Advertisement

Theoretical and Applied Genetics

, Volume 133, Issue 1, pp 365–365 | Cite as

Correction to: Genetic characterization and expression analysis of wheat (Triticum aestivum) line 07OR1074 exhibiting very low polyphenol oxidase (PPO) activity

  • S. M. Hystad
  • J. M. Martin
  • R. A. Graybosch
  • M. J. GirouxEmail author
Correction
  • 189 Downloads

Correction to: Theor Appl Genet (2015) 128:1605–1615  https://doi.org/10.1007/s00122-015-2535-8

The above-mentioned article was published in 2015 with an error in the reverse primer sequence for the PPOA2d1074 marker, which made amplification difficult. The reverse primer was missing a thymine nucleotide at the thirteenth position (GCGGTGCTTCACTTGGT). The corrected marker can be found in the following table. Additionally, a new primer set that provides a shorter, more abundant PCR product was designed and validated. The new marker is designated PPOA2d1074_2.

Marker

Gene

Forward (5′–3′)

Reverse (5′–3′)

Amplicon size (bp)

PPOA2d1074

Ppo-A2d

CATCATGTACCGCCAGATGG

GCGGTGCTTCACTTGGT

878

PPOA2d1074_2

Ppo-A2d

ACTTCACCGACACTGAC

TCACTTGGTATAGCCGATGC

595

Notes

Copyright information

© Springer-Verlag GmbH Germany, part of Springer Nature 2019

Authors and Affiliations

  1. 1.Department of Plant Sciences and Plant PathologyMontana State UniversityBozemanUSA
  2. 2.USDA-ARS University of NebraskaLincolnUSA

Personalised recommendations