Marine Biology

, Volume 156, Issue 8, pp 1681–1690 | Cite as

Multiple paternity and extra-group fertilizations in a natural population of California grunion (Leuresthes tenuis), a beach-spawning marine fish

Open Access
Original Paper

Abstract

Although individuals in many fish species move to shallow waters to spawn, the California grunion (Leuresthes tenuis) is almost unique in its constitutive display of synchronous full-emergence beach spawning. During a spawning event, fish ride large waves onshore to spawn on beach land, where their eggs incubate terrestrially. Here, we employ molecular markers to ascertain how this unusual reproductive behavior impacts genetic parentage. We developed and utilized four highly polymorphic microsatellite markers to assess maternal and paternal contributions in a total of 682 progeny from 17 nests of a natural population of L. tenuis. Alleles deduced to be of paternal origin in progeny were used to determine the minimum number of sires per nest and to estimate the true number of sires per nest via Bayesian analysis. We document the following: (a) no instances of multiple maternity for progeny within a nest; (b) a high frequency of nests (88%) with multiple paternity; and (c) an appreciable fraction of nests (18%) in which the estimated number of genetic sires (as many as nine) proved to be greater than the observed number of male attendants, thus implicating occasional extra-group fertilization events. From these and other observations, we also conclude that spawning behavior in grunions may involve site choice but not explicit mate choice. In addition to providing the first analysis of molecular parentage in a beach-spawning fish, we compare our findings to those reported previously for a beach-spawning arthropod, and we discuss the forces that may be maintaining this peculiar reproductive behavior.

Introduction

Terrestrial spawning may afford several special advantages for a marine fish. Egg development can be accelerated by the increased availability of oxygen (Strathmann and Hess 1999) and by elevated temperatures in a terrestrial environment (Seymour and Bradford 1995; Smyder and Martin 2002); and, the lack of aquatic predators on a beach, and the synchronous release (when present) of hatched offspring, may increase egg (Middaugh 1981) and hatchling survival, respectively. However, potential disadvantages of terrestrial spawning include the risk of egg desiccation (Strathmann and Hess 1999), and depredation on spawning adults, eggs, or hatchlings by birds (Middaugh et al. 1983) or other beach predators. In addition, beached fish risk physical injury from wave action, exposure to infection from incurred wounds, and asphyxiation.

Spawning in many fish species entails movements of adults into shallow waters (Clark 1925; Middaugh 1981; Leggett and Frank 1990; Yamahira 1996; Martin et al. 2004), where individuals may experience, to a partial degree, some of the reproductive risks and benefits of terrestrial spawning. However, few fish species engage in either limited or full-emergence beach spawning. Indeed, the California grunion (Leuresthes tenuis) and its congener (L. sardina) are the only known fish species with synchronous and constitutive full-emergence beach spawning, during which the adults are completely out of the water for up to several minutes and the developing embryos are strictly land-based during early development (Walker 1952).

Nearly a century ago Thompson and Thompson (1919) and Clark (1925) detailed spawning events in L. tenuis. Briefly, during a mass spawning “run” (which lasts up to several hours), grunions ride large waves high up onto the beach. The event takes place during the first 3–4 nights following full-moon or new-moon tides, which coincide with the most extreme high tides of the year. Each female twists her body and uses her tail to bury herself—up to her head—in the sand, where she will deposit many eggs. Males likewise surf ashore but remain on the sand surface, releasing milt to the eggs buried below. Some males wrap their bodies around the partially exposed females, but all males quickly wriggle back to the sea. Females then work themselves out of the holes they have dug by twisting their bodies back and forth, and they too then make their way back across the beach to the water.

The deposited eggs incubate terrestrially in the moist sand for about 2 weeks until the next semilunar tide, at which time high waves once again reach the level of oviposition and hatching is initiated by agitation of the eggs (Walker 1952). The young are released synchronously to the water. Although the physical and chemical aspects of egg development associated with beach spawning have been well detailed (David 1939; Smyder and Martin 2002), aspects of the grunion mating system have not been addressed to date.

Full-emergence beach spawning by a marine fish is a highly unusual reproductive behavior that is likely to include impacts on patterns of genetic parentage. For example, empirical work by Levitan (1991) has shown that the diffusive properties of water rapidly (i.e., within a short distance) dilute sperm that have been released from a point source, an effect that is likely to be especially pronounced in open-water spawners. For the beach-spawning grunion, however, such diffusive effects might be somewhat diminished in the low-water-volume sand environment, perhaps leading to a greater probability of multiple paternity (by nearby sperm-releasing males) within a female’s clutch. Alternatively, a female’s oviposition site (the pit that she has dug in the sand) may restrict the number of males whose sperm have access to her nest. In another synchronous beach-spawner, the horseshoe crab Limulus polyphemus, paternity analyses have shown that males who are in direct physical contact with the female sire almost all of the young (Brockmann et al. 2000).

Behavioral observations suggest that as many as eight grunion males may fertilize the eggs in a given nest (Walker 1952), but this claim has not been verified genetically. With regard to paternity in any grunion nest, three distinct outcomes seem plausible: (a) one male (perhaps the first to reach the female, or the specimen who physically embraces the female or otherwise out-competes his rivals) fertilizes all of the eggs; (b) two or more males who are in direct behavioral consort with the focal female contribute to her clutch of offspring; or, (c) males that are not near the focal female at the time of her spawn also make a genetic contribution to her clutch via sand-stored pools of sperm (either deposited on-site from an earlier spawn, or diffused from nearby locations across the light film of water on the sand).

In this study, we test these possibilities by employing microsatellite markers to assess genetic parentage (paternity and maternity) in a natural population of California grunion. We determine the percentage of nests with multiple sires, the number and source of males that contributed to each nest, and we also address whether female body size influences sire numbers. We compare our genetic findings to those for a previously studied beach-spawning marine invertebrate, and interpret results in the context of sexual selection theory.

Materials and methods

Study site and sampling

The mating behavior of the California grunion may be observed along the species’ range from San Francisco to Magdalena Bay, Baja California (Miller and Lea 1972), during the spawning months of March to August. For this study, all observations and sampling of Leuresthes tenuis occurred at Laguna Beach (Orange County, 33°32′N, 117°47′W), California, during spawning runs on 13 and 14 June 2006 and 4 April 2007. In total, 17 females and their eggs were collected for parentage analysis. We identified each nesting female as an individual positioned vertically in the sand, and with at least one male attendant wrapped around her. Previous research has shown that this behavior indicates that the female is depositing eggs in the sand, at a depth of about 5–15 cm, while the male(s) release milt into the hole she has dug (Thompson and Thompson 1919). In addition, we collected 50 random adults (gender unknown) to generate population genetic data.

During initial reconnaissance, we noticed that males quickly departed if a human observer approached within a few feet during spawning activity. Thus, to minimize any effect we might otherwise have on the behavior of our study samples, we stood at least several meters away while the fish were in consort, and we also waited until the attendant males departed of their own accord (presumably after releasing milt) and the female had begun to twist her way back out of the sand. At that point we quickly captured the female and then used a small hand shovel to collect the sand with eggs directly under her. Females were immediately stored on ice and then frozen at −80°C in the laboratory. Eggs from each nest were placed in a plastic container of sand kept at ambient temperature, and brought to the laboratory for incubation. No males from study nests were collected, as it did not seem possible to do so without disrupting mating behavior. We did observe, however, that the nests we collected had as few as one to as many as six male attendants each.

Incubation and hatching of eggs

Holes were cut in the bottom of the plastic containers holding the eggs to allow for water drainage, and the containers then were suspended over a large tray. Each container was loosely covered to allow ventilation, and deionized water was added periodically to prevent egg desiccation. Eggs were incubated at 22°C for 8 days, at which time the sand–egg mixture was briefly mixed and about one quarter to one-third of the mixture was transferred to a large jar of seawater and agitated for 1 min to initiate hatching. Forty or more hatchlings from each nest were collected at random and stored in lysis buffer at −20°C for subsequent analysis.

Microsatellite isolation

Genomic DNA was extracted from individual hatchlings via a proteinase K lysis procedure (Hoelzel and Green 1998), and from each of 17 nesting mothers and 50 random adults using a Qiagen DNeasy kit (animal tissue protocol). To isolate microsatellite markers, we followed a protocol of Hamilton et al. (1999) as modified by Hauswaldt and Glenn (2003). Briefly, about 5 μg of genomic DNA was isolated from one of the 50 random individuals and was digested with the restriction enzyme BstU I (New England Biolabs). Double-stranded SuperSNX24 linkers were then ligated to the resulting fragments. To isolate fragments containing microsatellite sequences, we hybridized biotinylated microsatellite oligonucleotides (GT, GACA, GATC, GATA, and CT repeats) to the fragments with SuperSNX24 linkers, incubated the product with magnetic beads (Dynabeads, Dyna1) that bind to the probes, and then captured and washed these fragments using a magnetic particle collecting unit. Next, the microsatellite-containing fragments were amplified via PCR with the SuperSNX24 linkers utilized as priming sites, and the enriched DNA was cloned with a TOPO TA cloning kit (Invitrogen). The transformed bacteria were grown on LB plates and colonies were incubated overnight in LB broth and amplified via PCR with M13 primers (F: GTAAAACGACGGCCAGT, R: CAGGAAAGAGCTATGAC). These PCR products were then run on agarose gels, and the products with inserts ranging in size from 500–1,000 bp were sequenced on an ABI 3130xl Genetic Analyzer. Primers were designed for desirable sequences and these primer sets were tested on a select set of population DNA samples to estimate site variability. In all, four polymorphic loci (B18, B19, B39, B82) were selected. Two of the primer sets (B18 and B82) were fluorescently labeled with FAM and two (B19 and B39) were labeled with HEX.

Genetic analyses

PCR amplifications of hatchling and adult DNA were performed in a 15-μL mix composed of the following: 1.5 mM MgCl2, 0.2 mM of each dNTP, 0.2 μM each of forward and reverse primer, and 0.75 units GoTaq DNA Polymerase in a buffer supplied by the manufacturer (Promega). The amplifications began with a 2-min denaturation at 95°C, followed by 35 cycles of 95º for 30 s, 55 or 56° (see Table 1) for 1 min, and 72° for 1 min, and a final extension at 72° for 5 min. One μL of diluted PCR product was then mixed with 0.45 μL of GeneScan-ROX 500 size standard (Applied Biosystems) and 9.55 μL Hi-Di Formamide (Applied Biosystems), denatured at 95° for 3 min, and electrophoresed on an ABI 3100 Genetic Analyzer in two multiplex loading groups (B18 and B19; B39 and B82). Alleles were sized using GeneMapper 4.0 software with verification done by eye.
Table 1

Characterization of developed microsatellite loci in the California grunion, Leuresthes tenuis

Locus

Primer sequence

Repeat motifa

Size range (bp)

NA

TA(°C)

B18

F: GCTGCTGAAAATCATCATGTC

(GT)12

231–263

11

55

R: FAM-CAGATTGTATGTAACAGGC

B19

F: GCGTGTGTATTCTCATGTGTGC

(GT)15

203–241

16

55

R: HEX-CAATGCGTTAATGATATGC

B39

F: GTGAAATGATCCCAGGCAGC

(GT)24

233–311

30

56

R: HEX-CAAGGGATGATGCACAGAAC

B82

F: FAM-ATGTGAAAGAGGTGTGTTC

(GT)23

239–309

24

56

R: GTGTCAGGTTAGCGCATACAG

Values are based on a random sample of 50 individuals from the Laguna Beach, California, population

NA number of observed alleles, TA annealing temperature

aResults from one sequenced individual

Fifty random individuals were used to estimate population allelic diversity at our four loci. We used the program GENEPOP (Raymond and Rousset 1995) to estimate allele frequencies, to test for Hardy–Weinberg equilibrium at each locus, and to test for linkage disequilibrium between pairs of loci. Bonferroni corrections were applied for multiple tests where applicable, and probabilities of exclusion were calculated following Jamieson and Taylor (1997). The estimated allele frequencies were then used in the simulation program BROOD (DeWoody et al. 2000) to estimate the mean number of hatchlings per nest sufficient to detect the total number of sires. The program output suggests that a mean of 41 hatchlings per nest probably would elucidate all of the sires given approximately equal contributions among males. We genotyped a mean of 40.1 young per nest (SD = 2.52).

Finally, the number of sires per nest was assessed in two ways: (a) as the minimum number of sires, calculated as one-half the number of paternal alleles observed at the locus with the greatest allelic richness for that nest (rounded up for odd-numbered values); and (b) as a statistically adjusted estimate of the true number of sires per nest, calculated using the program PARENTAGE (Emery et al. 2001). This program uses Bayesian inference and Markov chain Monte-Carlo to sample from the posterior distributions of interest, and it attempts to account for multi-locus parental genotypes, mutation, and mis-scoring of alleles. We input allele frequencies of the parental population estimated from 50 random adult individuals, and the Markov chains were carried out with 5,000 iterations for each nest following a burn-in of 5,000 iterations and a thinning interval of 400. A prior for the mutation rate was set using a gamma distribution with a shape parameter of 2 and a mean of 0.001. This allowed for 95% of the mutation rates to lie between 0.00014 and 0.0028 mutations per generation, which is in accordance with observed mutation rates for microsatellite loci (Weber and Wong 1993). To address the potentiality that eggs from one “nest” might actually contain fertilized eggs from two or more females (either from a neighboring nest of the same run, or from a nest deposited during a previous run), the genotype of each focal female was input into PARENTAGE as a potential maternal genotype without restricting the possibility of additional dams.

Physical measurements

To address whether the number of sires per nest correlates with female body size, we measured body weight and length (fork length or FL, from the tip of the snout to the fork of the tail) of all nest females. Data then were visualized with regression analysis.

Results

Microsatellite markers and genetic population summary

In our genetic analysis of 50 random adults, allelic diversities were high at all four microsatellite loci. The mean number of alleles per locus was 20.25 (range 11–30) (Table 1; Fig. 1), and each surveyed fish displayed a unique multi-locus genotype. Mean overall heterozygosity was 0.89, and at no locus did the observed heterozygosity depart from the Hardy–Weinberg expectation. The four loci provided a combined exclusion probability of 0.99 (Table 2), and in pairwise combinations showed no indication of linkage disequilibrium (P > 0.05 after Bonferroni correction). These attributes confirm that the four loci are powerful and independent markers for parentage analyses.
Fig. 1

Allele frequencies for four microsatellite loci in the California grunion, Leuresthes tenuis

Table 2

Characteristics of microsatellite loci estimated from a sample of 50 adults from the Laguna Beach, California, population

Locus

Heterozygosity

P value for HWE

Exclusion probabilities

Observed

Expected

B18

0.84

0.80

0.98

0.43

B18

0.90

0.92

0.16

0.68

B39

0.92

0.93

0.06

0.73

B82

0.88

0.94

0.08

0.75

Combined

  

0.07

0.99

De novo mutation and null alleles

Nonamplifying (null) alleles tend to be common in microsatellite data and must be accounted for in parentage studies (Pemberton et al. 1995; Dakin and Avise 2004). We concluded that null alleles were not of significant concern in our combined four-locus assessments for two reasons. First, all hatchling fish shared an allele with their suspected mother at each of the four assayed loci, indicating Mendelian inheritance of alleles (and also confirming the status of each nest-attendant female as the genuine dam). Second, we tested for a heterozygote deficiency using our random population data following a method by Brookfield (1996), from which we estimated a mean frequency of null alleles of 0.01. Such a low frequency of null alleles would not materially affect our assessments of genetic parentage in the current multi-locus characterizations.

De novo mutations, when unrecognized as such, can potentially confound parentage analysis by inflating the inferred number of sires or dams. The program PARENTAGE identified 16 new mutations among the 682 young surveyed at four loci (5,456 alleles in total), thus yielding an estimated mutation rate of 2.9 × 10−3. This rate is similar to those detected in various other microsatellite studies (Weber and Wong 1993; Hancock 1999; Mackiewicz et al.2002). It should be also noted that this estimate encompasses any mis-scoring of alleles (i.e., we did not distinguish de novo mutation from possible mis-scoring for the aberrant alleles in our analysis). Thus, the true de novo mutation rate may be lower than the value reported here.

Genetic assessment of parentage

Hatchling genotypes invariably were consistent with the expectation of one dam per nest. In other words, no hatchling lacked an allele from its presumed mother at any locus. Likewise, statistical analysis of nest maternity with the program PARENTAGE supported a single-mother model for each nest.

On the other hand, 88% of the nests clearly displayed multiple paternity. Indeed, from the genetic evidence, only two among the 17 nests had a single contributing sire each (Fig. 2). For the remaining nests, hatchling genotypes identified 2–5 sires per nest as a documented minimum (mean = 3.18, SD = 1.42), or a mode of 2–9 sires per nest as calculated in the statistically adjusted estimate in PARENTAGE (mean = 4.30, SD = 2.54). Pmode values reported by PARENTAGE indicate the observed proportion of the modal value based on 5,000 simulations. In those nests with a modal number of sires greater than 6 (nests 4, 9, and 16), Pmode values were much lower (mean = 0.45) than those values for nests with a modal number of sires less than or equal to 6 (mean = 0.83; Table 3), indicating that precision of analysis was reduced in these nests and we may have less confidence in the modal number observed. However, P>6 (the sum of observed proportions for values greater than 6) for each of the three nests was 1.00 (Table 3), confirming that, at the least, we have confidence that the true number of sires at nests 4, 9, and 16 is greater than 6. Neither body weight nor body length of the nesting females correlated with sire numbers per nest (r2 = 0.006 and 0.004, respectively; Fig. 3).
Fig. 2

Distribution of the number of sires per grunion nest (n = 17). Bars with hatching are the minimum number of sires per nest; black bars represent the estimated number of sires per nest based on 5,000 simulations in the program PARENTAGE

Table 3

Summary of results regarding paternity at each Leuresthes tenuis nest, as estimated by allele counting (Minimum No. Sires) and inferred via the program PARENTAGE

   

PARENTAGE

Nest

No. offspring analyzed

Minimum no. sires

Range

Mean (±SE)

Mode

Pmode

1

40

3

2–5

3.21 (0.004)

3

0.79

2

38

5

5–9

6.39 (0.006)

6

0.60

3

40

2

2–3

2.02 (0.002)

2

0.98

4

40

5

7–12

8.68 (0.009)

9

0.39*

5

40

1

1

1.00 (0.000)

1

1.00

6

40

3

5–7

5.04 (0.002)

5

0.96

7

40

3

3–5

3.64 (0.005)

4

0.63

8

40

3

3–5

3.85 (0.004)

4

0.84

9

40

5

7–12

8.85 (0.008)

9

0.49*

10

49

2

2

2.00 (0.000)

2

1.00

11

40

2

3–5

3.37 (0.005)

3

0.64

12

40

3

4–7

4.19 (0.004)

4

0.82

13

40

4

4–7

5.01 (0.007)

5

0.54

14

39

5

4–6

4.95 (0.004)

5

0.84

15

40

2

2–3

2.00 (0.000)

2

1.00

16

36

5

6–11

7.64 (0.007)

8

0.48*

17

40

1

1–2

1.00 (0.007)

1

1.00

Pmode indicates the observed proportion of samples with the modal value based on 5,000 simulations

* P>6 = 1.00

Fig. 3

Correlation between a female fork length and estimated number of sires (r2 = 0.006, n = 17), and b female weight and estimated number of sires (r2 = 0.004, n = 17)

Discussion

Genetic paternity

In this study we provide the first information on genetic parentage in a beach-spawning fish. As previously suspected through behavioral observations (Thompson and Thompson 1919; Walker 1952), multiple paternity proved to be common within grunion nests (characterizing 15 of the 17 progeny cohorts we genetically analyzed). This finding might seem to have been foregone given the dense spawning aggregations in these fishes and the synchrony of gamete release, but only detailed genetic analyses could rule out the possibility that the first male to reach a female’s nest is rewarded with most or all of the fertilizations. In many animal species, similar kinds of genetic parentage analyses have revealed that the social mating system is not always a reliable guide to the actual genetic contributions of adults to the next generation (Avise 2004).

Perhaps more surprising were our documentations of high numbers of sires (estimated mean = 4.3) per nest, and the fact that for three of the 17 surveyed nests (18%), the genetically estimated number of sires (8–9, or more conservatively, number of sires >6; see Table 3) was greater than the observed number of male attendants at the nest (6 at most). This latter finding suggests that extra-group fertilizations also take place on occasion, a phenomenon that presumably requires an available “background pool” of male gametes onshore. Such a pool of gametes could in principle represent sperm that were deposited earlier at a different but proximate nest, concurrently released at a nearby nest and passively carried to the focal nest by water action, or perhaps “shotgun-released” by non-attendant males who are not situated with any particular female. We cannot decide among these possibilities with available genetic evidence, but addressing this issue could make for interesting future research on mating behaviors and sexual selection in this species.

To our knowledge, the only other beach-spawning marine animal whose mating system has been genetically analyzed to date is the horseshoe crab, Limulus polyphemus. Using microsatellite markers as applied to dams and their offspring, plus attendant males, Brockmann et al. (1994) documented multiple paternity within many Limulus nests, and also determined that only a small fraction of the fertilization events was attributable to non-attendant males. Brockmann et al. (1994) posited that the success of attendant males may help to make beach spawning advantageous despite the risks.

In our current study, the mean number of grunion offspring genotyped per nest (40.1) was well below the total progeny count, which can approach 3,000 per nest (Thompson and Thompson 1919). Thus, our current estimates of sire numbers per nest are conservative and may underestimate the true count. It should also be noted that our samples were taken during mass spawning runs with dense aggregations of individuals. The number and spatial distribution of grunions on a beach during any given spawning run varies naturally with time of year and location of the event. We would expect the level of multiple paternity to vary accordingly. Finally, we took care when collecting the nests to keep the eggs and the sand above it undisturbed to the greatest extent possible. However, it is possible that our collection method influenced the number and/or source of sperm with access to the eggs, and therefore influenced our sire estimates. In such an event, it would seem most likely that in removing the nest from the surrounding sand we would have excluded potential sources of sperm and we would therefore have underestimated the total number of sires per nest.

Mating behavior

Levitan (1998) posits that for external fertilizers, sexual selection is influenced both by sperm competition (where two or more males compete to fertilize one female’s eggs; Parker 1970) and by sperm limitation (where dilution of male gametes results in many fewer zygotes than available eggs; Pennington 1985). In light of these forces, members of a species may engage in a variety of alternative mating tactics and spawning behaviors that should increase their own fitness. Fish species, in particular, display a wide array of reproductive tactics and mating behaviors (Avise et al.2002), with male reproductive behavior being especially diverse (Breder and Rosen 1966; Gross and Sargent 1985; Taborsky 1994). The following illustrate just a few such mating behaviors: nest-tending male damselfish (Gronell 1989) may adopt eggs from other species to appear more desirable to conspecific females; similarly, female striped darters preferentially mate with males tending larger nests (even though the eggs may be adopted) or with those displaying egg mimicking pigmentation on their fins (Porter et al. 2002); plainfin midshipman fish (Brantley and Bass 1994) use their pectoral fins to fan their sperm towards a nest guarded by another male; some “bourgeois” bluegill sunfish males provide offspring care yet frequently are cuckolded by sneaker or satellite males (Neff 2001); and some Atlantic salmon spawn either as socially dominant males after returning from the sea or as smaller, socially inferior parr that have remained in freshwater (Thomaz et al. 1997). In general, such alternative mating tactics by male fish fall within one of four strategies: be quicker than rival males in “scramble competition”; cooperate or trade with resource holders for access to mates; exploit the monopolization of resources or mates via reproductive parasitism; or monopolize resources or mates themselves (Taborsky 2001).

The latter tactic seems to be employed by particular grunion males who, during the spawn, curl around a female and place the vent close to the female’s body. Such behavior suggests that these males in effect are trying to ensure their own reproductive success by depositing milt directly on top of the eggs while physically blocking sperm from nearby males from entering the female’s nest that he surrounds. If so, this attempt to monopolize the mate in grunions is likely an evolved behavior in response to sperm competition.

Strong levels of sperm competition have been documented in other externally fertilizing fish species, especially when spawning densities are high (Parker 1990; Petersen and Warner 1998). Given that spawning individuals form dense aggregations and that the high beach is a low-water-volume environment, intense sperm competition seems likely in grunions as well, a prediction that gains additional support from the aforementioned mate-guarding behavior as well as from the high frequency of multiple paternity that we detected in the current study (Fig. 2).

Previous studies have reported high fertilization success rates in grunion (Thompson and Thompson 1919; Walker 1949). Similarly, we found no obvious evidence for sperm limitation in this study: no unfertilized eggs were noted in our collected nests (as determined by observations of embryonic development including a change from many small orange oil globules in each egg to one large clear one; an increase in size of the egg; and the appearance of eyes, tails, and/or circulation of the embryo through the semitransparent membrane) and hatching rates in the lab were high. Such observations support the notion that sperm availability is not typically a serious limitation in grunion reproduction. However, we did not measure fertilization success directly and cannot discount the possibility that sperm is sometimes a limiting factor during the spawning episodes, especially along the outer reaches of the spawning aggregations or during runs of fewer individuals.

Female grunion appear to lack overt behaviors that might influence (positively or negatively) the number of males given access to their eggs. Many males arrive on the beach well after a female has dug her way into the sand and committed her eggs to a nest location; and once vertical in the sand, a female would not seem to be in a position where she could exert great control over the sources of milt that flow to her eggs (unless perhaps some undetected chemical signaling is somehow involved; see Hassler and Brockmann 2001). This raises a possible conundrum: if a female cannot exercise choice amongst her suitors, what if any benefits might she nonetheless receive from multiple paternity? One possibility is that multi-sire clutches are of no direct mean benefit to females, but rather they are a by-product of male–male (sperm) competition (Halliday and Arnold 1987). If so, it could be that during the evolutionary transition to beach spawning, females have forgone active mate choice in return for the aforementioned benefits of terrestrial egg incubation.

Alternatively, perhaps females do gain a direct fitness benefit from multi-sire clutches via increased quality or quantity of offspring. This might happen in any of several ways: if “better” males produce more or better sperm, and such qualities are heritable (Gomendio et al. 1998); if greater genetic diversity in multi-sire clutches (Sugg and Chesser 1994; Chesser and Baker 1996) is adaptive in a variable habitat; if multiple paternity is used as a bet-hedging tactic either because a female is unable to gauge a male’s fitness (Jennions and Petrie 2000), or genetic incompatibilities exist between particular spawning pairs (Tregenza and Wedell 2002), or because multiple males might provide fertilization insurance; or, finally, if a female welcomes fertilizations by multiple males in an attempt to avoid unwanted mates (Alcock et al.1977). This latter possibility might have added significance for grunions because high-beach egg-laying means that precious little time is available to spawn.

Spawning site choice

Although a male undoubtedly is under selection pressure to monopolize mating at a given nest, his choice of nest may be random with respect to his fitness. Previous work has shown that larger, more mature female grunion produce more eggs (up to ~3,000; Thompson and Thompson 1919; Walker 1952). Thus, if all else were equal, a male would fare better by choosing a larger female with whom to spawn (Halliday 1983). However, the lack of any correlation between female size and number of sires per nest (Fig. 3), plus the general setup of spawning in the turbulent beach environment, suggest that the pairing of grunion males with females is probably quite random at a beach site.

In contrast to the California grunion, mate choice in beach-spawning horseshoe crabs does appear to be affected by female size. Brockmann (1996) reported that the number of males in consort with a female increases with female weight and carapace width. In addition, mate choice by horseshoe crabs probably entails chemical cues (Hassler and Brockmann 2001; Schwab and Brockmann 2007). These evolutionary outcomes are likely influenced by the fact that these organisms, unlike the grunions, are able to pair in the water, actively crawl onshore, and are not dependent on tides for their terrestrial mobility. Thus, wave action and water velocity on the beach undoubtedly limit any opportunities for mate choice in grunions far more so than in horseshoe crabs.

The high average number of grunion sires per nest (4.3), a female’s apparent lack of control over which males fertilize her eggs, the lack of correlation between female size and mate number, and the dramatic environmental differences between terrestrial and submerged sites, all indicate that grunion mating behavior probably reflects choice of spawning site far more so than choice of mate. If a female’s oviposition site affects the quality of the abiotic environment in which her eggs mature, including the level of predation on her eggs, then grunion will have been under strong selection pressure for proper habitat choice (Rausher 1983). Such selection for oviposition site has been well documented in insects (Rausher 1983), amphibians (Rieger et al. 2004), and fish (Jones 1981; Warner 1990). Although the choice of general spawning location (i.e., a given stretch of beach) might in principle be based on either genetic instincts or culturally transmitted traditions (Warner 1988) in grunion, the specific micro-site of each nest, and who fertilizes its eggs, probably has a large stochastic component due to the second-by-second idiosyncrasies of tide and wave action as each female and each male surfs ashore during its brief terrestrial sojourn. The observed mating system of the grunion probably registers how males and females have made the best of this peculiar ecological situation.

Notes

Acknowledgments

This work was supported by the National Science Foundation (NSF Grant DGE-0638751) and the University of California, Irvine. Animals were collected with permission from the California Department of Fish and Game granted to R.J.B. with Scientific Collecting Permit ID Number SC-008834. We thank Felipe Barreto and Molly Burke for field assistance, and Felipe Barreto, Vimoksalehi Lukoschek, Andrey Tatarenkov, and two anonymous reviewers for thoughtful comments on the manuscript.

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

References

  1. Alcock J, Eickwort GC, Eickwort KR (1977) The reproductive behavior of Anthidium maculosum (Hymenoptera: Megachilidae) and the evolutionary significance of multiple copulations by females. Behav Ecol Sociobiol 2:385–396. doi:10.1007/BF00299507 CrossRefGoogle Scholar
  2. Avise JC (2004) Molecular markers, natural history, and evolution, 2nd edn. Sinauer Associates, Sunderland, MSGoogle Scholar
  3. Avise JC, Jones AG, Walker D, DeWoody JA et al (2002) Genetic mating systems and reproductive natural histories of fishes: lessons for ecology and evolution. Annu Rev Genet 36:19–45. doi:10.1146/annurev.genet.36.030602.090831 PubMedCrossRefGoogle Scholar
  4. Brantley RK, Bass AH (1994) Alternative male spawning tactics and acoustic signals in the plainfin midshipman fish Porichthys notatus Girard (Teleostei, Batrachoididae). Ethology 96:213–232Google Scholar
  5. Breder CM Jr, Rosen DE (1966) Modes of reproduction in fishes. Natural History Press, Garden City, NYGoogle Scholar
  6. Brockmann HJ (1996) Satellite male groups in horseshoe crabs, Limulus polyphemus. Ethology 102:1–21Google Scholar
  7. Brockmann HJ, Colson T, Potts W (1994) Sperm competition in horseshoe crabs (Limulus polyphemus). Behav Ecol Sociobiol 3:153–160. doi:10.1007/BF00167954 CrossRefGoogle Scholar
  8. Brockmann HJ, Nguyen C, Potts W (2000) Paternity in horseshoe crabs when spawning in multiple-male groups. Anim Behav 60:837–849. doi:10.1006/anbe.2000.1547 PubMedCrossRefGoogle Scholar
  9. Brookfield JFY (1996) A simple new method for estimating null allele frequency from heterozygote deficiency. Mol Ecol 5:453–455. doi:10.1111/j.1365-294X.1996.tb00336.x PubMedCrossRefGoogle Scholar
  10. Chesser RK, Baker RJ (1996) Effective sizes and dynamics of uniparentally and diparentally inherited genes. Genetics 144:1225–1235PubMedGoogle Scholar
  11. Clark FN (1925) The life history of Leuresthes tenuis, an atherine fish with tide controlled spawning habits. Calif Dep Fish Game Fish Bull 10:1–51Google Scholar
  12. Dakin EE, Avise JC (2004) Microsatellite null alleles in parentage analysis. Heredity 93:504–509. doi:10.1038/sj.hdy.6800545 PubMedCrossRefGoogle Scholar
  13. David LR (1939) Embryonic and early larval stages of the grunion, Leuresthes tenuis, and of the sculpin, Scorpaena guttata. Copeia 1939:75–81. doi:10.2307/1435943 CrossRefGoogle Scholar
  14. DeWoody JA, DeWoody YD, Fiumera AC, Avise JC (2000) On the number of reproductives contributing to a half-sib progeny array. Genet Res 75:95–105. doi:10.1017/S0016672399004000 PubMedCrossRefGoogle Scholar
  15. Emery AM, Wilson IJ, Craig S, Boyle PR, Noble LR (2001) Assignment of paternity groups without access to parental genotypes: multiple mating and developmental plasticity in squid. Mol Ecol 10:1265–1278. doi:10.1046/j.1365-294X.2001.01258.x PubMedCrossRefGoogle Scholar
  16. Gomendio M, Harcourt AH, Roldán ERS (1998) Sperm competition in mammals. In: Birkhead TR, Møller AP (eds) Sperm competition and sexual selection. Academic Press, London, pp 667–756CrossRefGoogle Scholar
  17. Gronell AM (1989) Visiting behaviour by females of the sexually dichromatic damselfish, Chrysiptera cyanea (Teleostei: Pomacentridae): a probable method of assessing male quality. Ethology 81:89–122Google Scholar
  18. Gross MR, Sargent RC (1985) The evolution of male and female parental care in fishes. Am Zool 25:807–822Google Scholar
  19. Halliday TR (1983) The study of mate choice. In: Bateson P (ed) Mate choice. Cambridge University Press, Cambridge, pp 3–32Google Scholar
  20. Halliday T, Arnold SJ (1987) Multiple mating by females: a perspective from quantitative genetics. Anim Behav 35:939–941. doi:10.1016/S0003-3472(87)80138-0 CrossRefGoogle Scholar
  21. Hamilton MB, Pincus EL, Di Fiore A, Flescher RC (1999) Universal linker and ligation procedures for construction of genomic DNA libraries enriched for microsatellites. Biotechniques 27:500–507PubMedGoogle Scholar
  22. Hancock JM (1999) Microsatellites and other simple sequences: genomic context and mutational mechanisms. In: Goldstein DB, Schlötterer C (eds) Microsatellites: evolution and applications. Oxford University Press, New York, pp 1–9Google Scholar
  23. Hassler C, Brockmann HJ (2001) Evidence for use of chemical cues by male horseshoe crabs when locating nesting females (Limulus polyphemus). J Chem Ecol 27:2319–2335. doi:10.1023/A:1012291206831 PubMedCrossRefGoogle Scholar
  24. Hauswaldt JS, Glenn TC (2003) Microsatellite DNA loci from the diamondback terrapin (Malaclemys terrapin). Mol Ecol Notes 3:174–176. doi:10.1046/j.1471-8286.2003.00388.x CrossRefGoogle Scholar
  25. Hoelzel AR, Green A (1998) PCR protocols and population analysis by direct DNA sequencing and PCR-based DNA fingerprinting. In: Hoelzel AR (ed) Molecular genetic analysis of populations: a practical approach, 2nd edn. Oxford University Press, New York, pp 201–235Google Scholar
  26. Jamieson A, Taylor SCS (1997) Comparisons of three probability formulae for parentage exclusion. Anim Genet 28:397–400. doi:10.1111/j.1365-2052.1997.00186.x PubMedCrossRefGoogle Scholar
  27. Jennions MD, Petrie M (2000) Why do females mate multiply? A review of the genetic benefits. Biol Rev Camb Philos Soc 75:21–64. doi:10.1017/S0006323199005423 PubMedCrossRefGoogle Scholar
  28. Jones GP (1981) Spawning-site choice by female Pseudolabrus celidotus (Pisces: Labridae) and its influence on the mating system. Behav Ecol Sociobiol 8:129–142. doi:10.1007/BF00300825 CrossRefGoogle Scholar
  29. Leggett WC, Frank KT (1990) The spawning of the capelin. Sci Am 262:102–107CrossRefGoogle Scholar
  30. Levitan DR (1991) Influence of body size and population density on fertilization success and reproductive output in a free-spawning invertebrate. Biol Bull 181:261–268. doi:10.2307/1542097 CrossRefGoogle Scholar
  31. Levitan DR (1998) Sperm limitation, gamete competition, and sexual selection in external fertilizers. In: Birkhead TR, Møller AP (eds) Sperm competition and sexual selection. Academic Press, London, pp 175–217CrossRefGoogle Scholar
  32. Mackiewicz M, Fletcher DE, Wilkins SD, DeWoody JA, Avise JC (2002) A genetic assessment of parentage in a natural population of dollar sunfish (Lepomis marginatus) based on microsatellite markers. Mol Ecol 11:1877–1883. doi:10.1046/j.1365-294X.2002.01577.x PubMedCrossRefGoogle Scholar
  33. Martin KLM, Van Winkle RC, Drais JE, Lakisic H (2004) Beach-spawning fishes, terrestrial eggs, and air breathing. Physiol Biochem Zool 77:750–759. doi:10.1086/421755 PubMedCrossRefGoogle Scholar
  34. Middaugh DP (1981) Reproductive ecology and spawning periodicity of the Atlantic silverside, Menidia menidia (Pisces, Atherinidae). Copeia 1981:766–776. doi:10.2307/1444176 CrossRefGoogle Scholar
  35. Middaugh DP, Kohl HW, Burnett LE (1983) Concurrent measurement of intertidal environmental variables and embryo survival for the California grunion, Leuresthes tenuis, and Atlantic silverside, Menidia menidia (Pisces: Atherinidae). Calif Fish Game 69:89–96Google Scholar
  36. Miller DJ, Lea RN (1972) Guide to the coastal marine fishes of California. Calif Depart Fish Game Fish Bull 157:1–235Google Scholar
  37. Neff BD (2001) Genetic paternity analysis and breeding success in bluegill sunfish (Lepomis macrochirus). J Hered 92:111–119. doi:10.1093/jhered/92.2.111 PubMedCrossRefGoogle Scholar
  38. Parker GA (1970) Sperm competition and its evolutionary consequences in the insects. Biol Rev Camb Philos Soc 45:525–567. doi:10.1111/j.1469-185X.1970.tb01176.x CrossRefGoogle Scholar
  39. Parker GA (1990) Sperm competition games: raffles and roles. Proc R Soc Lond B Biol Sci 242:120–126. doi:10.1098/rspb.1990.0114 CrossRefGoogle Scholar
  40. Pemberton JM, Slate J, Bancroft DR, Barrett JA (1995) Nonamplifying alleles at microsatellite loci: a caution for parentage and population studies. Mol Ecol 4:249–252. doi:10.1111/j.1365-294X.1995.tb00214.x PubMedCrossRefGoogle Scholar
  41. Pennington JT (1985) The ecology of fertilization of echinoid eggs: the consequences of sperm dilution, adult aggregation, and synchronous spawning. Biol Bull 169:417–430. doi:10.2307/1541492 CrossRefGoogle Scholar
  42. Petersen CW, Warner RR (1998) Sperm competition in fishes. In: Birkhead TR, Møller AP (eds) Sperm competition and sexual selection. Academic Press, London, pp 435–463CrossRefGoogle Scholar
  43. Porter BA, Fiumera AC, Avise JC (2002) Egg mimicry and allopaternal care: two mate-attracting tactics by which nesting striped darter (Etheostoma virgatum) males enhance reproductive success. Behav Ecol Sociobiol 51:350–359. doi:10.1007/s00265-002-0456-4 CrossRefGoogle Scholar
  44. Rausher MD (1983) Ecology of host-selection behavior in phytophagous insects. In: Denno RF, McClure MS (eds) Variable plants and herbivores in natural and managed systems. Academic Press, New York, pp 223–257Google Scholar
  45. Raymond M, Rousset F (1995) GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered 86:248–249Google Scholar
  46. Rieger JF, Binckley CA, Resetarits WJ Jr (2004) Larval performance and oviposition site preference along a predation gradient. Ecology 85:2094–2099. doi:10.1890/04-0156 CrossRefGoogle Scholar
  47. Schwab RL, Brockmann HJ (2007) The role of visual and chemical cues in the mating decisions of satellite male horseshoe crabs, Limulus polyphemus. Anim Behav 74:837–846. doi:10.1016/j.anbehav.2007.01.012 CrossRefGoogle Scholar
  48. Seymour RS, Bradford DF (1995) Respiration of amphibian eggs. Physiol Zool 68:1–25Google Scholar
  49. Smyder EA, Martin KLM (2002) Temperature effects on egg survival and hatching during the extended incubation period of California grunion, Leuresthes tenuis. Copeia 2002:313–320. doi:10.1643/0045-8511(2002)002[0313:TEOESA]2.0.CO;2 CrossRefGoogle Scholar
  50. Strathmann RR, Hess HC (1999) Two designs of marine egg masses and their divergent consequences for oxygen supply and desiccation in air. Am Zool 39:253–260Google Scholar
  51. Sugg DW, Chesser RK (1994) Effective population sizes with multiple paternity. Genetics 137:1147–1155PubMedGoogle Scholar
  52. Taborsky M (1994) Sneakers, satellites, and helpers–parasitic and cooperative behavior in fish reproduction. Adv Stud Behav 23:1–100. doi:10.1016/S0065-3454(08)60351-4 CrossRefGoogle Scholar
  53. Taborsky M (2001) The evolution of bourgeois, parasitic, and cooperative reproductive behaviors in fishes. J Hered 92:100–110. doi:10.1093/jhered/92.2.100 PubMedCrossRefGoogle Scholar
  54. Thomaz D, Beall E, Burke T (1997) Alternative reproductive tactics in Atlantic salmon: factors affecting mature parr success. Proc R Soc Lond B Biol Sci 264:219–226. doi:10.1098/rspb.1997.0031 CrossRefGoogle Scholar
  55. Thompson WF, Thompson JB (1919) The spawning of the grunion (Leuresthes tenuis). Calif Depart Fish Game Fish Bull 3:1–29Google Scholar
  56. Tregenza T, Wedell N (2002) Polyandrous females avoid costs of inbreeding. Nature 415:71–73. doi:10.1038/415071a PubMedCrossRefGoogle Scholar
  57. Walker BW (1949) Periodicity of spawning by the Grunion, Louresthes tenuis, an Atherine Fish. PhD thesis, University of California, Los AngelesGoogle Scholar
  58. Walker BW (1952) A guide to the grunion. Calif Fish Game 38:409–420Google Scholar
  59. Warner RR (1988) Traditionality of mating-site preferences in a coral reef fish. Nature 335:719–721. doi:10.1038/335719a0 CrossRefGoogle Scholar
  60. Warner RR (1990) Male versus female influences on mating-site determination in a coral reef fish. Anim Behav 39:540–548. doi:10.1016/S0003-3472(05)80420-8 CrossRefGoogle Scholar
  61. Weber JL, Wong C (1993) Mutation of human short tandem repeats. Hum Mol Genet 2:1123–1128. doi:10.1093/hmg/2.8.1123 PubMedCrossRefGoogle Scholar
  62. Yamahira K (1996) The role of intertidal egg deposition on survival of the puffer, Takifugu niphobles (Jordan et Snyder), embryos. J Exp Mar Biol Ecol 198:291–306. doi:10.1016/0022-0981(96)00002-0 CrossRefGoogle Scholar

Copyright information

© The Author(s) 2009

Authors and Affiliations

  1. 1.Department of Ecology and Evolutionary BiologyUniversity of California, IrvineIrvineUSA

Personalised recommendations