Advertisement

Immunogenetics

, Volume 67, Issue 10, pp 547–561 | Cite as

Single nucleotide polymorphisms/haplotypes associated with multiple rubella-specific immune response outcomes post-MMR immunization in healthy children

  • Inna G. Ovsyannikova
  • Hannah M. Salk
  • Beth R. Larrabee
  • V. Shane Pankratz
  • Gregory A. PolandEmail author
Original Paper

Abstract

The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.

Keywords

Rubella vaccine Single nucleotide polymorphisms (SNPs) Genetic association Neutralizing antibodies Cytokines 

MeSH Keywords

Rubella Rubella vaccine Rubella virus Measles-mumps-rubella vaccine Single nucleotide polymorphism Genetic association studies Antibodies Neutralizing Cytokines 

Notes

Acknowledgments

We thank the Mayo Clinic Vaccine Research Group staff and subjects who participated in our studies. We thank Caroline L. Vitse for her editorial assistance with this manuscript. We thank Nathaniel D. Warner for his assistance with this study. Research reported in this publication was supported by the National Institute of Allergy and Infectious Diseases of the National Institutes of Health under award numbers R37AI48793 (which recently received a MERIT Award) and R01AI33144. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health

Conflict of interest

Dr. Poland is the chair of a Safety Evaluation Committee for novel non-rubella investigational vaccine trials being conducted by Merck Research Laboratories. Dr. Poland offers consultative advice on vaccine development to Merck & Co. Inc., CSL Biotherapies, Avianax, Sanofi Pasteur, Dynavax, Novartis Vaccines and Therapeutics, PAXVAX Inc., Emergent Biosolutions, Adjuvance, and Vaxess. Drs. Poland and Ovsyannikova hold two patents related to measles and vaccinia peptide research. These activities have been reviewed by the Mayo Clinic Conflict of Interest Review Board and are conducted in compliance with Mayo Clinic Conflict of Interest policies. This research has been reviewed by the Mayo Clinic Conflict of Interest Review Board and was conducted in compliance with Mayo Clinic Conflict of Interest policies.

Supplementary material

251_2015_864_MOESM1_ESM.docx (20 kb)
Table S1 (DOCX 19 kb)
251_2015_864_MOESM2_ESM.docx (16 kb)
Table S2 (DOCX 16 kb)

References

  1. Barton GM (2007) Viral recognition by toll-like receptors. Semin Immunol 19:33–40CrossRefPubMedGoogle Scholar
  2. Devilard E, Xerri L, Dubreuil P, Lopez M, Reymond N (2013) Nectin-3 (CD113) interacts with Nectin-2 (CD112) to promote lymphocyte transendothelial migration. PLoS ONE 8, e77424PubMedCentralCrossRefPubMedGoogle Scholar
  3. Dhiman N, Haralambieva IH, Vierkant RA, Pankratz VS, Ryan E, Jacobson RM, Ovsyannikova IG, Poland GA (2010) Predominant inflammatory cytokine secretion pattern in response to two doses of live rubella vaccine in health vaccinees. Cytokine 50:24–29PubMedCentralCrossRefPubMedGoogle Scholar
  4. Dokter WH, Koopmans SB, Vellenga E (1996) Effects of IL-10 and IL-4 on LPS-induced transcription factors (AP-1, NF-IL6 and NF-kappa B) which are involved in IL-6 regulation. Leukemia 10:1308–1316PubMedGoogle Scholar
  5. Fuchs A, Cella M, Giurisato E, Shaw AS, Colonna M (2004) Cutting edge: CD96 (tactile) promotes NK cell-target cell adhesion by interacting with the poliovirus receptor (CD155). J Immunol 172:3994–3998CrossRefPubMedGoogle Scholar
  6. Geraghty RJ, Krummenacher C, Cohen GH, Eisenberg RJ, Spear PG (1998) Entry of alphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirus receptor. Science 280:1618–1620CrossRefPubMedGoogle Scholar
  7. Haralambieva IH, Dhiman N, Ovsyannikova IG, Vierkant RA, Pankratz VS, Jacobson RM, Poland GA (2010) 2’-5’-Oligoadenylate synthetase single-nucleotide polymorphisms and haplotypes are associated with variations in immune responses to rubella vaccine. Hum Immunol 71:383–391PubMedCentralCrossRefPubMedGoogle Scholar
  8. Haralambieva IH, Ovsyannikova IG, Kennedy RB, Vierkant RA, Pankratz SV, Jacobson RM, Poland GA (2011a) Associations between single nucleotide polymorphisms and haplotypes in cytokine and cytokine receptor genes and immunity to measles vaccination. Vaccine 29:7883–7895PubMedCentralCrossRefPubMedGoogle Scholar
  9. Haralambieva IH, Ovsyannikova IG, Umlauf BJ, Vierkant RA, Pankratz SV, Jacobson RM, Poland GA (2011b) Genetic polymorphisms in host antiviral genes: associations with humoral and cellular immunity to measles vaccine. Vaccine 29:8988–8997PubMedCentralCrossRefPubMedGoogle Scholar
  10. Haralambieva IH, Oberg AL, Ovsyannikova IG, Kennedy RB, Grill DE, Middha S, Bot BM, Wang VW, Smith DI, Jacobson RM, Poland GA (2013) Genome-wide characterization of transcriptional patterns in high and low antibody responders to rubella vaccination. PLoS ONE 8, e62149PubMedCentralCrossRefPubMedGoogle Scholar
  11. Haralambieva IH, Lambert ND, Ovsyannikova IG, Kennedy RB, Larrabee BR, Pankrantz VS, Poland GA (2014) Associations between single nucleotide polymorphisms in cellular viral receptors and attachment factor-related genes and humoral immunity to rubella vaccination. PLoS ONE 9, e99997PubMedCentralCrossRefPubMedGoogle Scholar
  12. He Y, Bowman VD, Mueller S, Bator CM, Bella J, Peng X, Baker TS, Wimmer E, Kuhn RJ, Rossmann MG (2000) Interaction of the poliovirus receptor with poliovirus. Proc Natl Acad Sci U S A 97:79–84PubMedCentralCrossRefPubMedGoogle Scholar
  13. Kamran N, Takai Y, Miyoshi J, Biswas SK, Wong JS, Gasser S (2013) Toll-like receptor ligands induce expression of the costimulatory molecule CD155 on antigen-presenting cells. PLoS ONE 8, e54406PubMedCentralCrossRefPubMedGoogle Scholar
  14. Kopp EB, Medzhitov R (1999) The Toll-receptor family and control of innate immunity. Curr Opin Immunol 11:13–18CrossRefPubMedGoogle Scholar
  15. Lambert ND, Haralambieva IH, Ovsyannikova IG, Larrabee BR, Pankratz VS, Poland GA (2013) Characterization of humoral and cellular immunity to rubella vaccine in four distinct cohorts. Immunol Res 58:1–8CrossRefGoogle Scholar
  16. Lambert ND, Pankratz VS, Larrabee BR, Ogee-Nwankwo A, Chen MH, Icenogle JP, Poland GA (2014) High-throughput assay optimization and statistical interpolation of rubella-specific neutralizing antibody titers. Clin Vaccine Immunol 21:340–346PubMedCentralCrossRefPubMedGoogle Scholar
  17. Lievano F, Galea SA, Thornton M, Wiedmann RT, Manoff SB, Tran TN, Amin MA, Seminack MM, Vagie KA, Dana A, Plotkin SA (2012) Measles, mumps, and rubella virus vaccine (M-M-RII): a review of 32 years of clinical and postmarketing experience. Vaccine 30:6918–6926CrossRefPubMedGoogle Scholar
  18. McNab FW, Rajsbaum R, Stoye JP, O’Garra A (2011) Tripartite-motif proteins and innate immune regulation. Curr Opin Immunol 23:46–56CrossRefPubMedGoogle Scholar
  19. Muhlebach MD, Mateo M, Sinn PL, Prufer S, Uhlig KM, Leonard VH, Navaratnarajah CK, Frenzke M, Wong XX, Sawatsky B, Ramachandran S, McCray PB Jr, Cichutek K, Von MV, Lopez M, Cattaneo R (2011) Adherens junction protein nectin-4 is the epithelial receptor for measles virus. Nature 480:530–533PubMedCentralPubMedGoogle Scholar
  20. Ovsyannikova IG, Jacobson RM, Vierkant RA, Jacobsen SJ, Pankratz VS, Poland GA (2004) The contribution of HLA class I antigens in immune status following two doses of rubella vaccination. Hum Immunol 65:1506–1515CrossRefPubMedGoogle Scholar
  21. Ovsyannikova IG, Jacobson RM, Vierkant RA, Jacobsen SJ, Pankratz VS, Poland GA (2005) Human leukocyte antigen class II alleles and rubella-specific humoral and cell-mediated immunity following measles-mumps-rubella-II vaccination. J Infect Dis 191:515–519CrossRefPubMedGoogle Scholar
  22. Ovsyannikova IG, Jacobson RM, Ryan JE, Dhiman N, Vierkant RA, Poland GA (2007) Relationship between HLA polymorphisms and gamma interferon and interleukin-10 cytokine production in healthy individuals after rubella vaccination. Clin Vaccine Immunol 14:115–122PubMedCentralCrossRefPubMedGoogle Scholar
  23. Ovsyannikova IG, Jacobson RM, Vierkant RA, O’Byrne MM, Poland GA (2009a) Replication of rubella vaccine population genetic studies: validation of HLA genotype and humoral response associations. Vaccine 27:6926–6931PubMedCentralCrossRefPubMedGoogle Scholar
  24. Ovsyannikova IG, Ryan JE, Vierkant RA, O’Byrne MM, Jacobson RM, Poland GA (2009b) Influence of host genetic variation on rubella-specific T cell cytokine responses following rubella vaccination. Vaccine 27:3359–3366PubMedCentralCrossRefPubMedGoogle Scholar
  25. Ovsyannikova IG, Dhiman N, Haralambieva IH, Vierkant RA, O’Byrne MM, Jacobson RM, Poland GA (2010a) Rubella vaccine-induced cellular immunity: evidence of associations with polymorphisms in the Toll-like, vitamin A and D receptors, and innate immune response genes. Hum Genet 127:207–221PubMedCentralCrossRefPubMedGoogle Scholar
  26. Ovsyannikova IG, Haralambieva IH, Dhiman N, O’Byrne MM, Pankratz VS, Jacobson RM, Poland GA (2010b) Polymorphisms in the vitamin A receptor and innate immunity genes influence the antibody response to rubella vaccination. J Infect Dis 201:207–213PubMedCentralCrossRefPubMedGoogle Scholar
  27. Ovsyannikova IG, Haralambieva IH, Vierkant RA, O’Byrne MM, Jacobson RM, Poland GA (2011a) The association of CD46, SLAM, and CD209 cellular receptor gene SNPs with variations in measles vaccine-induced immune responses--a replication study and examination of novel polymorphisms. Hum Hered 72:206–223PubMedCentralCrossRefPubMedGoogle Scholar
  28. Ovsyannikova IG, Haralambieva IH, Vierkant RA, Pankratz VS, Poland GA (2011b) The role of polymorphisms in toll-like receptors and their associated intracellular signaling genes in measles vaccine immunity. Hum Genet 130:547–561PubMedCentralCrossRefPubMedGoogle Scholar
  29. Ovsyannikova IG, Haralambieva IH, Vierkant RA, O’Byrne MM, Jacobson RM, Poland GA (2012) Effects of vitamin A and D receptor gene polymophisms/haplotypes on immune responses to measles vaccine. Pharmacogenet Genomics 22:20–31PubMedCentralCrossRefPubMedGoogle Scholar
  30. Ovsyannikova IG, Haralambieva IH, Vierkant RA, O’Byrne MM, Poland GA (2013) Associations between polymorphisms in the antiviral TRIM genes and measles vaccine immunity. Hum Immunol 74:768–774PubMedCentralCrossRefPubMedGoogle Scholar
  31. Ovsyannikova IG, Pankratz VS, Larrabee BR, Jacobson RM, Poland GA (2014a) HLA genotypes and rubella vaccine immune response: additional evidence. Vaccine 32:4206–4213PubMedCentralCrossRefPubMedGoogle Scholar
  32. Ovsyannikova IG, Salk HM, Larrabee BR, Pankratz VS, Poland GA (2014b) Single-nucleotide polymorphism associations in common with immune responses to measles and rubella vaccines. Immunogenetics 66:663–669CrossRefPubMedGoogle Scholar
  33. Pankratz VS, Vierkant RA, O’Byrne MM, Ovsyannikova IG, Poland GA (2010) Associations between SNPs in candidate immune-relevant genes and rubella antibody levels: a multigenic assessment. BMC Immunol 11:48PubMedCentralCrossRefPubMedGoogle Scholar
  34. Plotkin SA (2001) Rubella eradication. Vaccine 19:3311–3319CrossRefPubMedGoogle Scholar
  35. Poland GA, Ovsyannikova IG, Jacobson RM (2009) Application of pharmacogenomics to vaccines. Pharmacogenomics 10:837–852PubMedCentralCrossRefPubMedGoogle Scholar
  36. Poland GA, Kennedy RB, Ovsyannikova IG (2011a) Vaccinomics and personalized vaccinology: is science leading us toward a new path of directed vaccine development and discovery? PLoS Pathog 7, e1002344PubMedCentralCrossRefPubMedGoogle Scholar
  37. Poland GA, Ovsyannikova IG, Kennedy RB, Haralambieva IH, Jacobson RM (2011b) Vaccinomics and a new paradigm for the development of preventive vaccines against viral infections. OMICS 15:625–636PubMedCentralCrossRefPubMedGoogle Scholar
  38. Puthothu B, Forster J, Heinzmann A, Krueger M (2006) TLR-4 and CD14 polymorphisms in respiratory syncytial virus associated disease. Dis Markers 22:303–308PubMedCentralCrossRefPubMedGoogle Scholar
  39. Qi YF, Huang YX, Wang HY, Zhang Y, Bao YL, Sun LG, Wu Y, Yu CL, Song ZB, Zheng LH, Sun Y, Wang GN, Li YX (2013) Elucidating the crosstalk mechanism between IFN-gamma and IL-6 via mathematical modelling. BMC Bioinf 14:41CrossRefGoogle Scholar
  40. Reymond A, Meroni G, Fantozzi A, Merla G, Cairo S, Luzi L, Riganelli D, Zanaria E, Messali S, Cainarca S, Guffanti A, Minucci S, Pelicci PG, Ballabio A (2001) The tripartite motif family identifies cell compartments. EMBO J 20:2140–2151PubMedCentralCrossRefPubMedGoogle Scholar
  41. Satoh-Horikawa K, Nakanishi H, Takahashi K, Miyahara M, Nishimura M, Tachibana K, Mizoguchi A, Takai Y (2000) Nectin-3, a new member of immunoglobulin-like cell adhesion molecules that shows homophilic and heterophilic cell-cell adhesion activities. J Biol Chem 275:10291–10299CrossRefPubMedGoogle Scholar
  42. Schaid DJ, Rowland CM, Tines DE, Jacobson RM, Poland GA (2002) Score tests for association between traits and haplotypes when linkage phase is ambiguous. Am J Hum Genet 70:425–434PubMedCentralCrossRefPubMedGoogle Scholar
  43. Sydnor E, Perl TM (2014) Healthcare providers as sources of vaccine-preventable diseases. Vaccine 32:4814–4822CrossRefPubMedGoogle Scholar
  44. Takai Y, Miyoshi J, Ikeda W, Ogita H (2008) Nectins and nectin-like molecules: roles in contact inhibition of cell movement and proliferation. Nature reviews. Mol Cell Biol 9:603–615Google Scholar
  45. Yen D, Cheung J, Scheerens H, Poulet F, McClanahan T, McKenzie B, Kleinschek MA, Owyang A, Mattson J, Blumenschein W, Murphy E, Sathe M, Cua DJ, Kastelein RA, Rennick D (2006) IL-23 is essential for T cell-mediated colitis and promotes inflammation via IL-17 and IL-6. J Clin Invest 116:1310–1316PubMedCentralCrossRefPubMedGoogle Scholar
  46. Yu S, Gao B, Duan Z, Xu W, Xiong S (2011) Identification of tripartite motif-containing 22 (TRIM22) as a novel NF-kappaB activator. Biochem Biophys Res Commun 410:247–251CrossRefPubMedGoogle Scholar
  47. Yuan J, Wegenka UM, Lutticken C, Buschmann J, Decker T, Schindler C, Heinrich PC, Horn F (1994) The signalling pathways of interleukin-6 and gamma interferon converge by the activation of different transcription factors which bind to common responsive DNA elements. Mol Cell Biol 14:1657–1668PubMedCentralPubMedGoogle Scholar
  48. Zhou L, Wei B, Xing C, Xie H, Yu X, Wu L, Zheng S (2011) Polymorphism in 3’-untranslated region of toll-like receptor 4 gene is associated with protection from hepatitis B virus recurrence after liver transplantation. Transpl Infect Dis 13:250–258CrossRefPubMedGoogle Scholar

Copyright information

© Springer-Verlag Berlin Heidelberg 2015

Authors and Affiliations

  • Inna G. Ovsyannikova
    • 1
  • Hannah M. Salk
    • 1
  • Beth R. Larrabee
    • 2
  • V. Shane Pankratz
    • 2
  • Gregory A. Poland
    • 1
    Email author
  1. 1.Mayo Clinic Vaccine Research GroupMayo ClinicRochesterUSA
  2. 2.Department of Health Sciences ResearchMayo ClinicRochesterUSA

Personalised recommendations