Journal of Molecular Evolution

, Volume 60, Issue 2, pp 174–182 | Cite as

Intervening Sequences of Regularly Spaced Prokaryotic Repeats Derive from Foreign Genetic Elements

  • Francisco J.M. Mojica
  • Chc)sar Díez-Villaseñor
  • Jesús García-Martínez
  • Elena Soria
Article

Abstract

Prokaryotes contain short DNA repeats known as CRISPR, recognizable by the regular spacing existing between the recurring units. They represent the most widely distributed family of repeats among prokaryotic genomes, suggesting a biological function. The origin of the intervening sequences, at present unknown, could provide clues about their biological activities. Here we show that CRISPR spacers derive from preexisting sequences, either chromosomal or within transmissible genetic elements such as bacteriophages and conjugative plasmids. Remarkably, these extrachromosomal elements fail to infect the specific spacer-carrier strain, implying a relationship between CRISPR and immunity against targeted DNA. Bacteriophages and conjugative plasmids are involved in prokaryotic population control, evolution, and pathogenicity. All these biological traits could be influenced by the presence of specific spacers. CRISPR loci can be visualized as mosaics of a repeated unit, separated by sequences at some time present elsewhere in the cell.

Keywords

CRISPR DNA repeats Conjugative plasmids Bacteriophages Lateral gene transfer Prokaryotic evolution Pathogenicity 

Introduction

Prokaryotic genomes contain a peculiar family of repeated DNA sequences. They consist of 24- to 40-nucleotide (nt) recurrent motifs regularly spaced by intervening sequences of sizes similar to that of the repeated unit. These repetitive elements were defined as short regularly spaced repeats (SRSR) (Mojica et al. 2000) and more recently named CRISPR (clustered regularly interspaced short palindromic repeats) (Jansen et al. 2002). CRISPR are widespread among the various physiological and phylogenetic groups of prokaryotes including Archaea (both Crenarchaeota and Euryarchaeota) and lineages of Gram-negative and Gram-positive bacteria (Jansen et al. 2002; Mojica et al. 2000). Thus they represent the most widely distributed family of repeats among prokaryotic genomes. A biological function is predicted by the broad distribution and the remarkable structural conservation of CRISPR, but this has not been firmly established. The only experimental insight reported in this sense relates CRISPR to partitioning on the basis of incompatibility between replicons containing loci of these repeats (Mojica et al. 1995). The origin of the intervening sequences, at present also unknown, could provide the clue to determine the CRISPR function. With this aim, we have carried out a systematic search for spacer identities, finding significant similarities to a variety of DNA molecules. The highest identities are with genetic elements, including chromosomes, bacteriophages, and conjugative plasmids, of strains closely related to the one containing the spacer. Interestingly, these targeted viruses are unable to infect the spacer-carrier cell but succeed with closely related strains lacking the specific CRISPR spacer. Likewise, plasmids efficiently transferred among various species in the same phylogenetic group cannot be stably maintained in members with a CRISPR spacer matching a sequence in the replicon. The relationship between CRISPR and immunity against targeted foreign DNA is discussed in relation to its functional and evolutionary significance.

Materials and Methods

PCR and Nucleotide Sequencing

PCR reactions for E. coli CRISPR loci amplification were performed under standard conditions with recombinant Taq polymerase from Invitrogen (Carlsbad, CA), using the oligonucleotide primers 5′TGGTGAAGGAGTTGGCGAAGG3′ and 5′AAAAT GTCCCTCCGCGCTTACG3′ or 5′CGATCCAGAGCTGGTCG AATG3′ and 5′CGCTGACCGATGATAAAC3′. PCR products were purified with the QIAquick PCR purification kit (QiaGen, Valencia, CA) and sequenced with the Big Dye Terminator Cycle sequencing kit in an ABI PRISM 310 DNA Sequencer following the manufacturer instructions (Applied Biosystems, Foster City, CA). The sequence data for CRISPR regions of the E. coli strains ECOR42, ECOR44, ECOR47, and ECOR49 have been submitted to the GeneBank database under accession numbers AY490777, AY490778, AY490779, and AY490780, respectively.

Sequence Analyses

CRISPR loci of available prokaryotic genomes were detected with a specifically designed computer program (Mojica et al. 2000). Similarities to the spacers were searched for in the GeneBank nucleotide sequence database using the BLASTn program (Altschul et al. 1997) at the NCBI Web site (www.ncbi.nlm.nih.gov/BLAST/). The default parameters were used, but for a word size of 7. Given the short length of the spacers (<50 nt) and the considerably large database (over 1010 nt), the significance of the aligments was empirically determined by an iterative process. First, only identical matches were considered, which gave Expect values (E-values) from 0.02 (20-nt sequence) to 10↓18 (for the largest spacers). According to this and to the abrupt discontinuity usually found between sequences related and unrelated to the identical one, the cutoff for the E-value in subsequent searches was rigorously set at 0.02. Although searches were done against all organisms, alignments with values below the threshold corresponded to sequences related to the organism hosting the query (with identities over 80%), and the first match after the discontinuity mainly to eukaryotic sequences, validating this cutoff value. Thus, eventually, sequence identity, E-value, and relatedness were used together as criteria in each search to confirm positives and recognize false negatives. Sequences fitting these established criteria are designated CRISPR-spacer homologs in the text.

Results

We have searched for identities to about 4500 CRISPR spacers from 67 strains representing 36 genera of prokaryotes (Table 1). Significant similarities to known sequences (Fig. 1; see Materials and Methods for criteria) were found for 88 spacers from 4 strains of Archaea, 12 strains of Gram-negative bacteria, and 9 strains of Gram-positive bacteria (Table 2). Interestingly, 47 spacers of the 88 matched sequences within genes corresponding to bacteriophages, 10 within plasmidic DNA, and 31 within chromosomal DNA not directly related to foreign genetic elements.
Table 1

List of strains analyzed

Strain

Phylogenetic group

Aeropyrum pernix K1

Crenarchaeota

Aquifex aeolicus VF5

Aquificales

Archaeoglobus fulgidus DSM-4304

Euryarchaeota

Bacillus cereus ATCC-14579

Gram-positive bacteria

Bacillus halodurans C-125

Gram-positive bacteria

Calothrix sp. D253

Cyanobacteria

Campylobacter jejuni subsp. jejuni NCTC11168

Epsilon-proteobacteria

Chlorobium tepidum TLS

CFB/green-sulfur bacteria

Clostridium difficile 630

Gram-positive bacteria

Clostridium tetani Massachusetts E88

Gram-positive bacteria

Corynebacterium diphtheriae gravis NCTC13129

Gram-positive bacteria

Corynebacterium efficiens YS-314T

Gram-positive bacteria

Escherichia coli UPEC-CFT073

Gamma-proteobacteria

Escherichia coli O157:H7 Sakai

Gamma-proteobacteria

Escherichia coli O157:H7 EDL933

Gamma-proteobacteria

Escherichia coli K12-MG1655

Gamma-proteobacteria

Escherichia coli ECOR42

Gamma-proteobacteria

Escherichia coli ECOR44

Gamma-proteobacteria

Escherichia coli ECOR47

Gamma-proteobacteria

Escherichia coli ECOR49

Gamma-proteobacteria

Geobacillus stearothermophilus 10

Gram-positive bacteria

Geobacter sulfurreducens PCA

Delta-proteobacteria

Haloferax mediterranei ATCC-33500

Euryarchaeota

Haloferax volcanii DS2

Euryarchaeota

Listeria monocytogenes EGD-e

Gram-positive bacteria

Listeria innocua Clip 11262

Gram-positive bacteria

Methanothermobacter thermoautotrophicum H

Euryarchaeota

Methanococcus jannaschii DSM-2661

Euryarchaeota

Methanopyrus kandleri AV19

Euryarchaeota

Mycoplasma gallisepticum R

Gram-positive bacteria

Nanoarchaeum equitans Kin4-M

Nanoarchaeota

Neisseria meningitidis Z2491 (serogroup A)

Beta-proteobacteria

Nitrosomonas europaea ATCC-19718

Beta-proteobacteria

Nostoc sp. PCC 7120

Cyanobacteria

Pasteurella multocida Pm70

Gamma-proteobacteria

Photorhabdus luminescens laumondii TT01

Gamma-proteobacteria

Porphyromonas gingivalis W83

CFB/green-sulfur bacteria

Pyrobaculum aerophilum IM2

Crenarchaeota

Pyrococcus furiosus DSM3638

Euryarchaeota

Pyrococcus abyssi GE5

Euryarchaeota

Pyrococcus horikoshii (shinkaj) OT3

Euryarchaeota

Salmonella bongori 12149

Gamma-proteobacteria

Salmonella enterica Typhi Ty2

Gamma-proteobacteria

Salmonella enterica Typhi CT18

Gamma-proteobacteria

Salmonella enterica subsp. enterica serovar Dublin

Gamma-proteobacteria

Salmonella enteritidis PT4

Gamma-proteobacteria

Salmonella paratyphi A

Gamma-proteobacteria

Salmonella typhimurium LT2 SGSC1412

Gamma-proteobacteria

Salmonella typhimurium DT104

Gamma-proteobacteria

Salmonella typhimurium SL1344

Gamma-proteobacteria

Shigella flexneri 2a301

Gamma-proteobacteria

Shigella flexneri 2a2457T

Gamma-proteobacteria

Shigella sonnei 53G

Gamma-proteobacteria

Streptococcus agalactiae NEM316

Gram-positive bacteria

Streptococcus agalactiae 2603V/R

Gram-positive bacteria

Streptococcus mutans UA159

Gram-positive bacteria

Streptococcus pyogenes M1 GAS SF370

Gram-positive bacteria

Sulfolobus solfataricus P2

Crenarchaeota

Sulfolobus tokodaii 7

Crenarchaeota

Thermoanaerobacter tengcongensis MB4T

Gram-positive bacteria

Thermoplasma acidophilum DSM1728

Euryarchaeota

Thermoplasma volcanium GSS1

Euryarchaeota

Thermotoga maritima MSB8

Thermotogales

Thermus thermophilus HB8

Thermus/Deinococcus

Vibrio vulnificus YJ016

Gamma-proteobacteria

Yersinia pestis CO-92 (Biovar Orientalis)

Gamma-proteobacteria

Yersinia pestis KIM5P12 (Biovar Mediaevalis)

Gamma-proteobacteria

Figure 1

Distribution of E-values corresponding to validated similarities (solid bars) and best-score discarded alignments for the positive searches (open bars). Cutoff significance value is indicated by an arrow. See Materials and Methods for details.

Table 2

Distribution of CRISPR-spacer homologs

  

No. of spacers with homologs in

Strain

No. of spacers analyzed

Phagesa

Plasmids

NFb

Chlorobium tepidum TLS

62

 

1

 

Clostridium tetani Massachusetts E88

62

1

 

6

Corynebacterium efficiens YS-314T

22

 

1

2

Escherichia coli ECOR42

14

 

1

 

Escherichia coli ECOR44

10

1

  

Escherichia coli ECOR47

17

1

  

Escherichia coli ECOR49

11

 

1

 

Listeria innocua Clip11262

9

3

  

Listeria monocytogenes EGD-e

4

1

  

Methanothermobacter thermoautotrophicum H

169

9

  

Mycoplasma gallisepticum R

71

  

1

Neisseria meningitidis Z2491 (serogroup A)

16

  

4

Photorhabdus luminescens laumondii TT01

65

7

 

3

Porphyromonas gingivalis W83

44

  

4

Pyrobaculum aerophilum IM2

129

  

1

Salmonella typhimurium LT2 SGSC1412

57

1

  

Shigella sonnei 53G

3

  

1

Streptococcus agalactiae NEM316

13

1

 

1

Streptococcus agalactiae 2603V/R

25

1

1

3

Streptococcus pyogenes MI GAS SF370

9

8

  

Sulfolobus solfataricus P2

424

6

3

 

Sulfolobus tokodaii 7

471

2

2

 

Thermoanaerobacter tengcongensis MB4T

306

  

5

Yersinia pestis CO-92 (Biovar Orientalis)

16

4

  

Yersinia pestis KIM5P12 (Biovar Mediaevalis)

10

1

  

aProphages are included.

bNumber of spacers with homology to chromosomal sequences not directly related to foreign DNA (prophages are excluded).

The spacers from the crenarchaea Sulfolobus, the euryarchaea Methanothermobacter, the Gram-positive bacteria Streptococcus pyogenes, and the Gram-negative bacteria Escherichia coli were selected as representatives of the four prokaryotic groups for further analysis. Given the substantial differences and evolutionary distance between these microorganisms, the conclusions drawn from this study span the prokaryotes.

Analysis of Sulfolobus CRISPR Spacers

The members of the genus Sulfolobus are sulfur metabolizing aerobic crenarchaea, growing optimally at 80°C and pH 2 4.

Sulfolobus solfataricus P2 has about 400 CRISPR spacers (She et al. 2001), 9 of which showed similarity to known sequences (Table 3), consistently within extrachromosomal genetic elements of Sulfolobus, either SIRV viruses (Prangishvili et al. 1999) or the conjugative plasmid pNOB8 (Schleper et al. 1995). It is noteworthy that, among the viral genes, only ORF121 (a putative resolvase [Birkenbihl et al. 2001]) has a homolog (hje) in the S. solfataricus P2 chromosome, although with a much lower similarity to the spacer sequence (13 instead of 32 identities in 37 nt). The plasmid-borne genes containing the most similar sequences to spacers are involved in transposition (ORF406; homologous to transposases [Zillig et al. 1998]), replicon partitioning (ORF315; homologous to parA [Easter et al. 1997]), or plasmid transfer (ORF1025; homologous to traG [Cabezón et al. 1997; Firth and Skurray 1992]). Only ORF406 of pNOB8 has homologous genes within the S. solfataricus chromosome, and like hje (see above), the similarity to the spacer diminishes from 30 to fewer than 21 identities in 37 nt.
Table 3

Features of the sequences most similar to CRISPR spacers from the genus Sulfolobus

Strain

ORF

Replicon

Activity

Alignmenta

S. solfataricus P2

ORF406

pNOB8

Transposase

Open image in new window

ORF1025

pNOB8

NTPase

Open image in new window

ORF315

pNOB8

Resolvase

Open image in new window

ORF121

SIRV1

Resolvase

Open image in new window

ORF510

SIRV1

Unknown

Open image in new window

ORF134

SIRV1

Structural

Open image in new window

ORF356

SIRV1

Glycosyl transferase

Open image in new window

ORF98

SIRV1

Unknown

Open image in new window

ORF268

SIRV1

Unknown

Open image in new window

S. tokodaii strain7

ORF F-92

SSV1

Unknown

Open image in new window

ORF436

SIRV1

Unknown

Open image in new window

ORF94

pING1

Unknown

Open image in new window

ORF246

pNOB8

Unknown

Open image in new window

aCRISPR-spacer sequence (top line) and best-match homologous sequence (bottom line).

Sulfolobus tokodaii strain7 has about 450 CRISPR spacers (Kawarabayasi et al. 2001). Four of them showed significant similarity to known sequences, invariably within uncharacterized ORFs located in genetic elements of Sulfolobus, either viruses (SIRV1 and SSV1 [Prangishvili et al. 1999; Stedman et al. 2003]) or conjugative plasmids (pNOB8 and pING1 [She et al. 1998; Stedman et al. 2000; Zillig et al. 1998]) (see Table 3). No homolog to these genes was detected in the S. tokodaii genome.

Analysis of Methanothermobacterthermoautotrophicum CRISPR Spacers

Methanothermobacter (formerly Methanobacterium) thermoautotrophicum is a lithoautotrophic, thermophilic euryarchaeon that grows optimally at 65°C. M. thermoautotrophicum H has 169 CRISPR spacers (Mojica et al. 2000), 9 of which showed similarity to sequences in the databases (Table 4), all of them within phages of Methanothermobacter, either the M. wolfeii prophage ΨM100 (four spacers [Luo et al. 2001]) or the M. marburgensis phage ΨM2 (six spacers including one duplicated [Pfister et al. 1998]).
Table 4

Features of the sequences most similar to CRISPR spacers from Methanothermobacter thermoautotrophicum

Location

Phage

Activity

Alignmenta

40 bp 3′ from ORF31

ΨM100

Not applicable

Open image in new window

ORF31

ΨM100

Unknown

Open image in new window

ORF31

ΨM100

Unknown

Open image in new window

ORF21

ΨM100

Tail protein

Open image in new window

peiP

ΨM2

Pseudomurein endoisopeptidase

Open image in new window

ORF6

ΨM2

Unknown

Open image in new window

ORF6

ΨM2

Unknown

Open image in new window

103 bp 3′ from ORF6

ΨM2

Not applicable

Open image in new window

ORF17

ΨM2

Unknown

Open image in new window

aCRISPR-spacer sequence (top line) and best-match homologous sequence (bottom line).

Among the genes containing sequences similar to spacers, only peiP (a lytic enzyme [Luo et al. 2001]) has a homolog (MTH412) in the M. thermoautotrophicum H chromosome. As in the Sulfolobus cases (see above), the spacer sequence is greatly degenerated (13 instead of 37 identities in 37 nt).

Analysis of Streptococcus pyogenes CRISPR Spacers

Streptococcus pyogenes is a strict human pathogen (Cunningham 2000) member of the low-G+C group of Gram-positive bacteria. Among the four at present fully sequenced S. pyogenes strains, we have only detected CRISPR loci in SF370 (Ferretti et al. 2001), which contains two clusters of repeats, one of them with four CRISPR units (Cluster4), and the other (Cluster7) with seven repeats (Jansen et al. 2002). The three spacers of Cluster4 (here named 4-1, 4-2, and 4-3) and five of six spacers of Cluster7 (here named 7-1, 7-2, 7-3, 7-4, and 7-5) showed significant similarity to known sequences (Table 5). The greatest similarities were found within prophages present in the CRISPR-negative S. pyogenes strains SSI-1 (Nakagawa et al. 2003), MGAS8232 (Smoot et al. 2002), and MGAS315 (Beres et al. 2002). Those genes containing sequences identical to spacers 7-1 (spyM3_1215 of prophage 315.4, spyM3_0930 of prophage 315.2, and spyM3_119 of prophage 315.6, all in MGAS315, and homologous genes in the other strains) and 7-4 (hylp within prophage 315.3 in MGAS315) are related to cell lysis. Genes with homologs to spacers 4-3 and 7-3 are involved in DNA modification, probably protecting the phage against host restriction. Gene spyM3_0941 of prophage 315.2 in MGAS315 and homologs in SSI-1 and MGAS8323, all of them containing a sequence similar to spacer 4-2 (28 identities in 31 nt), encode a capside structural protein (Beres et al. 2002). The gene with similarity to spacer 7-2 encodes the exotoxin SpeM, which acts as a superantigen (Profit et al. 2003; Smoot et al. 2002). It is noteworthy that the Streptococcus prophages containing sequences similar to CRISPR spacers are usually absent from the SF370 genome. Moreover, while the homologous sequence is highly conserved in CRISPR-negative Streptococcus strains, in the exceptional cases where a prophage homolog is inserted into the SF370 genome, either the spacer-homologous gene is absent (spacer 4-1) or the corresponding sequence similar to the spacer is degenerated (spacers 7-1 and 7-4).
Table 5

Features of the sequences most similar to CRISPR spacers from S. pyogenes

Spacer

Gene

Prophagea

Activity

Alignmentb

4-1

spyM3_1239

315.4

Unknown

Open image in new window

4-2

spyM3_0941

315.2

Capside protein

Open image in new window

4-3

spyM18_0741

ΦspeC

Methyltransferase

Open image in new window

7-1

spyM3_1215

315.4

Endopeptidase

Open image in new window

7-2

speM

ΦspeLM

Exotoxin

Open image in new window

7-3

spyM18_0742

ΦspeC

Methyltransferase

Open image in new window

7-4

hylP

315.3

Hyaluronidase

Open image in new window

7-5

spyM3_1347

315.5

Unknown

Open image in new window

aProphages 315.2-5 are integrated into S. pyogenes MGAS315. ΦspeC and ΦspeLM are integrated into S. pyogenes MGAS8232.

bCRISPR-spacer sequence (top line) and best-match homologous sequence (bottom line).

Analysis of Escherichia coli CRISPR Spacers

E. coli is an extensively studied Gram-negative bacteria that includes both saprophytic and pathogenic strains. No homology to CRISPR spacers in the genomes of the E. coli strains UPEC-CFT073, O157:H7 Sakai, 0157:H7-EDL933, and K12-MG1655 was detected in this work. We have sequenced additional CRISPR loci from strains of the E. coli reference (ECOR) collection (Ochman and Selander 1984) and found similarities ranging from 28 identities in 32 nt to 100% identity for four spacers (Table 6). Two of them have the highest similarity within genes of enterobacteria conjugative plasmids, and the other two within enterobacteria phages. The plasmid-borne genes involved are resD (ECOR49 spacer), related to plasmid replication and resolution (Lane et al. 1986), and a traI homolog (ECOR42 spacer), which participates in plasmid transfer (Traxler and Minkley 1988). One of the viral genes is located close to the replication origin of phage P1 (ECOR44 spacer) (Martin et al. 1991), and another is the darB gene of the same phage (ECOR47 spacer), which encodes for a DNA methylase involved in P1 protection against host restriction (Iida et al. 1987).
Table 6

Features of the sequences most similar to CRISPR spacers from E. coli

Strain

Gene

Element

Activity

Alignmenta

ECOR42

traI

Plasmid F

Helicase

Open image in new window

ECOR44

Unannotated

Phage P1

Unknown

Open image in new window

ECOR47

darB

Phage P1

Methylase

Open image in new window

ECOR49

resD

Plasmid F

Resolvase

Open image in new window

aCRISPR-spacer sequence (top line) and best-match homologous sequence (bottom line).

Discussion

In this paper we report the origin of the CRISPR intervening sequences, demonstrating that such spacers are not unique, as previously considered (Jansen et al. 2002; Mojica et al. 2000), but derive from preexisting sequences. The highest similarities to a given spacer are found within genetic elements of strains closely related to that carrying the spacer, reinforcing the conclusion that the CRISPR intervening sequences originate from such elements. About 65% of the spacer homologs encountered correspond to bacteriophages or conjugative plasmids, and the remaining 35% to chromosomal sequences not directly related to foreign DNA. This proportion of chromosomal DNA is most likely overestimated because of the limited accessory element sequences in the databases (Canchaya et al. 2003). The fact that only 88 spacers of about 4500 probed show significant identities could be interpreted as indicating a vast amount of uncharacterized genetic elements in nature. The case of S. pyogenes SF370 is exceptional. Eight of nine spacers showed over 90% identity to sequences within prophages integrated in other strains, suggesting a high sequence conservation of the corresponding genes among S. pyogenes phages and, at the same time, evoking a functional relevance for the genes targeted by spacers.

The incorporation of a given spacer in a CRISPR locus must not be devoid of functional significance. Although our current knowledge remains limited, multiple observations suggest that CRISPR could be involved in conferring specific immunity against foreign DNA: (i) SIRV viruses are unable to infect S. solfataricus (with CRISPR spacers similar to this phage sequences), although they can penetrate the cell (She et al. 2001), and while a SSV-type element is integrated into the S. solfataricus genome (which has no CRISPR spacer similar to SSV sequences), SSV-related prophages are absent from S. tokodaii; (ii) M. thermoautotrophicum H, with CRISPR spacers similar to ΨM100, has two putative attachment sites of this phage, but there is no recognizable prophage in its genome (Smith et al. 1997); (iii) in the exceptional cases where a prophage homologous to those that contain sequences matching a given spacer is present in the carrier strain, the particular sequence used to be either absent or degenerated; (iv) pNOB8 can be transferred into S. solfataricus, but this plasmid is not integrated, even though there is a perfectly conserved integration site (She et al. 2002), neither stably maintained as a replicon (Schleper et al. 1995); and (v) although there is evidence that a pNOB8-like plasmid was once integrated into the S. tokodaii strain7 genome, only a few sequences homologous to pNOB8 genes remain scattered in the chromosome (Kawarabayasi et al. 2001). Indeed, the preferential occurrence of CRISPR spacers derived from genetic elements that fail to infect the corresponding spacer-carrier strain, but not from those successfully propagated in the population, strongly suggests a relationship between CRISPR and such immunity. Most targeted genes detected in this study are directly involved in plasmid transference, DNA replication, virion assembly, DNA protection against restriction, replicon partitioning, pili synthesis, replicons resolution, transposition, or phage integration and excision. Inhibition of any of these genes would be enough to hinder infectivity. The incompatibility with foreign DNA could be explained by the inhibition of any of these gene functions, necessary for the efficient transfer or infection. The transcription of the CRISPR loci (Tang et al. 2002) suggests that such activity could be executed by CRISPR-RNA molecules, acting as regulatory RNA that specifically recognizes the target through the homologous RNA-spacer sequence, similarly to the eukaryotic interference RNA.

The susceptibility to foreign genetic elements has multiple consequences related to the pathogenic potential and evolution of the prokaryotes: (i) bacteriophages are involved in prokaryotic population control by inducing cell lysis (Young et al. 1992), (ii) antibiotic resistance is frequently transmitted by conjugative plasmids (Martínez and Baquero 2002), (iii) both bacteriophages and conjugative plasmids are vectors for lateral gene transfer (Boucher et al. 2003), and (iv) many virulence factors from bacteria are bacteriophage encoded (Boyd and Brussow 2002). Indeed, prophages account for most of the genetic variation among closely related strains and have greatly contributed to their evolution (Banks et al. 2002; Glaser et al. 2001).

Control of both mobility and maintenance of extrachromosomal genetic elements could be a relevant task of CRISPR loci, but the homologies found with chromosomal sequences unrelated to foreign DNA indicate that CRISPR may be constituents of a more versatile regulatory system. Experimental approaches have to be carried out to corroborate this functionality.

Notes

Acknowledgments

This work was financed by research grants from the Conselleria de Cultura, Educació i Ciència, Generalitat Valenciana (CTIDIB/2002/155 and gv04B-457). C.D. is supported by a graduate fellowship from the Ministerio de Educación, Cultura y Deporte. We are indebted to Kathy Hernández for assistance and to J. Antón for critical reading of the manuscript.

References

  1. Altschul, SF, Madden, TL, Schaffer, AA, Zhang, J, Zhang, Z, Miller, W, Lipman, DJ 1997Gapped BLAST and PSI-BLAST: A new generation of protein database search programsNucleic Acids Res2533893402PubMedGoogle Scholar
  2. Banks, DJ, Beres, SB, Musser, JM 2002The fundamental contribution of phages to GAS evolution, genome diversification and strain emergenceTrends Microbiol10515521Google Scholar
  3. Beres, SB, Sylva, GL, Barbian, KD, Lei, BF, Hoff, JS, Mammarella, ND, Liu, MY, Smoot, JC, Porcella, SF, Parkins, LD, Campbell, DS, Smith, TM, McCormick, JK, Leung, DYM, Schlievert, PM, Musser, JM 2002Genome sequence of a serotype M3 strain of group A Streptococcus: Phage-encoded toxins, the high-virulence phenotype, and clone emergenceProc Natl Acad Sci USA991007810083Google Scholar
  4. Birkenbihl, RP, Neef, K, Prangishvili, D, Kemper, B 2001Holliday junction resolving enzymes of archaeal viruses SIRV1 and SIRV2J Mol Biol30910671076Google Scholar
  5. Boucher, Y, Douady, CJ, Papke, RT, Walsh, DA, Boudreau, ME, Nesbo, CL, Case, RJ, Doolittle, WF 2003Lateral gene transfer and the origins of prokaryotic groupsAnnu Rev Genet37283328Google Scholar
  6. Boyd, EF, Brussow, H 2002Common themes among bacteriophage-encoded virulence factors and diversity among the bacteriophages involvedTrends Microbiol10521529Google Scholar
  7. Cabezón, E, Sastre, JI, la Cruz, F 1997Genetic evidence of a coupling role for the TraG protein family in bacterial conjugationMol Gen Genet254400406Google Scholar
  8. Canchaya, C, Proux, C, Fournous, G, Bruttin, A, Brq/4ssow, H 2003Prophage genomicsMicrobiol Mol Biol Rev6738276Google Scholar
  9. Cunningham, MW 2000Pathogenesis of group A streptococcal infectionsClin Microbiol Rev13470511Google Scholar
  10. Easter, CL, Sobecky, PA, Helinski, DR 1997Contribution of different segments of the par region to stable maintenance of the broad-host-range plasmid RK2J Bacteriol17964726479PubMedGoogle Scholar
  11. Ferretti, JJ, McShan, WM, Ajdic, D,  et al. 2001Complete genome sequence of an M1 strain of Streptococcus pyogenesProc Natl Acad Sci USA9846584663Google Scholar
  12. Firth, N, Skurray, R 1992Characterization of the F plasmid bifunctional conjugation gene traGMol Gen Genet232145153Google Scholar
  13. Glaser, P, Frangeul, L, Buchrieser, C,  et al. 2001Comparative genomics of Listeria speciesScience294849852CrossRefPubMedGoogle Scholar
  14. Iida, S, Streiff, MB, Bickle, TA, Arber, W 1987Two DNA antirestriction systems of bacteriophage P1, darA, and darB: Characterization of darA phagesVirology157156166Google Scholar
  15. Jansen, R, Embden, JD, Gaastra, W, Schouls, LM 2002Identification of genes that are associated with DNA repeats in prokaryotesMol Microbiol4315651575Google Scholar
  16. Kawarabayasi, Y, Hino, Y, Horikawa, H,  et al. 2001Complete genome sequence of an aerobic thermoacidophilic crenarchaeon, Sulfolobus tokodaii strain7DNA Res8123140PubMedGoogle Scholar
  17. Lane, D, Feyter, R, Kennedy, M, Phua, SH, Semon, D 1986D protein of miniF plasmid acts as a repressor of transcription and as a site-specific resolvaseNucleic Acids Res1497139728Google Scholar
  18. Luo, YN, Pfister, P, Leisinger, T, Wasserfallen, A 2001The genome of archaeal prophage Ψ M100 encodes the lytic enzyme responsible for autolysis of Methanothermobacter wolfeiiJ Bacteriol18357885792Google Scholar
  19. Martin, KA, Davis, MA, Austin, S 1991Fine-structure analysis of the P1 plasmid partition siteJ Bacteriol17336303634Google Scholar
  20. Martínez, JL, Baquero, F 2002Interactions among strategies associated with bacterial infection: Pathogenicity, epidemicity, and antibiotic resistanceClin Microbiol Rev15647679Google Scholar
  21. Mojica, FJM, Ferrer, C, Juez, G, Rodríguez-Valera, F 1995Long stretches of short tandem repeats are present in the largest replicons of the Archaea Haloferax mediterranei and Haloferax volcanii and could be involved in replicon partitioningMol Microbiol178593Google Scholar
  22. Mojica, FJM, Díez-Villaseñor, C, Soria, E, Juez, G 2000Biological significance of a family of regularly spaced repeats in the genomes of Archaea, Bacteria and mitochondriaMol Microbiol36244246Google Scholar
  23. Nakagawa, I, Kurokawa, K, Yamashita, A, Nakata, M, Tomiyasu, Y, Okahashi, N, Kawabata, S, Yamazaki, K, Shiba, T, Yasunaga, T, Hayashi, H, Hattori, M, Hamada, S 2003Genome sequence of an M3 strain of Streptococcus pyogenes reveals a large-scale genomic rearrangement in invasive strains and new insights into phage evolutionGenome Res1310421055Google Scholar
  24. Ochman, H, Selander, RK 1984Standard reference strains of Escherichia coli from natural populationsJ Bacteriol157690693Google Scholar
  25. Pfister, P, Wesserfallen, A, Stettler, R, Leisinger, T 1998Molecular analysis of Methanobacterium phage ΨM2Mol Microbiol30233244Google Scholar
  26. Prangishvili, D, Arnold, HP, Gotz, D, Ziese, U, Holz, I, Kristjansson, JK, Zillig, W 1999A novel virus family, the Rudiviridae: Structure, virus-host interactions and genome variability of the Sulfolobus viruses SIRV1 and SIRV2Genetics1521387 1396Google Scholar
  27. Profit, T, Sriskandan, S, Yang, L, Fraser, JD 2003Superantigens and streptococcal toxic shock syndromeEmerg Infect Dis912111218Google Scholar
  28. Schleper, C, Holz, I, Janekovic, D, Murphy, J, Zillig, W 1995A multicopy plasmid of the extremely thermophilic archaeon Sulfolobus effects its transfer to recipients by matingJ Bacteriol17744174426Google Scholar
  29. She, Q, Phan, H, Garrett, RA, Albers, SV, Stedman, KM, Zillig, W 1998Genetic profile of pNOB8 from Sulfolobus: The first conjugative plasmid from an archaeonExtremophiles2417425Google Scholar
  30. She, Q, Singh, RK, Confalonieri, F,  et al. 2001The complete genome of the crenarchaeon Sulfolobus solfataricus P2Proc Natl Acad Sci USA9878357840CrossRefPubMedGoogle Scholar
  31. She, Q, Brugger, K, Chen, L 2002Archaeal integrative genetic elements and their impact on genome evolutionRes Microbiol153325332Google Scholar
  32. Smith, DR, DoucetteStamm, LA, Deloughery, C,  et al. 1997Complete genome sequence of Methanobacterium thermoautotrophicum H: Functional analysis and comparative genomicsJ Bacteriol17971357155PubMedGoogle Scholar
  33. Smoot, JC, Barbian, KD, Compel, JJ,,  et al. 2002Genome sequence and comparative microarray analysis of serotype M18 group A Streptococcus strains associated with acute rheumatic fever outbreaksProc Natl Acad Sci USA9946684673Google Scholar
  34. Smoot, LM, McCormick, JK, Smoot, JC, Hoe, NP, Strickland, I, Cole, RL, Barbian, KD, Earhart, CA, Ohlendorf, DH, Veasy, LG, Hill, HR, Leung, DYM, Schlievert, PM, Musser, JM 2002Characterization of two novel pyrogenic toxin superantigens made by an acute rheumatic fever clone of Streptococcus pyogenes associated with multiple disease outbreaksInfect Immun7070957104Google Scholar
  35. Stedman, KM, She, Q, Phan, H, Holz, I, Singh, H, Prangishvili, D, Garrett, R, Zillig, W 2000pING family of conjugative plasmids from the extremely thermophilic archaeon Sulfolobus islandicus: Insights into recombination and conjugation in CrenarchaeotaJ Bacteriol18270147020Google Scholar
  36. Stedman, KM, She, Q, Phan, H, Arnold, HP, Holz, I, Garrett, RA, Zillig, W 2003Relationships between fuselloviruses infecting the extremely thermophilic archaeon Sulfolobus: SSV1 and SSV2Res Microbiol154295302CrossRefPubMedGoogle Scholar
  37. Tang, TH, Bachellerie, JP, Rozhdestvensky, T, Bortolin, ML, Huber, H, Drungowski, M, Elge, T, Brosius, J, Huttenhofer, A 2002Identification of 86 candidates for small non-messenger RNAs from the archaeon Archaeoglobus fulgidusProc Natl Acad Sci USA9975367541Google Scholar
  38. Traxler, BA, Minkley, EG,Jr 1988Evidence that DNA helicase I and oriT site-specific nicking are both functions of the F Tral proteinJ Mol Biol5205209Google Scholar
  39. Young, R 1992Bacteriophage lysis: Mechanism and regulationMicrobiol Rev56430481Google Scholar
  40. Zillig, W, Arnold, HP, Holz, I, Prangishvili, D, Schweier, A, Stedman, K, She, Q, Phan, H, Garrett, R, Kristjansson, JK 1998Genetic elements in the extremely thermophilic archaeon SulfolobusExtremophiles2131140Google Scholar

Copyright information

© Springer Science+Business Media, Inc. 2005

Authors and Affiliations

  • Francisco J.M. Mojica
    • 1
  • Chc)sar Díez-Villaseñor
    • 1
  • Jesús García-Martínez
    • 1
  • Elena Soria
    • 1
  1. 1.División de Microbiología, Departamento de Fisiología, Genhc)tica y MicrobiologíaUniversidad de AlicanteSpain

Personalised recommendations