Advertisement

Diabetologia

, Volume 46, Issue 2, pp 291–295 | Cite as

Genetic epidemiology of MODY in the Czech republic: new mutations in the MODY genes HNF-4α, GCK and HNF-1α

  • S. Pruhova
  • J. Ek
  • J. LeblEmail author
  • Z. Sumnik
  • F. Saudek
  • M. Andel
  • O. Pedersen
  • T. Hansen
Article

Abstract

Aims/hypothesis

The aim of this study was to examine the prevalence and nature of mutations in HNF4α/MODY1, GCK/MODY2 and HNF-1α/MODY3 genes in Czech subjects with clinical diagnosis of MODY.

Methods

We studied 61 unrelated index probands of Czech origin (28 males, 33 females) with a clinical diagnosis of MODY and 202 family members. The mean age of probands was 22.7±12.0 years (range, 6–62) and the mean age at the first recognition of hyperglycaemia was 14.7±6.0 years (range, 1–25). The promotor and coding regions inclusive intron exon boundaries of the HNF-4α, GCK and HNF-1α genes were examined by PCR-dHPLC (HNF-1α and GCK) and direct sequencing.

Results

We identified 20 different mutations in the HNF-4α, GCK and HNF-1α in 29 families (48% of all families studied), giving a relative prevalence of 5% of MODY1, 31% of MODY2 and 11.5% of MODY3 among the Czech kindred with MODY. Three of 3, 10 of 11 and 1 of 6 of the mutations identified in HNF-4α, GCK and HNF-1α respectively, were new.

Conclusion/interpretation

Of the families 48% carried mutations in the MODY1–3 genes and of the identified mutations 70% were new. In 52% of Czech families with clinical characteristics of MODY, no mutations were found in the analysed genes. This finding shows that the majority of MODY mutations in a central European population are local and that other MODY genes could be responsible for autosomal dominant transmission of diabetes mellitus.

Keywords

MODY genetics mutation glucokinase HNF-1α HNF-4α MODY X 

Abbreviations

GCK

Glucokinase

HNF-1α

hepatocyte nuclear factor-1alpha

HNF-4α

hepatocyte nuclear factor-4alpha

IPF-1

insulin promoter factor-1

HNF-1β

hepatocyte nuclear factor-1beta

dHPLC

denatured high performance liquid chromatography

RFLP

restriction fragment length polymorphism; OHA, oral hypoglycaemic agents

Maturity Onset Diabetes of the Young is a genetically heterogeneous form of diabetes mellitus, characterised by an autosomal dominant inheritance, by early age at onset and by a primary defect in beta-cell function. Six known MODY subtypes are caused by mutations in genes encoding the hepatocyte nuclear factor-4α (HNF-4α), glucokinase (GCK), hepatocyte nuclear factor-1α (HNF-1α), insulin promoter factor-1 (IPF-1), hepatocyte nuclear factor-1β (HNF-1β) and NeuroD1 respectively [1].

The relative prevalence of distinct MODY subtypes differs substantially in studies in various populations [2, 3, 4], mutations in GCK representing from 8 to 63% and HNF-1α mutations for 13 to 64% of all subjects with MODY [5]. Mutations in the HNF-4α, IPF-1, HNF-1β and NeuroD1 have been recognised in single families only, while additional unknown MODY genes ("MODY X") may cause between 16 and 45% of cases of MODY [3].

We initiated a study of genetic epidemiology of MODY in the Czech republic, as no data on the relative prevalence of the different MODY subtypes and on the spectrum of mutations in MODY genes have been published from central or east European countries with a predominantly Slavonic population.

Subjects and methods

Subjects

A total of 61 unrelated probands between 6 and 62 years of age (median 18; 28 males, 33 females) with a clinical diagnosis of MODY and 202 members of their families participated. Hyperglycaemia in probands was firstly recognised at age 1 to 25 years (median 15), 1 to 43 years (median 3) prior to this study.

The probands were previously diagnosed to suffer from diabetes mellitus or IFG and all had a family history of diabetes mellitus or another form of hyperglycaemia (gestational diabetes mellitus, "impaired glucose tolerance") in at least two consecutive generations. The patients were referred from paediatric endocrinologists from the whole country (38 patients) and from clinics for adults from Prague (23 patients). Informed consent was obtained from all study participants. The protocol was approved by the Ethics Committee of the 3rd Faculty of Medicine, Charles University, Prague, and was in accordance with the Helsinki declaration II.

Clinical studies

All patients underwent a structured assessment including detailed family history. A fasting blood sample was taken for measurements of glucose, C-peptide and glycosylated haemoglobin (HbA1c). Retinopathy was evaluated by an ophthalmologist at the diabetes centre. Nephropathy was diagnosed by testing for microalbuminuria and proteinuria.

Genetic analysis

All exons, the intron-exon boundaries and the promoter regions of the HNF-1α and GCK gene were examined using dHPLC (denatured High Performance Liquid Chromatography) and direct sequencing [6]. The HNF-4α gene and the P1 promoter was analysed by direct sequencing using ABI PRISM Dye Primer Cycle Sequencing Kit with Amplitaq DNA Polymerase FS. The published primers were used [7] except for exon 1c, where we used primers: F 5′GCCAATTTCCAGCAAAAGTC and R 5′CTTGCCGTCTCTCTGAACCT. The PCR amplifications of exon 1c were done by using a previously described PCR protocol [7] using 1.5 mg MgCl2 and an annealing temperature of 60°C.

The prevalence of variants identified as putative mutations was estimated in 45 unrelated healthy Czech Caucasian subjects by PCR-restriction fragment length polymorphism (RFPL) for variants identified in the HNF-4α gene and by dHPLC in the HNF-1α gene and the GCK gene, respectively. The HNF-4α gene variant Arg125Trp (CGG→TGG) was detected using enzyme BsrB1, the variant Arg244Gln (CGG→CAG) using enzyme BsaJ1 and for detection of the variant Val121Ile (GTC→ATC) was used Fok1 (New England Biolabs, Beverly, Mass., USA).

Results

Screening of the HNF-4α gene

Three new mutations and five polymorphisms were identified (Table 1). The Arg125Trp and Val121Ile variants co-segregated with diabetes in five and two family members, respectively. In the case of the Arg244Gln variant, only the patient's DNA was available for investigation. None of the mutations was identified in 45 unrelated healthy Czech Caucasian subjects. Clinical features of the probands are given in Table 2.
Table 1.

Mutations, silent mutations, intronic variants and polymorphisms in the HNF4α, GCK, HNF-1α gene in Czech subjects with MODY

Subject

Location

Codon/nt

Nucleotide change

Designation

Frequency

HNF4α gene

Mutations

cz 205

Exon 4

125

CGG(Arg)→TGG(Trp)

Arg125Trpa

cz 243

Exon 4

121

GTC(Val)→ATC(Ile)

Val121Ilea

cz 162

Exon 7

244

CGG(Arg)→CAG(Gln)

Arg244Glnb

Polymorphisms

Exon 1c

49

ATG(Met)→GTG(Val)

Met49Val

A 0.73, G 0.27

Exon 2

58

GCC(Ala) →GCT(Ala)

A58 C/T

C 0.98, T 0.02

Intron 2

nt-5

C→T

IVS2nt-5 C/T

C 0.79, T 0.21

Exon 4

130

ACT(Thr)→ATT(Ile)

Thr130Ile

C 0.98, T 0.02

Exon 7

273

GAT(Asp)→GAC(Asp)

A 273 T/C

T 0.99, C 0.01

GCK gene

Mutations

cz050, cz054, cz196, cz245

Exon 2

40

GAG(Glu)→AAG(Lys)

Glu40Lysa

cz063, cz180

Exon 2

44

GGC(Gly)→GAC(Asp)

Gly44Aspa

cz086

Exon 4

150

TTC(Phe)→TTA(Leu)

Phe150Leua

cz013, cz066, cz118

Exon 6

220

GAG(Cys)→TAG(Stop)

Cys220Stopa

cz015, cz112

Exon 6

226

GTG(Val)→ATG(Met)

Val226Met

Velho 1997

cz097

Exon 6

251

ATG(Met)→GTG(Val)

Met251Vala

cz098

Exon 7

252

TGC(Cys)→CGC(Arg)

Cys252Arga

cz168

Exon 7

268

GAG(Glu)→TAG(Stop)

Glu268Stopa

cz042

Exon 7

294

GGT(Gly)→GAT(Asp)

Gly294Aspa

cz114

Exon 8

318

GGG(Gly)→AGG(Arg)

Gly318Arga

cz056, cz225

Exon 10

434

TGC(Cys)→TAC(Tyr)

Cys434Tyra

Silent mutation and intronic variants:

Exon 6

215

TAC(Tyr)→TAT(Tyr)

Y 215 C/T

C0.99, T 0,01

Intron 2

nt-8

G→A

IVS

2nt-8 G/A

G0.99, A 0.01

Intron 2

nt+11

G→A

IVS 2nt+11G/A

G0.99, A 0.01

Intron 9

nt-53

del ATTCATTACC

IVS

9nt-53 del

HNF 1α gene

Mutations

cz 023

Exon 3

200

CGG(Arg)→GGG(Gly)

Arg200Glya

cz 092

Exon 3

203

CGT(Arg)→CAT(His)

Arg203His

Awata 1998

cz 060

Exon 3

229

CGA(Arg)→TGA(Stop)

Arg229Stop

Kaisaki 1997

cz 040, cz 028

Exon 4

272

CGC(Arg)→CAC(His)

Arg272His

Kaisaki 1997

cz 230

Exon 4

288

GGG(Gly)→TGC(Cys)

Gly288Cysc

cz 132

Exon 4

291

P291fsinsC

Yamagata 1996

cz 082

Exon 6

379

P379fsdelCT

Yamagata 1996

Polymorphisms

Exon 1

17

CTC(Leu)→CTG(Leu)

L17C/G

C 0.53, G 0.47

Exon 1

27

ATC (Ile)→CTC(Leu)

I/L 27

A 0.64, C 0.36

Exon 1

98

GCC(Ala)→GTC(Val)

Ala98Val

C 0.97, T 0.03

Intron 2

nt-23

C→T

IVS2nt-23C/T

C 0.74, T 0.26

Exon 4

288

GGG(Gly)→GGC(Gly)

G 288G/C

G 0.74, C 0.26

Exon 7

459

CTG(Leu)→TTG(Leu)

L459C/T

C 0.65, T 0.35

Exon 7

487

AGC(Ser)→AAC(Asn)

S/N 487

G0.33, A 0.67

Intron 7

nt+7

G→A

IVS 7nt+7G/A

G0.35, A 0.65

Exon 8

515

ACG(Thr)→ACA(Thr)

Thr515Thr

G0.83, A 0.17

Intron 9

nt-24

T→C

IVS9nt-24 T/C

T 0.65, C 0.35

nt, indicates the nucleotide location relative to the splice donor (+) or acceptor site (−)

anew mutation which co-segregated with diabetes within the family and which was not found in 90 chromosomes from 45 unrelated healthy Czech Caucasian subjects

bnew mutation not tested for co-segregation

cnew mutation without co-segregation with diabetes within the family

Table 2.

Clinical characteristics of subjects with mutations in the HNF-4α, GCK and HNF-1α genes and in MODY X subjects

Subjects with HNF-4α mutations

Subjects with GCK mutations

Subjects with HNF-1α mutations

MODY X

Number

3

19

7

32

Age at diagnosis (years)

15.0±5.3

11.3±4.7

14.8±4.9

16.8±5.6

Age (years)

26.3±9.5

16.2±4.5

25.0±9.1

26.2±14.0

Sex (F/M)

3/0

8/11

4/3

18/14

Duration of DM (years)

17.0±13.1

4.9±3.4

10.7±9.3

9.1±10.6

BMI (kg/m2)

21.7±2.7

19.8±3.2

22.4±2.3

24.6±6.2

Fasting b-glucose(mmol/l)

10.7±4.4

6.9±0.8

6.2±1.1

8.9±3.8

HbA1c

8.8±3.2

6.3±0.8

7.0±1.2

7.5±2.5

Total s-cholesterol(mmol/l)

5.1±1.3

4.2±0.7

4.7±0.9

4.9±1.6

HDL s-cholesterol(mmol/l)

1.3±0.2

1.3±0.4

1.2±0.3

1.2±0.5

Complications:

  NP

1

0

1

7

  ESRF

0

0

1

3

  PDR

2

0

1

3

Current therapy (diet/OHA/insulin)

0/2/1

18/0/0

2/1/4

12/7/14

Data are n or mean±SD (range). The values for fasting glucose and insulin are current values measured with the subjects on diabetes treatment. NP, diabetic neuropathy; ESRF, end-stage renal failure; PDR, proliferative diabetic retinopathy; OHA, oral hypoglycaemic agent

Screening of the GCK gene

We identified 11 different mutations (Table 1) in 19 patients, all within the coding region of the gene. All mutations co-segregated with hyperglycaemia among affected family members with the exception of Val226Met, which was only found in the proband. However, this mutation has already been reported to be associated with MODY [8]. Clinical features of subjects with GCK mutations are summarised in Table 2. Furthermore, we identified a silent mutation in exon 6 and a nine nucleotide deletion in intron 9 which did not co-segregate with diabetes, and two single base intron polymorphisms (Table 1).

Screening of the HNF-1α gene

We identified 10 polymorphisms and 5 previously described mutations located in the coding region of the gene (Table 1). One variant Arg272His was identified in two unrelated probands. In addition, one new missense mutation Arg200Gly was found. All identified variants co-segregated with diabetes (Table 2).

Discussion

We have screened for mutations in the MODY genes HNF-4α, GCK and HNF-1α in Czech Caucasian families with clinically diagnosed MODY diabetes.

We identified three new mutations in the HNF-4α gene: Arg125Trp, Val121Ile and Arg244Gln. All amino acids altered by these missense mutations are conserved across rat, mouse, hamster and frog. The mutation Arg125Trp is located two codons upstream from the known mutation Arg127Trp in the exon 4 [9] and alters a conserved amino acid that is located in the T-box, a region of the receptor implicated in dimerization and DNA binding. The variant co-segregated with diabetes within the family suggesting that the variant Arg125Trp is a new disease-causing mutation. The variant Val121Ile was identified in a 16-year-old lean girl who was diagnosed to be mildly hyperglycaemic at 14 years and in her mother with mild Type 2 diabetes treated with OHA.

Within 19 families, we detected a total number of 11 mutations in the GCK gene. Ten of them are new including eight missense and two nonsense mutations. Some of the new mutations were detected in two or more apparently unrelated families: Glu40Lys (four times), Gly44Asp (twice), Cys434Tyr (twice), Cys220Stop (three times), probably reflecting Czech founder mutations. Also a previously described mutation Val226Met [8] was identified in two families. None of the mutations were found in normal chromosomes. The youngest subject with GCK mutation was an 8-month-old boy with fasting glycaemia ranging between 6.1 to 7.2 mmol/l. No signs of microvascular complications were found in any subject with a GCK mutation.

Seven patients with six different mutations and one patient with an uncharacteristic variant in the HNF-1α gene were found (Table 1). The new Arg200Gly mutation leads to a change in codons that are conserved in the genomes of human, chicken, mouse, rat and hamster and are therefore assumed to be of functional importance. The Arg200Gly is located in the DNA-binding domain and could affect DNA recognition and/or binding. This mutation was observed in one allele of a patient and not found in any of the 45 healthy control subjects. A new Gly288Cys mutation was found in a 14-year-old girl with mild hyperglycaemia. Detailed investigation of the family did not show co-segregation with diabetes.

The clinical features in seven probands with mutations in HNF-1α ranged from mild hyperglycaemia in children and youngsters to severe diabetes mellitus on insulin therapy in most subjects with a disease duration of more than 10 years. Some stage of diabetic complications was detected in 71% of patients. Among them, a 47-year-old man carrying the Arg272His mutation already developed end-stage renal failure and underwent combined renal-pancreas transplantation at the age of 45 years.

After complete screening for the HNF-4α, GCK and HNF-1α genes in 61 families with clinically diagnosed MODY, we identified 20 different mutations and variants in 29 families (48%) and observed a relative prevalence of 5% of MODY1, 31% of MODY2 and 11.5% of MODY3. The high relative prevalence of MODY2 compared to some other studies could reflect not only a specific genetic background but also the mode of recruitment of our study cohort, as 62% of probands were referred by paediatricians. We have not tested for mutations in the genes causing MODY4–6 as these according to previous reports are not likely to be responsible for diabetes in a substantial proportion of affected families [1].

We have identified gene mutations (70% of them new) in 48% of families with clinical characteristics of MODY. These findings show that the majority of MODY mutations in the Czech population are local and support the hypothesis that other genes might be involved in autosomal dominant transmission of diabetes mellitus.

Notes

Acknowledgements

This work was supported by a grant IGA MZd CR NB/6122-3 and a ESPE research fellowship sponsored by Novo Nordisk. The study was supported by grants from the Danish Medical Research Council, the Danish Diabetes Association, the Velux Foundation and a research grant from the European Community (QLRT-CT-1999-00546).

The authors thank these specialists who took care of patients and their families participating in this study: J. Bartošová, P. Bouček, M. Cvejn, L. Dohnalová, R. Hamouzová, L. Jandová, Z. Ježová, V. Karlová, J. Klabochová, J. Kopřiva, J. Malý, L. Osičková, R. Pomahačová, V. Rákosníková, I. Röschlová, P. Sláma, M. Slavíčková, J. Souček, J. Škvor, M. Šnajderová, L. Turková, A. Valentová, J. Venháčová. We also would like to thank to M. L. Jensen, S. K. Hansen, L. Aabo and H. Francová for their dedicated and careful technical assistance and help.

References

  1. 1.
    Fajans SS, Bell GI, Polonsky KS (2001) Molecular mechanisms and clinical pathophysiology of maturity-onset diabetes of the young. N Engl J Med 345:971–980PubMedGoogle Scholar
  2. 2.
    Costa A, Bescós M, Vleho G et al. (2000) Genetic and clinical characterisation of maturity-onset diabetes of the young in Spanish families. Eur J Endocrinol 142:380–386PubMedGoogle Scholar
  3. 3.
    Lindner TH (1999) Molecular genetics of MODY in Germany. Diabetologia 42:121–123PubMedGoogle Scholar
  4. 4.
    Frayling T, Evans J, Bulman M et al. (2001) β-Cell genes and diabetes. Diabetes 50:S94–S100PubMedGoogle Scholar
  5. 5.
    Massa O, Meschi F, Cuesta-Munoz A et al. (2001) High prevalence of glucokinase mutations in Italian children with MODY. Influence on glucose tolerance, first-phase insulin response, insulin sensitivity and BMI. Diabetologia 44:898–905CrossRefPubMedGoogle Scholar
  6. 6.
    Boutin P, Vasseur F, Samson C, Wahl C, Froguel P (2001) Routine mutation screening of HNF-1alpha and GCK genes in MODY diagnosis: how effective are the techniques of DHPLC and direct sequencing used in combination? Diabetologia 44:775–778CrossRefPubMedGoogle Scholar
  7. 7.
    Moller AM, Urhammer S, Dalgaard L et al. (1997) Studies of the genetic variability of the coding region of the hepatocyte nuclear factor-4α in Caucasians with maturity onset NIDDM. Diabetologia 40:980–983CrossRefPubMedGoogle Scholar
  8. 8.
    Velho G, Blanche H, Vaxillaire M et al. (1997) Identification of 14 new glucokinase mutations and description of the clinical profile of 42 MODY-2 families. Diabetologia 40:217–224CrossRefPubMedGoogle Scholar
  9. 9.
    Furuta H, Iwasaki N, Oda N et al. (1997) Organization and partial sequence of the hepatocyte nuclear factor-4α/MODY 1 gene and identification of a missense mutation, R127W, in a Japanese family with MODY. Diabetes 46:1652–1657PubMedGoogle Scholar

Copyright information

© Springer-Verlag 2003

Authors and Affiliations

  • S. Pruhova
    • 1
  • J. Ek
    • 2
  • J. Lebl
    • 1
    Email author
  • Z. Sumnik
    • 3
  • F. Saudek
    • 4
  • M. Andel
    • 5
  • O. Pedersen
    • 2
  • T. Hansen
    • 2
  1. 1.Department of Paediatrics, 3rd Faculty of MedicineCharles UniversityPrague 10Czech Republic
  2. 2.Steno Diabetes Centre and Hagedorn Research InstituteCopenhagenDenmark
  3. 3.2nd Department of Paediatrics, 2nd Faculty of MedicineCharles UniversityPragueCzech Republic
  4. 4.Diabetes CentreInstitute of Clinical and Experimental MedicinePragueCzech Republic
  5. 5.2nd Department of Internal Medicine, 3rd Faculty of MedicineCharles UniversityPrague Czech Republic

Personalised recommendations