumulated Mn2+ even from normal medium when overexpressing PHO84, a phenotype which is rather restricted to metal-hyperaccumulating plants.

Keywords

PHO84 Overexpression Heavy metal accumulation Saccharomyces cerevisiae 

Introduction

Transition metals such as Mn, Cu, Co, Zn, and Fe are required in trace amounts for normal metabolism, having important biological roles in stabilizing the structure of biomolecules, or acting in the catalytic center of numerous enzymes. Other heavy metals, such as Cd, Hg, and Pb, are not essential for life, but they can compete with the essential trace elements either for the transport systems or in binding to various biomolecules. Essential or not, when present in the environment in concentrations higher than normal, the heavy metals become toxic, causing serious damages to organisms due to nonspecific binding to proteins or by interfering to other metals’ metabolism.

The budding yeast Saccharomyces cerevisiae has been extensively used as a model organism to study the molecular mechanisms involved in the heavy metal transport (Van Ho et al. 2002; Feldmann 2005) and homeostasis (Ratherford and Bird 2004; Massé and Arguin 2005; Eide 2009; Reddi et al. 2009; Rosenfeld et al. 2010). In this context, the high-affinity inorganic phosphate transporter encoded by the PHO84 gene (Bun-ya et al. 1991) was found to act also as a low affinity transporter for Mn2+, Cu2+, Co2+, and Zn2+, playing a role in Mn2+ homeostasis in the S. cerevisiae cells, predominantly under metal surplus conditions (Jensen et al. 2003). Thus, yeast cells devoid of the Pho84p are more resistant to Mn2+, Cu2+, Co2+, and Zn2+ as the PHO84 gene disruption results in reduced metal-ion accumulation (Jensen et al. 2003).

Due to their potential harmful effect, the essential elements are not accumulated by the yeast cells, hence their low potential to act as heavy metal scavengers or bioremediators (Ruta et al. 2010), in spite of their high biosorptive capacity (Machado et al. 2008; 2009). Pmr1p, the P-type ATPase ion pump responsible for transporting Ca2+ and Mn2+ into the Golgi (Rudolph et al. 1989; Antebi and Fink 1992; Sorin et al. 1997; Mandal et al. 2000), is one of the key elements in the heavy metal extrusion from the cell. Pmr1p provides a major route for cellular detoxification of Mn2+ (and to a lesser extent of Cd2+, Co2+, and Cu2+) by transporting the excess cytosolic ions into the Golgi, from where they exit the cell via the secretory pathway vesicles (Lapinskas et al. 1995; Dürr et al. 1998; Mandal et al. 2000; Culotta et al. 2005; Lauer Júnior et al. 2008).

Although the link between inorganic phosphate and metal-ion transport across the plasma membrane has long been considered (Borst-Pauwels 1981; Kihn et al. 1988) and there is evidence that phosphate accumulation affects heavy metal homeostasis in the yeast cells (Rosenfeld et al. 2010), a correlation between the PHO84 overexpression and the heavy metal accumulation has not been reported. Pho84p is a transmembrane protein that is processed in the ER before being targeted to the plasma membrane (Bun-ya et al. 1996; Miller et al. 2005). Overproduction of secretory or plasma membrane proteins often overwhelms the ER processing capacity, resulting in misfolded proteins readily sensed by the Ire1p, the key component of the unfolded protein response (UPR) pathway (Kohno 2010 and references within). In yeast, activated Ire1p transmits the signal by removing an intron from the HAC1 mRNA that translates into the Hac1p transcription activator of the UPR target genes (Cocs and Walter 1996; Kawahara et al. 1997), many of which possess an UPR element (UPRE) in their promoter sequence (Mori et al. 1992).

In this study, the effect of PHO84 overexpression on heavy metal accumulation by yeast cells was investigated, but as the PHO84 overexpression elicited an Ire1p-mediated UPR response, abundant plasma membrane Pho84p could be achieved only in ire1Δ knockout cells. We show here that under metal surplus, the yeast cells overexpressing the PHO84 gene acquire the capacity to accumulate Mn2+, Cu2+, or Co2+, capacity which is augmented in the ire1Δ cells, while under normal metal concentration the pmr1Δ cells become Mn2+ hyperaccumulators.

Materials and methods

Strains and culture conditions

The S. cerevisiae strains used in this study were isogenic with the “wild-type” (WT) parental strain BY4741 (MATa, his3Δ1, leu2Δ0, met15Δ0, ura3Δ0; Brachmann et al. 1998). The knockout mutant strains used were Y06524 (BY4741, pho84::kanMX4), Y04534 (BY4741, pmr1::kanMX4), Y01907 (BY4741, ire1::kanMX4). All strains were obtained from EUROSCARF (European S. cerevisiae Archive for Functional Analysis; Institute of Molecular Biosciences Johann Wolfgang Goethe-University Frankfurt, Germany). Cell storage, growth, and manipulation were done as described (Sherman et al. 1986). Strains were grown in standard yeast extract–polypeptone–dextrose (YPD), synthetic dextrose (SD), or synthetic galactose (SG) media supplemented with the necessary amino acids. For solid media, 2% agar was used. For growth improvement, the synthetic media were supplemented with 0.1% yeast extract.

Plasmids

The PHO84 open reading frame was amplified by PCR from genomic DNA using primers PHO84rec1sens (5′GAATTCGATATCAAGCTTATCGATACCGTCGACAATGAGTTCCGTCAATAAAGA3′) and PHO84rec2AS (5′GCGTGACATAACTAATTACATGACTCGAGGTCGACTTATGCTTCATGTTGAAGTT3′), the underlined sequence being homologous to the target vectors pGREG505 (LEU2 marker) and pGREG506 (URA3 marker). For cloning into pGREG600 (URA3 marker), to construct the PHO84-GFP fusion, PHO84rec1sens and the reverse primer PHO84rec4AS 5′GTTCTTCTCCTTTACTCATTCTCGAGGTCGACTGCTTCATGTTGAAGTTGAGAT3′ were used (Jansen et al. 2005). The PCR fragments were purified by Wizard SV gel and PCR Clean-up System (Promega) and introduced into pGREG505, pGREG506, or pGREG600 by cotransformation into yeast cells (Jansen et al. 2005), thus generating pPHO84-505, pPHO84-506, and pPHO84-600, respectively. The plasmids were rescued from yeast cells and subsequently amplified and purified from E. coli cells. The pGREG plasmid series was purchased from EUROSCARF. Plasmid pCZY1 (URA3, 2 μ) harboring the lacZ reporter gene driven by the CYC core promoter fused with the UPRE was generously provided by Professor Kenji Kohno (Nara Institute of Science and Technology, Japan) and used to monitor cellular UPR activity (Mori et al. 1992). Yeast transformation was performed by a modified lithium acetate method (Schiestl and Gietz 1989), and transformants were selected for growth on SD medium lacking the appropriate selective nutrients.

Growth assessment

Overnight precultures were inoculated in fresh media at density 106 cells/mL, then cells were incubated with shaking (200 rpm) at 28°C for 2 h before being shifted to selective SG to allow gene induction. The influence of metals on cell growth in liquid media was monitored at time intervals by determining the optical density of cellular suspension at 660 nm (Shimadzu UV-VIS spectrophotometer, UV mini 1240). For spot assay, fresh cell cultures of OD660∼1 were diluted 10-, 100-, 1,000-, and 10,000-fold and stamped on agar plates using a replicator. For viability test, samples (200 μL; three replicates) were taken at defined intervals of time, serially diluted with sterile deionized water and plated on YPD/agar. After 3–4 days of incubation at 28°C, the colonies were counted. Original cell suspensions had viability higher than 99%.

Metal accumulation by living cells

Overnight precultures were diluted in fresh SD selective medium to 106 cells/mL. The cells were subsequently incubated with shaking for 2 h at 28°C before being washed and shifted to SG selective medium, used to induce gene expression via GAL1 promoter. Six hours after the galactose shift, metal ions (in the chloride forms) were added from sterile stocks. Cells grown in media containing various concentrations of MnCl2, CoCl2, or CuCl2 were harvested by centrifugation and were washed three times with 10 mM 2-(N-morpholino)ethanesulfonic acid (MES)–Tris buffer, pH 6.0, at 0–2°C. All centrifugations (1 min, 5,000 rpm) were done at 4°C. Cells were finally suspended in 10 mM MES–Tris buffer, pH 6.0 (109 cells/mL) and used for metal and cell protein assay. Metal analysis of whole cell was done using an instrument with a single collector, quadrupole inductively coupled plasma with mass spectrometry (ICP-MS; Perkin-Elmer ELAN DRC-e) with axial field technology for trace elements, rare earth elements, and isotopic analyses. The analyses were performed after digestion of cells with 65% ultrapure HNO3 (Merck). Standard solutions were prepared by diluting a 10-μg/mL multielement solution (Multielement ICP Calibration Standard 3, matrix 5% NNO3, Perkin Elmer Pure Plus). The metal cellular content was normalized to total cellular proteins, which were assayed as described by Bradford (1976). Values are expressed as the mean ± standard deviation of duplicate determinations of three independent yeast transformants. The experiments were repeated on three different days, with similar results.

Pho84p-GFP localization

For the detection of Pho84-GFP fluorescence, cells transformed with pPHO84-600 were grown overnight in SD-Ura, diluted to 106 cells/mL and grown for 2 h before being shifted to SD-Gal. Cells were examined with a Leica fluorescent microscope system (Leica DM 1000; Wetzlar, Germany) equipped with an HBO-100 mercury lamp and a Leica DFC 295 camera. To detect the GFP signals, a GFP filter set (excitation filter BP 470/40, dichromatic mirror 500, and suppression filter BP 525/50) was used. The microscopic photographs were processed using the Leica Application Suite software.

Phosphate removal test

Phosphate removal by cells from the incubation medium was done as described by Watanabe et al. (2008), with slight modifications. Yeast strains were precultivated in SD-Ura for 12 h. The cells were harvested, washed twice with deionized water, and then used to inoculate (OD660 1.0) 5 mL SG-Ura prepared in 0.1 mM phosphate buffer, pH 5.5. The cells were grown at 28°C, with shaking (200 rpm), and aliquots were taken at 4 and 6 h from the galactose shift. The cells were removed by centrifugation, and the remnant phosphate was determined as described (Nyren et al. 1986). Values are expressed as the mean ± standard deviation of duplicate determinations of three independent yeast transformants. The experiments were repeated on three different days, with similar results.

β-Galactosidase assay

The β-galactosidase activity of yeast extract was carried out on permeabilized cells as described (Amberg et al. 2005). Values are expressed as the mean ± standard deviation of duplicate determinations of three independent yeast transformants.

Reproducibility of the results

All experiments were repeated, independently, on three different days. For each individual determination, values were expressed as the mean ± standard deviation of duplicate measurements on three independent yeast transformants (n = 6). The data reported for viability are the mean ± SD of colony numbers obtained in triplicate from three independent transformants (n = 9). The observed trends were fully consistent among the experiments performed on different days, and a representative example is shown.

Statistical analysis

Multiple comparisons were performed with Student’s t test. The differences were considered to be significant when p < 0.05. Data analysis was performed with Statistical Package for Social Science 15.0 (SPSS 15.0) for Windows.

Results

Overexpression of PHO84 from a GAL1 promoter augments the heavy metal accumulation by yeast cells

Knockout pho84Δ cells are more tolerant to heavy metals due to the absence of the Pho84p-mediated low-affinity uptake, causing decreased metal accumulation within the cells (Jensen et al. 2003). To determine whether PHO84 overexpression affects metal accumulation through enhancement of ion transport across plasma membrane, genomic PHO84 gene was amplified by PCR and introduced in yeast vectors containing the GAL1 promoter, which switches on the gene expression when the transformed cells are grown in the presence of galactose, but not of glucose (Guthrie and Fink 1991). Wild-type cells expressing natural genomic PHO84 (WT) or overexpressing PHO84 via the GAL1 promoter (WT/PHO84-OE) were compared to knockout pho84Δ cells, in terms of metal tolerance and metal accumulation. PHO84 overexpression did not induce the expected heavy metal sensitivity, and the WT-PHO84-OE cells exhibited tolerance to Mn2+, Cu2+, or Co2+ similarly to the pho84Δ cells (Fig. 1a). Nevertheless, this tolerance was not associated with low metal uptake, as the WT/PHO84-OE cells visibly accumulated metals ions, observable with the naked eye in the case of Cu2+ (Fig. 1b, right) when the cells grown on the surface of agar medium containing CuCl2 changed color due to Cu2+ precipitation within the cells. When the metal uptake was determined, it was noted that the WT/PHO84-OE accumulated more metal than the WT cells (Fig. 1c). In spite of the higher metal uptake, the growth of WT/PHO84-OE cells was not severely impaired under metal surplus, suggesting that the ions may be taken up in a bound, less toxic form. Moreover, PHO84 overexpression slightly enhanced the tolerance to Mn2+, Cu2+, or Co2+ in wild-type cells (Fig. 2b), a phenotype which was reproduced in all growth experiments. Since Pho84p is primarily involved in the inorganic phosphate transport, it is possible that the metal ions are cotransported with the phosphate ions, thus entering the cell as metal phosphates and not as the more toxic osmotically free form.
Fig. 1

Effect of PHO84 overexpression on cell growth and metal accumulation. Wild-type cells transformed with URA3-marked control vector pGREG506 (native PHO84, WT) or with pPHO84-506 (WT/PHO84-OE) and pho84Δ cells transformed with control vector pGREG506 (pho84Δ) were precultured in SD-Ura and shifted in mid-log phase to SG-Ura to ensure PHO84 expression via the GAL1 promoter. a Effect of metal ions upon cell growth in liquid medium. MnCl2, CoCl2, or CuCl2 were added at the specified concentrations 6 h after the galactose shift. Cell growth was determined spectrophotometrically 24 h after the galactose shift (OD660) and expressed relatively to OD660 of the WT cells at the time of the galactose shift. b Effect of metal ions upon cell growth on agar plates. Mid-log phase cells pregrown for 4 h in liquid SG-Ura were spotted (approx. 4 μL/spot) in 10-fold serial dilutions (from 107cells/mL, left, to 104 cells/mL, right) onto SG-Ura plates supplemented with the indicated chemicals. Plates were photographed after 2–4 days incubation at 28°C. The growth experiment on plates was repeated at least three times, with similar results. c Metal accumulation by cells. Mid-log phase cells pre-grown for 4 h in SG-Ura were treated with 1 mM MnCl2, 1 mM CoCl2 or 0.5 mM CuCl2 and incubated at 28°C with agitation (200 rpm). Cells were assayed for metal accumulation as described in the “Materials and methods” section, after 60 min (grey bars) or 120 min (white bars). Each determination was repeated on three different days, with no significant variations (p < 0.05). One typical experiment is presented. Values are expressed as the mean ± standard deviation of duplicate determinations of three independent yeast transformants (n = 6)

Fig. 2

PHO84 overexpression induces the UPR in yeast cells. a Wild-type and pho84Δ cells were co-transformed with LEU2-marked control vector pGREG505 and pCZY1 (URA3) to obtain strains with native (WTUR) or deleted (pho84ΔUR) PHO84, respectively. To test the effect of PHO84 overexpression on UPR induction, wild-type and ire1Δ cells were co-transformed with pPHO84-505 and pCZY1 to yield strains WTUR/PHO84-OE and ireΔUR/PHO84-OE, respectively. The transformed cells were precultured in SD-Leu-Ura and shifted in mid-log phase to SG-Leu-Ura to ensure PHO84 expression via the GAL1 promoter. Cells were harvested at various times and assayed for β-galactosidase activity as described in the “Materials and methods” section. The diagram presents the β-galactosidase activity of cells harvested after 0 h (white bars), 4 h (striped bars), or 6 h (grey bars) incubation in SG-Leu-Ura. Each determination was repeated on different three days, with no significant variations (p < 0.05). One typical experiment is presented. Values are expressed as the mean ± standard deviation of duplicate determinations of three independent yeast transformants (n = 6). b Localization of Pho84p-GFP in cells overexpressing PHO84. Wild-type and ire1Δ cells were transformed with the URA3-marked pPHO84-600 harboring the PHO84-GFP fusion under the control of GAL1 promoter. Mid-log phase cells precultured in SD-Ura were washed and shifted to SG-Ura. Cells were visualized by fluorescent microscopy at various times following the shift to galactose. The photograph shows cells 4 h after the galactose shift. Exposure time, 10 s. More than 300 fluorescent cells were counted from different colonies and the cells exhibited the phenotype as visualized in the picture

PHO84 overexpression triggers the UPR pathway

Under the conditions described in Fig. 1c, the metal accumulation by the cells overexpressing PHO84 was constantly but moderately higher than that observed for WT cells. When the tests were repeated on different days, no obvious day-to-day variations were observed. Statistical analysis revealed that PHO84 overexpression enhanced the Mn2+ accumulation (2.8 ± 0.31) times, the Co2+ accumulation (2.6 ± 0.28) times, and the Cu2+ accumulation (1.7 ± 0.24) times (p < 0.05). Pho84p is a transmembrane protein processed in the ER before being targeted to the plasma membrane (Bun-ya et al. 1996; Miller et al. 2005), therefore Pho84p overproduction may overwhelm the ER processing capacity resulting in protein misfolding and UPR onset. To test this possibility, the plasmid containing the GAL1-PHO84 fusion was co-expressed with a plasmid harboring the reporter LacZ gene under the control of CYC core promoter fused with the UPRE. This latter system is suitable for quantification of Ire1p-mediated UPR by measuring the β-galactosidase activity of cells that express it (Mori et al. 1992). We found that PHO84 overexpression from the GAL1 promoter activated the UPR in wild-type cells (WTUR/PHO84-OE), as demonstrated by the high values of β-galactosidase of the permeabilized cells. This activation was Ire1p dependent, since the β-galactosidase activity in the ire1Δ cells overexpressing PHO84 (ire1ΔUR/PHO84-OE) was very low (Fig. 2a). To check the Pho84p localization in PHO84 overexpressing cells, we constructed a PHO84-GFP fusion driven by the GAL1 promoter, and cells expressing this fusion were visualized by fluorescent microscopy. It was noticed that the WT cells overexpressing the PHO84-GFP fusion exhibited a fluorescent halo, depicting the plasma membrane localization of the chimeric protein. Nevertheless, the fluorescence was faint compared to that observed for the ire1Δ cells overexpressing the PHO84-GFP fusion construct (Fig. 2b). This observation suggested that overproduction of Pho84p is controlled in the wild-type cells via Ire1p activation of the UPR and that high Pho84p at plasma level can be achieved only in cells defective in the UPR.

Overexpressing PHO84 in ire1Δ cells results in enhanced metal accumulation

As the IRE1 gene disruption resulted in increased accumulation of Pho84p at the plasma membrane level, the metal uptake by ire1Δ cells overexpressing PHO84 was monitored. This time, milder metal concentrations were used (0.05–0.1 mM) to avoid the nonspecific metal transport or the activation of export mechanisms. It was noticed that overexpression of PHO84 via the GAL1 promoter exacerbated the metal accumulation by the ire1Δ cells (Fig. 3a), suggesting that the abundant plasma membrane Pho84p observed in ire1Δ cells (Fig. 2b) had a cumulative effect upon metal accumulation. At similar concentrations (0.1 mM individual surplus), Mn2+ was accumulated in higher amount, followed closely by Co2+, and Cu2+ (Fig. 3a). In environments containing an equimolar mixture of Mn2+, Co2+, and Cu2+ (0.1 mM each), ire1Δ cells accumulated Mn2+ and Co2+ almost nonpreferentially, having a lower affinity for Cu2+ (Fig. 3b). The results were reproducible, and statistical analysis of data obtained from similar experiments performed on different days confirmed that the observed trends were fully consistent among the independent experiments (p < 0.05). The high metal accumulation did not seem to upset the PHO84 overexpressing cells, as their growth was not significantly affected by the metal surplus (data not shown). Heavy metal accumulation accompanied by tolerance can be partially accounted for by the presence of chelating agents that bind the free metal ions, thus rendering them nontoxic. As Pho84p is primarily involved in the high-affinity phosphate transport, the effect of PHO84 overexpression on phosphate accumulation was determined indirectly, by monitoring the phosphate removal from the incubation medium by the yeast cells. As expected, the highest decrease in phosphate concentration was noticed when the medium was inhabited by the ire1Δ cells overexpressing PHO84 (Fig. 3c). This observation suggested the possibility of metal phosphate co-transport, which limits the entry of the osmotically free metal ions (the more toxic form) into the cytoplasm. In this line of evidence, ire1Δ cells overexpressing PHO84 seem to tolerate surplus ions (Fig. 3d) in spite of the high metal accumulation (Fig. 3a, b).
Fig. 3

The effect of UPR pathway disruption on the metal-accumulating capacity of cells overexpressing PHO84. Wild-type, pho84Δ, and ire1Δ cells were transformed with URA3-marked control vector pGREG506, as control strains. To test the effect of PHO84 overexpression on metal accumulation, wild-type and ire1Δ cells were transformed with pPHO84-506 to yield strains WT/PHO84-OE and ireΔ/PHO84-OE, respectively. The transformed cells were precultured in SD-Ura and shifted in mid-log phase to SG-Ura to ensure PHO84 expression via the GAL1 promoter. MnCl2, CoCl2, or CuCl2 (final concentration, 0.1 mM) were added 4 h after the galactose shift and incubated at 28°C with agitation (200 rpm) one additional hour, when cells were assayed for metal accumulation as described in the “Materials and methods” section. a Accumulation of metals from media supplemented with individual ions (surplus concentration, 0.1 mM). b Accumulation of metals from media supplemented with an equimolar mixture of MnCl2, CoCl2, and CuCl2 (surplus concentration, 0.1 mM each). c Removal of phosphate from the incubation media by cells overexpressing PHO84. Total inorganic phosphate was assayed in the culture medium as described in “Materials and methods” section, 2 h (white bars) or 6 h (grey bars) after the galactose shift. Each determination was repeated on three different days, with no significant variations (p < 0.05). One typical experiment is presented. Values are expressed as the mean ± standard deviation of duplicate determinations of three independent yeast transformants (n = 6). d The effect of PHO84 overexpression on the metal tolerance of ire1Δ cells. Mid-log phase cells pregrown for 4 h in liquid SG-Ura were spotted (approx. 4 μL/spot) in 10-fold serial dilutions (from 107cells/mL, left, to 104 cells/mL, right) onto SG-Ura plates supplemented with the indicated ions. Plates were photographed after 2–4 days incubation at 28°C. The growth experiment on plates was repeated at least three times, with similar results

The pmr1Δ cells overexpressing PHO84 are Mn2+ hyperaccumulators

Pmr1p, the P-type ATPase ion pump responsible for transporting Ca2+ and Mn2+ into the Golgi, is one of the key elements in the heavy metal extrusion from the cell, and yeast cells lacking functional Pmr1p tend to accumulate metal ions (Lapinskas et al. 1995). Considering this phenotype, attempts were made to overexpress the PHO84 gene in the pmr1Δ cells via the GAL1 promoter and to investigate the cell behavior in terms of metal uptake. Nevertheless, this was not a straightforward task, as the pmr1Δ cells transformed with pPHO84-506 grew poorly in galactose-containing media (Fig. 4a), suggesting that PHO84 overexpression may be toxic to the pmr1Δ cells. Indeed, cell viability decreased as a function of galactose exposure time and viability decline started approximately 6 h following the galactose shift (Fig. 4b). It was noted that the pmr1Δ cells overexpressing PHO84 accumulated unusually high amounts of Mn2+ from normal nonsupplemented medium (Table 1), a characteristic that could account for the cell poor growth in galactose media. The maximum Mn2+ accumulation was pin-pointed at 6 h from the galactose shift (Fig. 4c), coinciding with the moment when the cell viability began to decrease (Fig. 4b). The concentration of various ions in the standard growing media was determined by ICP-MS, and it was noted that Mn2+ (∼0.75 μM) was present in concentrations higher than Co2+ (0.05 μM) or Cu2+ (0.25 μM), possibly accounting for cells’ preference for manganese. To test this possibility, the metal accumulation was determined in cells grown in media with Mn2+, Co2+, and Cu2+ adjusted to 1 μM each (completely nontoxic to wild-type cells). It was noted that even under equimolar conditions, the pmr1Δ cells overexpressing PHO84 still accumulated the Mn2+ ions preferentially (Table 1). No significant variation in metal accumulation was noticed when increasing the regular concentrations to 1 μM (∼20 times increase for Co2+ and ∼4 times increase for Cu2+). This was not surprising, as the adjusted concentrations were much lower than the toxic thresholds, the fluctuation in cation concentrations being buffered by the nutrients present in the growth media.
Fig. 4

The effect of PHO84 overexpression on the growth and viability of pmr1Δ cells. The pmr1Δ cells transformed with URA3-marked control vector pGREG506 (pmr1Δ, empty diamonds) or with pPHO84-506 (pmr1Δ/PHO84-OE, empty triangles) were precultured in SD-Ura til mid log phase before being shifted to SG-Ura (time 0), to ensure PHO84 expression via the GAL1 promoter. a Cell growth on standard SG-Ura plates. Plates were photographed after 2 days incubation at 28°C. The growth experiment on plates was repeated three times, with similar results. b Cell viability after the galactose shift. Viability was expressed as percentage of the number of cells plated (see “Materials and methods” section). The data are the mean ± standard deviation of colony numbers obtained in triplicate from three independent transformants (n = 9). c Manganese accumulation by pmr1Δ cells overexpressing PHO84. Values are expressed as the mean ± standard deviation of duplicate determinations of three independent yeast transformants (n = 6). Each determination was repeated on three different days, with no significant variations (p < 0.05). One typical experiment is presented in each case

Table 1

Metal accumulation by cells grown in standard SG-Ura medium

Cell line

Accumulated metal (nmol/mg total protein)

Mn2+

Co2+

Cu2+

Medium concetration

0.75 μMa

1 μMb

0.05 μMa

1 μMb

0.25 μMa

1 μMb

WT/pGREG506

4.89 ± 0.04

5.2 ± 0.06

3.2 ± 0.12

4.1 ± 0.28

4.05 ± 0.12

4.89 ± 0.89

pho84Δ/pGREG506

3.11 ± 0.01

2.12 ± 0.01

2.1 ± 0.056

1.9 ± 0.12

2.19 ± 0.023

1.9 ± 0.34

pmr1Δ/pGREG506

12.2 ± 0.35

16.8 ± 0.46

6.8 ± 0.32

8.24 ± 0.44

5.1 ± 0.12

6.2 ± 0.34

ire1Δ/pGREG506

36.8 ± 1.02

40.23 ± 1.14

12.1 ± 0.34

14.12 ± 0.56

8.2 ± 0.23

10.87 ± 1.16

WT/pPHO84-506

16.97 ± 1.24

24.54 ± 1.67

7.38 ± 1.87

8.8 ± 1.21

6.4 ± 0.28

8.86 ± 0.87

ire1Δ/pPHO84-506

46.22 ± 0.78

56.8 ± 2.12

30.9 ± 0.72

33.12 ± 0.84

24.9 ± 0.52

33.2 ± 2.43

pmr1Δ/pPHO84-506

1797.88 ± 3.9

1976.2 ± 4.23

8.22 ± 0.28

10.28 ± 1.12

17.7 ± 0.32

22.22 ± 1.86

The yeast cells transformed with the specified plasmids were pre-grown in SD-Ura until mid-log phase, then washed and shifted to SG-Ura (approx. 5 × 105 cells/mL) to allow the GAL1 induction of PHO84 expression. Cells were harvested after 6 h incubation at 28°C with agitation (200 rpm) and subjected to metal assay, as described in the “Materials and methods” section. The results are presented as the mean ± standard deviation of duplicate determinations of three independent yeast transformants (n = 6). Each determination was repeated on three different days, with no significant variations (p < 0.05). One typical experiment is presented

aMetal concentration in standard SG-Ura used in this study

bAdjusted metal concentration

Discussion

In this work it was shown that PHO84 overexpression accompanied by increased targeting of Pho84p to the plasma membrane augmented the heavy metal accumulation by the yeast cells. Obtaining heavy metal-accumulating mutants is a prime objective for technologies dealing with bioremediation of contaminated sites (metal excess) or with bioextraction from depleted sites (metal deficiency). Nevertheless, bioaccumulation has bioremediation significance only when correlated with increased (gained) tolerance to the accumulated substance. Similarly to heavy metal-accumulating plants (Baker 2002; Baker and Brooks 1989), both wild-type and UPR-disrupted (ire1Δ) cells overexpressing PHO84 could accumulate Mn2+, Co2+, or Cu2+ without developing toxicity symptoms (Figs. 1 and 3). The metal accumulation is probably facilitated by the fact that the ions are taken up by the cell in a bound form, as suggested by the possibility of a metal phosphate co-transport, which limits the entry of the osmotically free metal ions (the more toxic form) into the cytoplasm. Alternatively, as Pho84p is primarily involved in the high-affinity phosphate transport, it is also possible that the metal ions penetrate the cells concomitantly with the phosphate, the subsequent interaction taking place in the cytosol. The solubility of Mn2+, Co2+, or Cu2+ phosphates is low, limiting the occurrence of osmotically free metal ions (the more toxic form) in the cytoplasm, the place where many metabolically active enzymes or other biomolecules reside. The role of (poly)phosphate in alleviating metal toxicity is well documented (Borst-Pauwels 1981; Kihn et al. 1988; Farcasanu et al. 1996; Rosenfeld et al. 2010) and developing a system that co-transports phosphate with high affinity and metal ions with low affinity can be considered as a second protective action of a transporter whose main function is nutrient transport under limiting conditions. It was interesting to see that PHO84 overexpression significantly augmented the metal accumulation by ire1Δ cells under metal surplus conditions. Under normal conditions though, IRE1 deletion resulted in significantly higher manganese accumulation than simply overexpressing PHO84 in wild-type cells (∼10-fold compared to ∼4-fold, respectively, Table 1), suggesting that Ire1p-dependent UPR may clear the endogenous Pho84p. It was also striking that in standard medium, overexpression of PHO84 in ire1Δ cells does not result in significantly enhanced Mn levels relatively to the ire1Δ cells expressing the empty vector (Table 1). This observation suggested the possibility that endogenous Pho84p is already overexpressed in ire1Δ cells, thus rendering them potential candidates as bioextractors of manganese from low concentration environments. Nevertheless, this does not mean that there is no need to overexpress PHO84 in ire1Δ cells to obtain accumulating mutants. As Pho84p exhibits only low affinity for divalent cations (Jensen et al. 2003), the overexpression from a strong promoter such as GAL1 promoter may simply be superfluous for cation uptake from low concentration environments. The advantage of overexpressing PHO84 in ire1Δ cells can be seen when it comes to higher concentrations: under such circumstances, the low-affinity transporter seem to have the right abundance to engulf the surplus cations.

The pmr1Δ cells overexpressing PHO84 deserve special attention, since under normal growth conditions they tend to hyperaccumulate Mn2+, i.e., over 300 times more than the wild-type cells (Table 1), a value that corresponds to the definition of a hyperaccumulator given for plants (Baker and Brooks 1989). Considering the haploid yeast cell size and protein composition (Sherman 2002), the average Mn2+ concentration reached within the cell in conditions described in Table 1 would be grossly a staggering 150 mM, which is 20,000 more than the 0.75 μM detected in the SG-Ura medium used. The hyperaccumulating activity of pmr1Δ cells seemed to be restricted to Mn2+, and this was not surprising, considering the Pmr1p preference for Mn2+ (Lapinskas et al. 1995; Dürr et al. 1998). When this pump is lacking, the Mn2+ imported via the more-abundant-than-usual plasma membrane Pho84p cannot be extruded, but instead accumulates in the cell. Even though Mn2+ hyperaccumulation was accompanied by slow growth and loss of viability (thus enlarging the selected group of kamikaze cells, Ruta et al. 2010), controlling the level of PHO84 expression may improve cell growth, while maintaining the hyperaccumulating capacity. Apart from few marine organisms (Gifford et al. 2007), heavy metal hyperaccumulation is a phenotype characteristic to plants, and extrapolating it to a friendly microorganism like S. cerevisiae would open new possibilities for many fields, including biotechnology.

Manganese is very common in the environment, and much used in the industry or as fuel additive. It is an essential nutrient but also has the potential to produce neurotoxic effects when it accumulates in an organism, especially in the brain (for review, Takeda 2003). There are few plants that hyperaccumulate Mn from both contaminated soils (1% Mn) or from soils with normal concentration (Reeves 2006). Such plants are predominantly woody (Fernando et al. 2008, 2009) and hence unsuited to short-term controlled study. The use of friendly microorganisms as an alternative for hyperaccumulating plants is therefore an attractive possibility, and engineered yeast cells may be the organisms of choice. Nevertheless, the use of genetically modified cells would restrict the applicability of the method, unless strictly controlled fermenters are to be used, making this cellular system best suited for bioremediation of contaminated waters. The European and US regulations recommend a limit of 0.05 mg/L manganese (approximately 1 μM, similar to the concentration in yeast growth medium) in the drinking water; but for many industrial purposes, the manganese content should not exceed 0.01 to 0.02 mg/L, and in some cases, even this is considered excessive. In this respect, two PHO84-overexpressing yeast strains described in this study seem to be of relevance for potential usage in decreasing the manganese concentrations of contaminated waters.

Notes

Acknowledgments

The authors are grateful to Professor Kenji Kohno (Nara Institute of Science and Technology, Japan) for generously providing plasmid pCZY1. This work was supported by the Ministry of Education and Research of Romania through the grant-in-aid PNII Idei_965, 176/2007 and by the postdoctoral program POSDRU/89/1.5/S/60746, from the European Social Fund.

References

  1. Amberg DC, Burke DJ, Strathern JN (2005) Methods in yeast genetics. A Cold Spring Harbor Laboratory course manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, pp 135–139Google Scholar
  2. Antebi A, Fink GR (1992) The yeast Ca2+-ATPase homologue, PMR1, is required for normal Golgi function and localizes in a novel Golgi-like distribution. Mol Biol Cell 3:633–654Google Scholar
  3. Baker AJM, Brooks RR (1989) Terrestrial higher plants which hyperaccumulate metallic elements—a review of their distribution, ecology and phytochemistry. Biorecovery 1:81–126Google Scholar
  4. Baker AJM (2002) The use of tolerant plants and hyperaccumulators. In: Wong MH, Bradshaw AD (eds) Restoration and management of derelict land: modern approaches. World Scientific Publishing Co., Singapore, pp 138–148Google Scholar
  5. Borst-Pauwels GW (1981) Ion transport in yeast. Biochim Biophys Acta 650:88–127Google Scholar
  6. Brachmann CB, Davies A, Cost GJ, Caputo E, Li J, Hieter P, Boeke JD (1998) Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14:115–132CrossRefGoogle Scholar
  7. Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254CrossRefGoogle Scholar
  8. Bun-ya M, Nishimura M, Harashima S, Oshima Y (1991) The PHO84 gene of Saccharomyces cerevisiae encodes an inorganic phosphate transporter. Mol Cell Biol 11:3229–3238Google Scholar
  9. Bun-ya M, Shikata K, Nakade S, Yompakdee C, Harashima S, Oshima Y (1996) Two new genes, PHO86 and PHO87, involved in inorganic phosphate uptake in Saccharomyces cerevisiae. Curr Genet 29:344–351Google Scholar
  10. Cocs JS, Walter P (1996) A novel mechanism for regulating activity of a transcription factor that controls the unfolded protein response. Cell 87:391–404CrossRefGoogle Scholar
  11. Culotta VC, Yang M, Hall MD (2005) Manganese transport and trafficking: lessons learned from Saccharomyces cerevisiae. Eukaryot Cell 4:1159–1165CrossRefGoogle Scholar
  12. Dürr G, Strayle J, Plemper R, Elbs S, Klee SK, Catty P, Wolf DH, Rudolph HK (1998) The medial-Golgi ion pump Pmr1 supplies the yeast secretory pathway with Ca2+ and Mn2+ required for glycosylation, sorting, and endoplasmic reticulum-associated protein degradation. Mol Biol Cell 9:1149–1162Google Scholar
  13. Eide DJ (2009) Homeostatic and adaptive responses to zinc deficiency in Saccharomyces cerevisiae. J Biol Chem 284:18565–18569CrossRefGoogle Scholar
  14. Farcasanu IC, Ohta N, Miyakawa T (1996) The fate of Mn ions inside the Saccharomyces cerevisiae cells seen by electronic paramagnetic resonance. Biosci Biotechnol Biochem 60:468–471CrossRefGoogle Scholar
  15. Feldmann H (2005) Yeast transport. In: Yeast molecular biology, a short compendium on basic features and novel aspects. Adolf-Butenandt-Institute, University of Munich, pp 10–17. http://biochemie.web.med.uni-muenchen.de/Yeast_Biol/
  16. Fernando DR, Woodrow IE, Jaffré T, Dumontet V, Marshall AT, Baker AJM (2008) Foliar manganese accumulation by Maytenus founieri (Celastraceae) in its native New Caledonian habitats: populational variation and localization by X-ray microanalysis. New Phytol 177:178–185Google Scholar
  17. Fernando DR, Guymer G, Reeves RD, Woodrow IE, Baker AJ, Batianoff GN (2009) Foliar Mn accumulation in eastern Australian herbarium specimens: prospecting for ‘new’ Mn hyperaccumulators and potential applications in taxonomy. Ann Bot 103:931–939CrossRefGoogle Scholar
  18. Gifford S, Dunstan RH, O’Connor W, Koller CE, MacFarlane GR (2007) Aquatic zooremediation: deploying animals to remediate contaminated aquatic environments. Trends Biotechnol 25:60–65CrossRefGoogle Scholar
  19. Guthrie C, Fink GR (eds) (1991) Guide to yeast genetics and molecular biology. Academic, New YorkGoogle Scholar
  20. Jansen G, Wu C, Schade B, Thomas DY, Whiteway M (2005) Drag&Drop cloning in yeast. Gene 344:43–51CrossRefGoogle Scholar
  21. Jensen LT, Ajua-Alemanji M, Culotta VC (2003) The Saccharomyces cerevisiae high affinity phosphate transporter encoded by PHO84 also functions in manganese homeostasis. J Biol Chem 278:42036–42040CrossRefGoogle Scholar
  22. Kawahara T, Yanagi H, Yura T, Mori K (1997) Endoplasmic reticulum stress-induced mRNA splicing permits synthesis of transcription factor Hac1p/Ern4p that activates the unfolded protein response. Mol Biol Cell 8:1845–1862Google Scholar
  23. Kihn JC, Dassargues CM, Mestdagh MM (1988) Preliminary ESR studies of Mn(II) retention by the yeast Saccharomyces. Can J Microbiol 34:1230–1234CrossRefGoogle Scholar
  24. Kohno K (2010) Stress-sensing mechanisms in the unfolded protein response: similarities and differences between yeast and mammals. J Biochem 147:27–33CrossRefGoogle Scholar
  25. Lapinskas PJ, Cunningham KW, Liu XF, Fink GR, Culotta VC (1995) Mutations in PMR1 suppress oxidative damage in yeast lacking superoxide dismutase. Mol Cell Biol 15:1382–1388Google Scholar
  26. Lauer Júnior CM, Bonatto D, Mielniczki-Pereira AA, Schuch AZ, Dias JF, Yoneama ML, Pêgas Henriques JA (2008) The Pmr1 protein, the major yeast Ca2+-ATPase in the Golgi, regulates intracellular levels of the cadmium ion. FEMS Microbiol Lett 285:79–88CrossRefGoogle Scholar
  27. Machado MD, Santos MS, Gouveia C, Soares HM, Soares EV (2008) Removal of heavy metals using a brewer’s yeast strain of Saccharomyces cerevisiae: the flocculation as a separation process. Bioresour Technol 99:2107–2115CrossRefGoogle Scholar
  28. Machado MD, Janssens S, Soares HM, Soares EV (2009) Removal of heavy metals using a brewar’s yeast strain of Saccharomyces cerevisiae: advantages of using dead biomass. J Appl Biotech 106:1792–1804Google Scholar
  29. Mandal D, Woolf TB, Rao R (2000) Manganese selectivity of pmr1, the yeast secretory pathway ion pump, is defined by residue Gln783 in transmembrane segment 6. Residue Asp778 is essential for cation transport. J Biol Chem 275:23933–23938CrossRefGoogle Scholar
  30. Massé E, Arguin M (2005) Ironing out the problem: new mechanisms of iron homeostasis. Trends Biochem Sci 30:462–468CrossRefGoogle Scholar
  31. Miller JP, Lo RS, Ben-Hur A, Desmarais C, Stagljar I, Stafford Noble W, Fields S (2005) Large-scale identification of yeast integral membrane protein interactions. Proc Natl Acad Sci U S A 102:12123–12128CrossRefGoogle Scholar
  32. Mori K, Sant A, Kohno K, Normington K, Gething MJ, Sambrook JF (1992) A 22 bp cis-acting element is necessary and sufficient for the induction of the yeast KAR2 (BiP) gene by unfolded proteins. EMBO J 11:2583–2593Google Scholar
  33. Nyren P, Nore BF, Baltzcheffsky M (1986) Studies on photosynthetic inorganic pyrophosphate formation in Rhodospirillum rubrum chromatophores. Biochim Biophys Acta 851:276–282CrossRefGoogle Scholar
  34. Ratherford JC, Bird AJ (2004) Metal-responsive transcription factors that regulate iron, zinc, and copper homeostasis in eukaryotic cells. Eukaryot Cell 3:1–13CrossRefGoogle Scholar
  35. Reddi AR, Jensen LT, Culotta VC (2009) Manganese homeostasis in Saccharomyces cerevisiae. Chem Rev 109:4722–4732CrossRefGoogle Scholar
  36. Reeves RD (2006) Hyperaccumulation of trace elements by plants. In: Morel J-L, Echevarria G, Goncharova N (eds) Phytoremediation of metal contaminated soils. Springer, Berlin, pp 25–52CrossRefGoogle Scholar
  37. Rosenfeld L, Reddi AR, Leung E, Aranda K, Jensen LT, Culotta VC (2010) The effect of phosphate accumulation on metal ion homeostasis in Saccharomyces cerevisiae. J Biol Inorg Chem 15:1051–1062CrossRefGoogle Scholar
  38. Rudolph HK, Antebi A, Fink GR, Buckley CM, Dorman TE, LeVitre J, Davidow LS, Mao JI, Moir DT (1989) The yeast secretory pathway is perturbed by mutations in PMR1, a member of a Ca2+ ATPase family. Cell 58:133–145CrossRefGoogle Scholar
  39. Ruta L, Paraschivescu C, Matache M, Avramescu S, Farcasanu IC (2010) Removing heavy metals from synthetic effluents using “kamikaze” Saccharomyces cerevisiae cells. Appl Microbiol Biotechnol 85:763–771CrossRefGoogle Scholar
  40. Schiestl R, Gietz RD (1989) High efficiency transformation of intact yeast cells using single stranded nucleic acid as carrier. Curr Genet 16:339–346CrossRefGoogle Scholar
  41. Sherman F (2002) Getting started with yeast. Methods Enzymol 350:3–41CrossRefGoogle Scholar
  42. Sherman F, Fink GR, Hicks JB (1986) Methods in yeast genetics. Cold Spring Harbor Laboratory Press, Cold Spring HarborGoogle Scholar
  43. Sorin A, Rosas G, Rao R (1997) PMR1, a Ca2+-ATPase in yeast Golgi, has properties distinct from sarco/endoplasmic reticulum and plasma membrane calcium pumps. J Biol Chem 272:9895–9901CrossRefGoogle Scholar
  44. Takeda A (2003) Manganese action in brain function. Brain Res Rev 41:79–87CrossRefGoogle Scholar
  45. Van Ho A, Ward DM, Kaplan J (2002) Transition metal transport in yeast. Annu Rev Microbiol 56:237–261CrossRefGoogle Scholar
  46. Watanabe T, Ozaki N, Iwashita K, Fujii T, Iefuji H (2008) Breeding of wastewater treatment yeasts that accumulate high concentrations of phosphorus. Appl Microbiol Biotechnol 80:331–338CrossRefGoogle Scholar

Copyright information

© Springer-Verlag 2011

Authors and Affiliations

  • Augustin Minel Ofiteru
    • 1
  • Lavinia Liliana Ruta
    • 1
  • Codruta Rotaru
    • 1
  • Ioana Dumitru
    • 1
  • Cristian Dumitru Ene
    • 1
  • Aurora Neagoe
    • 2
  • Ileana Cornelia Farcasanu
    • 1
  1. 1.Faculty of ChemistryUniversity of BucharestBucharestRomania
  2. 2.Faculty of BiologyUniversity of BucharestBucharestRomania

Personalised recommendations