Advertisement

Theoretical and Applied Genetics

, Volume 119, Issue 5, pp 939–951 | Cite as

Development and assessment of simple PCR markers for SNP genotyping in barley

  • Matthew J. HaydenEmail author
  • T. Tabone
  • D. E. Mather
Original Paper

Abstract

Simple molecular marker assays underpin routine plant breeding and research activities in many laboratories worldwide. With the rapid growth of single nucleotide polymorphism (SNP) resources for many important crop plants, the availability of routine, low-tech marker assays for genotyping SNPs is of increased importance. In this study, we demonstrate that temperature-switch PCR (TSP) supports the rapid development of robust, allele-specific PCR markers for codominant SNP genotyping on agarose gel. A total of 87 TSP markers for assessing gene diversity in barley were developed and used to investigate the efficacy for marker development, assay reliably and genotyping accuracy. The TSP markers described provide good coverage of the barley genome, are simple to use, easy to interpret and score, and are amenable to assay automation. They provide a resource of informative SNP markers for assessing genetic relationships among individuals, populations and gene pools of cultivated barley (Hordeum vulgare L.) and its wild relative H. spontaneum K. Koch. TSP markers provide opportunities to use available SNP resources for marker-assisted breeding and plant genetic research, and to generate information that can be integrated with SNP data from different sources and studies. TSP markers are expected to provide similar advantages for any animal or plant species.

Keywords

Single Nucleotide Polymorphism Single Nucleotide Polymorphism Marker Cleave Amplify Polymorphic Sequence Single Nucleotide Polymorphism Genotyping Single Nucleotide Polymorphism Locus 
These keywords were added by machine and not by the authors. This process is experimental and the keywords may be updated as the learning algorithm improves.

Introduction

Single nucleotide polymorphisms (SNPs) are the smallest unit of genetic variation and represent the most common type of sequence polymorphism in plant and animal genomes. SNPs are usually discovered in silico from preexisting datasets of genomic sequences or expressed sequence tags (Kota et al. 2003; Rostoks et al. 2005), and through sequencing or re-sequencing of candidate genes or anonymous PCR products (van Orsouw et al. 2007; Ponting et al. 2007). When compared with other types of markers, such as RFLPs, RAPDs, AFLPs and SSRs, SNPs offer higher levels of genotyping throughput owing to their amenability to simpler and quicker processes that collectively facilitate automation (Rafalski 2002). SNP markers are biallelic (in diploids), provide exact allele information that can be described in a binary alphanumeric manner according to the nucleotide present, and enable the direct comparison of data collected across time and in different laboratories, and using different assay chemistries and platforms.

Rapid advances in DNA sequencing and genotyping technologies make SNP markers an ideal tool for applications in plant genetics and breeding. As a consequence, large-scale identification and mapping of SNPs has been initiated in many crop plant species including, barley, grape, soybean, sugar beet and forest trees (Hayes and Szucs 2006; Lijavezky et al. 2007; Choi et al. 2007; Schneider et al. 2007; Pavy et al. 2008). The generation of dense genetic linkage maps based on the SNP markers will provide a genomic resource to further support applications, such as the assessment of genetic relationships between individuals and populations, understanding of genome architecture, mapping of key traits and marker-assisted breeding.

Numerous methods have been developed to genotype SNPs, ranging from single marker assays to specialized systems that enable thousands of SNPs to be scored in parallel (see Kwok 2001; Gupta et al. 2008 for reviews). These methods are based on a range of assay chemistries, have different requirements for specialized equipment and reagents, and vary in suitability for use in different types of studies. Two widely used methods, cleaved amplified polymorphic sequences (CAPS) and allele-specific PCR, allow for simple SNP genotyping by analysis of size polymorphisms of PCR products separated on agarose gel (Konieczny and Ausubel 1993; Bundock et al. 2005). However, because CAPS technology relies upon the cleavage of PCR products at restriction sites, it can be costly (depending on the restriction enzyme used) and unreliable (due to partial digestion of PCR products) and it is not applicable to all SNPs. Allele-specific PCR methods can lack robustness and typically require two assays per sample for codominant SNP scoring.

Temperature-switch PCR (TSP) is a newly reported method for developing allele-specific PCR markers for rapid, codominant SNP genotyping (Tabone et al. 2009). TSP marker assays are performed under standardized reaction conditions and the genotyping products can be detected by gel electrophoresis or high-resolution melt analysis, making them easy to deploy. Application of this technology for SNP genotyping in plant genomes has the potential to provide simple PCR markers that can be deployed in laboratories with widely differing technical capabilities and used to generate data that can be integrated into, and interpreted in, global contexts. TSP could allow the growing resource of SNP information for crop species to be used by any laboratory for marker-assisted breeding, and to assess genetic relationships among individuals, populations and gene pools for the efficient management and utilization of genetic diversity and germplasm resources.

The aim of this study was to investigate the efficacy of TSP for developing robust markers to genotype SNPs in barley. To achieve this objective, we used published SNPs to develop 87 TSP markers providing good genome coverage, as a first step towards producing an informative set of gene-based markers for distinguishing genotypes of cultivated barley (Hordeum vulgare L.) and its wild relative H. spontaneum K.Koch.

Materials and methods

Plant materials

Barley lines used for SNP genotyping were based on a collection of released varieties, breeding materials, mapping populations, and wild relatives of cultivated barley. Forty-eight cultivated varieties and advanced breeding lines of barley obtained from the University of Adelaide barley breeding program, and 40 accessions of H. spontaneum, obtained from the Australian Winter Cereal Collection, Tamworth NSW, Australia, were used to assess TSP markers for amplification and SNP diversity. The H. spontaneum accessions were collected in diverse geographical regions of the world including Afghanistan, China, the former Soviet Union, Iran, Israel, Nepal and Tajikistan. A subset of 48 highly informative doubled haploid lines, identified using the software MapPop (Howad et al. 2005), from a cross between varieties Chebec and Harrington (Karakousis et al. 2003) was used for genetic mapping. Ninety-six F3 progeny derived from a cross between two doubled haploid lines from the Chebec × Harrington population (unpublished data) and tissue samples from 48 F1 plants, obtained from the University of Adelaide barley breeding program, were used to confirm the ability of TSP markers to detect heterozygous SNP loci. DNA for each barley line was isolated from a single plant as described by Rogowsky et al. (1991).

Primer design and marker nomenclature

Temperature-switch PCR markers were designed to amplify SNPs that Rostoks et al. (2005) had identified from the re-sequencing of EST unigenes in eight barley lines. The sequence and SNP information used is available at http://bioinf.scri.ac.uk/. Each TSP marker comprised a set of three primers: a pair of locus-specific primers flanking the SNP and designed to amplify the unigene sequence, and an allele-specific primer designed to assay the SNP harbored within that sequence (Fig. 1). Primers were designed using Primer3 (Rozen and Skaletsky 2000) and NetPrimer (Premier Biosoft International) software according to Tabone et al. (2009) and are provided in Table 1. Briefly, the locus-specific primers reported by Rostoks et al. (2005) were redesigned to increase the primer melting temperature at 60–65°C and to amplify a PCR fragment greater than 400 bp in length. The locus-specific primers were positioned such that the forward primer, designed to the same template DNA strand as the allele-specific primer, was located at least 100 nucleotides from the SNP. The allele-specific primer was designed with a melting temperature of 43–48°C and to have a 3′ nucleotide complementary to one of the SNP alleles present at the locus. A short (2 or 3 bp) arbitrary nucleotide sequence, non-complementary to the target DNA, was added to the 5′ end of the allele-specific primer. This 5′-tail sequence was designed to increase the melting temperature of the allele-specific primer to about 53°C once the non-complementary sequence was incorporated into PCR product.
Fig. 1

Diagram illustrating the position and orientation of PCR primers for three primer, allele-specific TSP markers relative to matching template DNA

Table 1

Marker name, chromosome, map position, SNP alleles and primer sequences for 87 SNPs

SNP name

Chromosomea

Pos. (cM)a

SNP allelesa

Locus-specific primers

ASPE Primerb,c

SNP allele assayed

scsnp21640_136[T/C]top

1H

0.00

T/C

Fwd

Rvs

CCCACTGACCCCTACGAACG

CCGCTTCGTCTTGGCAAACT

GCTGATTACCGTTGCTATTC

C

scsnp21640_328[T/C]top

1H

0.00

T/C

Fwd

Rvs

CCCACTGACCCCTACGAACG

CCGCTTCGTCTTGGCAAACT

CCGCATTGGGTGGTCTACT

T

scsnp07301_416[G/A]top

1H

47.22

G/A

Fwd

Rvs

AACGGAAACTCCAATGGCGA

AGCCACAGCCATAGGGCAAA

CGCGTCTTTCGAAGACTCG

G

scsnp13561_727[G/A]bot

1H

61.82

G/A

Fwd

Rvs

CCCTGAGCAAGGGGACACAT

TGCCAACAAGCTCCACCGTA

GGCCAAACTTGCTTCGTC

G

scsnp03346_170[C/G]top

1H

68.95

C/G

Fwd

Rvs

CTTCTTAGCCCGGGGCAACT

TGCAACTTGCGAAACGAACC

GGCTTAGCTCATGCACTCTG

G

scsnp04853_317[C/T]top

1H

99.36

C/T

Fwd

Rvs

CCCGTGGGTGTTGAAGGTCT

GCAATTGCAGATGCTGCTGG

CCGATGTAATGTACTCCCTCC

C

scsnp04853_522[A/G]top

1H

99.36

A/G

Fwd

Rvs

CCCGTGGGTGTTGAAGGTCT

GCAATTGCAGATGCTGCTGG

CGTGAATTGATTGATTTTGG

G

scsnp06274_166[C/T]bot

1H

105.91

C/T

Fwd

Rvs

TCGAAACAAAACTGCGTGGC

TGGCTCACAGTGCCATCCAT

CCAAATGGGAACATAGGG

C

scsnp06274_318[A/T]top

1H

105.91

A/T

Fwd

Rvs

TGGCTCACAGTGCCATCCAT

TCGAAACAAAACTGCGTGGC

CGATAATGCGAACAAAACA

A

scsnp01812_678[T/C]bot

1H

140.07

T/C

Fwd

Rvs

TTGATAAGACAAGACTC

TCCTGTGCGGGAACAAGGTT

GCATTGATAAGACAAGACTCG

C

scsnp07434_260[G/A]bot

1H

150.40

G/A

Fwd

Rvs

TGGAATGGCTTGAACCAGCA

GGTTGTCCGAGAATGGTGCC

CCGGAACAAATGTCTCTTGC

G

scsnp17647_248[T/C]top

1H

170.12

T/C

Fwd

Rvs

CTGTTCTGGGCCTTCTGCGT

AGAATCGAGCCAGCGATTGG

CGGAAACTTGTAAATGTGGAT

T

scsnp02622_674[T/C]bot

2H

3.03

T/C

Fwd

Rvs

TGGACGGCTCAATGGAACAA

GCGATACGACGCCGAGAAAG

GCATCTCGAAACAAGAACG

C

scsnp02329_170[A/G]top

2H

13.43

A/G

Fwd

Rvs

GGGGAAAACGTGAAGAGCCC

CATGGCCACGAAGCTCAATG

GCCGTCATCCTGTTGTACTTA

A

scsnp01327_275[C/T]bot

2H

41.73

C/T

Fwd

Rvs

TCGTGCGATCCGTTTTAGCA

GAAGTCGACGCTGATGGCAA

GGGTCTTCGGAGCACGA

T

scsnp05033_332[G/A]bot

2H

52.56

G/A

Fwd

Rvs

CAAGCGCCGTATGGTGTGTC

TCGAGGGTCAGATGCTGTCG

GCCTCCAGGTTGCCCAC

G

scsnp01644_323[A/G]top

2H

58.12

A/G

Fwd

Rvs

CGAGGATTGGCTCAAGACGC

GCAGCGTTCTTAGGACTGGCA

GGCCAGAGTAAGTTGCTGAA

A

scsnp01644_557[T/C]bot

2H

58.12

T/C

Fwd

Rvs

GCAGCGTTCTTAGGACTGGCA

CGAGGATTGGCTCAAGACGC

CGAATGGATTCTTCAGAAAAG

C

scsnp02403_54[T/C]top

2H

58.37

T/C

Fwd

Rvs

GGGAGGAACAGTGCCTGCAA

CCAGTCCTGGCACAACCACA

GCCTTAGTACTGTTGCTATTGAT

T

scsnp15266_311[C/T]bot

2H

65.42

C/T

Fwd

Rvs

GAGCTCTGCTACCGGCCTCA

ACGTGAAGTGCGCAAAGCAG

CCCGTCACTCAAGTGACACA

T

scsnp15266_493[G/A]top

2H

65.42

G/A

Fwd

Rvs

ACGTGAAGTGCGCAAAGCAG

GAGCTCTGCTACCGGCCTCA

GCATACATCCGTATCTAGACAA

A

scsnp03181_210[C/T]top

2H

69.61

C/T

Fwd

Rvs

GCCCATTCGTTTGATCAGGG

CCTTTTCTTGGCGGTGATGC

GCGCAAAATTTTAGTGTAACT

T

scsnp04861_524[T/C]top

2H

83.89

T/C

Fwd

Rvs

GCAAGGGTGGAAAGCGAGAA

CCGAACACCTGTCCTGGGAG

GCGCTCAACTGAAGAAGATT

T

scsnp04861_655[T/G]top

2H

83.89

T/G

Fwd

Rvs

GCAAGGGTGGAAAGCGAGAA

CCGAACACCTGTCCTGGGAG

CGCTGGCACTCTCTTCATAT

T

scsnp06130_208[C/T]bot

2H

93.81

C/T

Fwd

Rvs

TTGGCCGGGAACTTATGGTG

GACGTCCCTCGCGTAAATGG

CGCCAAACATCTTTTACAAG

C

scsnp14531_165[G/A]top

2H

96.98

G/A

Fwd

Rvs

TGGGCTCTCAGATTCCACGG

TTCCATGCAAATGCCTGCTG

GCCAACTACTAAGTTAGTAATGCTA

A

scsnp06766_249[G/A]top

2H

143.10

G/A

Fwd

Rvs

AGCTCCCATCGAGCTTGTGC

GTTCAGCGACAGCCAACGAA

GCTCGTCGAGAAGTTCCA

A

scsnp05814_321[A/G]top

2H

152.46

A/G

Fwd

Rvs

AGGCACTGCTGTCATGCTGG

TTTTCAATCGGGCGTCTTCC

CCCTGCATCTACAGTACCTTA

A

scsnp05814_98[G/A]top

2H

152.46

G/A

Fwd

Rvs

AGGCACTGCTGTCATGCTGG

TTTTCAATCGGGCGTCTTCC

GCCGGCATAAACTTTGTACTA

A

scsnp01404_680[T/C]bot

3H

6.87

C/T

Fwd

Rvs

CTTCTGGGTGCACAACACGG

AAGCCGCCTCTGTCAAGTGC

ACGGCTTCGCTCATCAG

C

scsnp00495_502[G/T]bot

3H

48.73

G/T

Fwd

Rvs

ATGGCAAATTCACATCGGGC

GGCTCTGCTCTCGCTCAAGG

CGATGCAGAACTGTGGC

G

scsnp04006_344[T/C]top

3H

55.06

T/C

Fwd

Rvs

CAGCCGTGACACCATCCTTC

CAATGAACAGCCCCCACCTC

GCTGGAAGAAAACATAACCAC

C

scsnp03835_396[A/G]top

3H

56.02

A/G

Fwd

Rvs

GGGCGGTATCAGAGGTGCAG

GCATGCACGCAGCAAGACTC

GCGTCATACAACACCCGG

G

scsnp03835_399[A/G]bot

3H

56.02

A/G

Fwd

Rvs

GCATGCACGCAGCAAGACTC

GGGCGGTATCAGAGGTGCAG

CCGGGTCACTACTTCCAATC

G

scsnp05580_438[T/A]top

3H

77.65

T/A

Fwd

Rvs

GCCCCGGTGAAGGGAGTAAG

CCGCGATTCTCGTCCCTCT

CGAAGACTTATATTTAGGAACGA

A

scsnp03814_188[A/G]top

3H

94.64

A/G

Fwd

Rvs

GTGATGGGACTCGCTTCGGT

GCTCTTTGCGTACCCATGCC

GGAGATAGCGACACAGTAACAA

A

scsnp03814_307[A/G]top

3H

94.64

A/G

Fwd

Rvs

GTGATGGGACTCGCTTCGGT

GCTCTTTGCGTACCCATGCC

GCCAACCACAGGAGAAGG

G

scsnp14307_683[T/C]top

3H

106.40

T/C

Fwd

Rvs

TGGAGCAGCTGTTCTCGGTG

CCAAGAGGCCAAAACTGTGGA

CCCTGAGCGTTTGATGAAT

T

scsnp19616_322[G/A]top

3H

111.05

G/A

Fwd

Rvs

AGGCCATCGTCGACACCTTC

ATGCGGTGATCCTCCAGCTC

GCGGTGCGTCTCCCAG

G

scsnp19616_617[C/T]bot

3H

111.05

C/T

Fwd

Rvs

ATGCGGTGATCCTCCAGCTC

AGGCCATCGTCGACACCTTC

GCGACTGTGATATTGCCTG

C

scsnp06381_514[G/A]top

3H

117.99

G/A

Fwd

Rvs

CGGAGATCCTTTCAACCCGA

TCGGATGTCCGTCCAGATCA

GGCATTTTGTAACATGTTCAG

G

scsnp06381_726[T/G]top

3H

117.99

T/G

Fwd

Rvs

CGGAGATCCTTTCAACCCGA

TCGGATGTCCGTCCAGATCA

CCTGGTCGTTAATTAGAGCTT

T

scsnp05754_646[G/A]top

3H

122.55

G/A

Fwd

Rvs

CGCATACCACACCCGGTACA

GGCCCAACCAGGAAATCTCA

CGACTTACAGTTAAGGAGCTCA

A

scsnp05754_714[T/C]bot

3H

122.55

T/C

Fwd

Rvs

GGCCCAACCAGGAAATCTCA

CGCATACCACACCCGGTACA

CGATGATCCGCCCTGA

T

scsnp06172_369[G/A]bot

4H

26.69

G/A

Fwd

Rvs

GAATCTACCACCGCTCCAGCA

GGGACATGCATGGTGGCATA

GCGGATTGTTGCCCTAC

G

scsnp05351_422[G/A]bot

4H

33.32

G/A

Fwd

Rvs

GCAACTAAACACCCCTGCCG

CGGCCCTCAGACCAGACCTA

CGAATAGTCTTCAGTGAAGCC

G

scsnp07112_598[T/C]bot

4H

35.81

T/C

Fwd

Rvs

TTGGAATAGAAGCGGGCACC

ACCAGGACTTCGGCATGGAC

TCTCAACGCCAGTGAGGA

T

scsnp03465_115[T/C]top

4H

53.15

T/C

Fwd

Rvs

GCGTCGCAAAGACAAGCTGA

CCGCAGGCGAACCTTTACAT

CGGATATGTTTGGGTATCATT

T

scsnp03465_158[T/A]bot

4H

53.15

T/A

Fwd

Rvs

CCGCAGGCGAACCTTTACAT

GCGTCGCAAAGACAAGCTGA

CGTGCATACTGCACAAATT

A

Bmy1_A430V_3281[T/C]top

4H

129.97

T/C

Fwd

Rvs

CCTGAGCACAAGCTGTTTGGA

CAGGTTGGCATGCATTCTGTC

GCGAGGGACAAAACTATGT

T

Bmy1_E165D_1137[G/C]bot

4H

129.97

G/C

Fwd

Rvs

TGTATGCCGATTACATGACAAGC

CGTGGCTCTGAGGATATGATGG

CGAGGGAGAACATGAAAGAC

G

Bmy1_S347L_2856[T/C]top

4H

129.97

T/C

Fwd

Rvs

TGATAGAGACGGCTACAGAACCA

CTAGTTCTTCTGGTGCGCTCAT

GCCGGAGATGAGGGATTC

C

scsnp00388_768[G/A]bot

5H

1.73

G/A

Fwd

Rvs

GCCAAACTGCATCACCAACG

CCGATACACTCTGAGCGGCA

CGACGGACGATTACAGTAGC

G

scsnp01741_596[C/T]top

5H

26.00

C/T

Fwd

Rvs

TGAGGCTGGCACAACTGGTC

GCTGCAAAAGCAAGCAAGCA

GCAAAGTATGGATGGCTCTC

C

scsnp07010_126[A/C]top

5H

56.18

A/C

Fwd

Rvs

GACTCTGTCGGGCAGCATGA

CCCATAAATTGCGAGCGTGG

CGCAGTCAAACTCTACTTTCTAC

C

scsnp07010_217[G/A]top

5H

56.18

G/A

Fwd

Rvs

GACTCTGTCGGGCAGCATGA

CCCATAAATTGCGAGCGTGG

CCAACACAAGATAATCAGTCG

G

scsnp05926_188[C/G]top

5H

57.21

C/G

Fwd

Rvs

CCAACACTTGGTGTGAGGCG

GCTAACCATCAGCCCCATGC

CCGAAGATGTCGCAAAGG

G

scsnp05926_55[T/C]top

5H

57.21

T/C

Fwd

Rvs

CCAACACTTGGTGTGAGGCG

GCTAACCATCAGCCCCATGC

CGGACAAATCTAAATGCCTTC

C

scsnp02265_354[A/G]bot

5H

59.87

A/G

Fwd

Rvs

GCTGGTCCTAGCCGTTCCCT

TGTCAAGAACAACCCGGCAG

GGCCTGGTGACCTAGAGAAC

G

scsnp03594_515[T/C]top

5H

87.13

T/C

Fwd

Rvs

TGGGGCTGTTTGAGACGGAT

AGAGGAAGTTCGGCGTGTCG

GGGGTTATAGATGCTCTTATGTT

T

scsnp02739_543[T/C]bot

5H

100.59

T/C

Fwd

Rvs

CCGGGCTTATTCATGCATCC

TTGGGTCATCAACACCGTGG

GGCATGGAGGAAGCCG

C

scsnp02739_586[G/A]bot

5H

100.59

G/A

Fwd

Rvs

CCGGGCTTATTCATGCATCC

TTGGGTCATCAACACCGTGG

CGGAGAATAGGCCTTGCC

G

scsnp00177_689[T/C]bot

5H

124.38

T/C

Fwd

Rvs

GCACTCCCAGGAAGAACGGA

GGCTATGTCATCCGCAACCC

GCGTTTTCAGTTGGTTGATG

C

scsnp00314_166[T/C]top

5H

149.73

T/C

Fwd

Rvs

TTGGCAAGTGCTGTGGCAAT

TATCGCAGGCGGGTGTTTTT

CGAAGCGAACACGATCAC

C

scsnp03683_406[A/C]top

5H

199.15

A/C

Fwd

Rvs

CAACGGCGCCACCTTCTACT

CACATACCCCACTGCCATGC

ACGACTTGGCCGTGGA

A

scsnp07305_298[T/A]bot

6H

1.70

T/A

Fwd

Rvs

TCCGACCATCGACCTGAACA

TCAACGTTGCAAGGAAGCCA

CGAGAGGATCTTTTCCGAT

A

scsnp07351_407[A/C]bot

6H

10.45

A/C

Fwd

Rvs

CCCAGCTAGCAGCAAGGGAA

TACTCCCCCGGCGGACTTAT

GGCATAGCTGGAACAGCG

C

scsnp06204_159[C/T]bot

6H

35.61

C/T

Fwd

Rvs

ATCATGACCCGATGCGGTG

TCAAAGTGGGCAGGCATCAA

GCGAGCTCTTGCATTCTCCG

C

scsnp06204_63[A/G]top

6H

35.61

A/G

Fwd

Rvs

TCAAAGTGGGCAGGCATCAA

ATCATGACCCGATGCGGTG

CGTGGCAAAAGACCAACA

A

scsnp02895_268[A/G]bot

6H

63.80

A/G

Fwd

Rvs

GGAATCGCAAGCACTACGGG

TGATCGGTCCAGTTCACCCA

CGGATGGAGAAAGAAAGTCC

G

scsnp02895_423[T/C]bot

6H

63.80

T/C

Fwd

Rvs

TGATCGGTCCAGTTCACCCA

GGAATCGCAAGCACTACGGG

CCAGAGCTTGACATCCTCG

C

scsnp03149_168[C/A]top

6H

133.30

C/A

Fwd

Rvs

CCGAAGAGGAAGCCATCGAA

TGTCCACAAAACCCATGCCA

GCTGATTTCCGGTGACC

C

scsnp03149_617[G/A]top

6H

133.30

G/A

Fwd

Rvs

CCGAAGAGGAAGCCATCGAA

TGTCCACAAAACCCATGCCA

GCGCTCCGGCTAACTAG

G

scsnp04273_107[G/A]bot

6H

137.79

G/A

Fwd

Rvs

ACCACACAAGCTGCCCAACA

ACGTGCCCATCGTTCCAAAT

CGGTATAAGGATGAAATAGAGAGAT

A

scsnp04220_436[C/T]bot

6H

143.14

C/T

Fwd

Rvs

CAGCTTTCCTCACCGCGTCT

TACAAGCCGCTAGCCCCGTA

GCGCCTATTATGTCTGACAAG

C

scsnp04220_508[G/T]bot

6H

143.14

G/T

Fwd

Rvs

CAGCTTTCCTCACCGCGTCT

TACAAGCCGCTAGCCCCGTA

GCAGCCCTCTGATGAAGC

G

scsnp04135_235[T/C]top

6H

149.78

T/C

Fwd

Rvs

GCTGAGCAACCTTGGTGCAA

TCATCTTGCATGTCGGCACA

GCCAAAAGTTCACAGTCAAAT

T

scsnp04135_67[C/G]top

6H

149.78

C/G

Fwd

Rvs

GCTGAGCAACCTTGGTGCAA

TCATCTTGCATGTCGGCACA

GCACCACCGATCTTAGTTC

C

scsnp02493_292[G/C]bot

7H

13.02

G/C

Fwd

Rvs

TCATCTCGCCAAGAACCCAA

CCCTCAGGGTGTTGGTGGAC

CGGGATCAATCAATGTGATC

G

scsnp02493_317[C/T]bot

7H

13.02

C/T

Fwd

Rvs

TCATCTCGCCAAGAACCCAA

CCCTCAGGGTGTTGGTGGAC

GGCATCCATGAGGGAGG

C

scsnp00823_425[G/A]top

7H

20.31

G/A

Fwd

Rvs

GCCTTTGTGCAGCCTGCTTT

CCCTCAACAGCCAATGGGAC

CCGTCTTCCTACCTTTGCA

A

scsnp00694_225[T/A]top

7H

34.70

T/A

Fwd

Rvs

CTCCAGGGAATGCGCTATGG

AAAGAGGCAAGCGGCACAAC

GCCGATCCTCTTGTGTAAAA

A

scsnp00694_248[T/C]top

7H

34.70

T/C

Fwd

Rvs

CTCCAGGGAATGCGCTATGG

AAAGAGGCAAGCGGCACAAC

GCCATCTTGTTCATCCTGGT

T

scsnp06931_64[A/G]top

7H

40.74

A/G

Fwd

Rvs

GCCCCTCTACAGCCTCGTCA

AGATCCAGTGCCCTTGCAGC

CGGCTAGCTACAACGCTG

G

scsnp00610_670[A/G]bot

7H

98.30

A/G

Fwd

Rvs

ACCAGGCTGTTGGGGATTCA

AGGCCTTCACTGTCCGCAAC

CCGTTTGATATACTTACGTATGTATAC

G

scsnp00610_69[C/T]top

7H

98.30

C/T

Fwd

Rvs

AGGCCTTCACTGTCCGCAAC

ACCAGGCTGTTGGGGATTCA

GCTTGGATCGGCCATT

T

scsnp05362_340[C/G]bot

7H

142.55

C/G

Fwd

Rvs

TACACGCCGGCCTTCATCTT

AAAAGGGGGCAAATCAAGCG

GGCACAGCTCCGAACG

C

aAs reported by Rostoks et al. (2005)

bA SNP allele complementary to the allele-specific primer produces the ‘reference SNP allele’ (smallest) PCR product, whereas those without complementarity produce the ‘alternate SNP allele’ (largest) product. Heterozygous samples produce both TSP genotyping products

cThe arbitrary 5′-nucleotide sequence indicated in underlined, bold font is non-complementary to the target DNA

Temperature-switch PCR markers were named using the nomenclature of Rostoks et al. (2005) and consisted of the prefix ‘scsnp’, followed by the contig number from the Affymetrix Barley Gene Chip assembly (HarvEST assembly #21, http://www.harvest-web.org). Additional information linked to each TSP marker name indicates the position (bp) of the SNP in the resequencing data, nucleotide variants at the SNP, and the designation ‘top’ (top) or ‘bottom’ (bot) to indicate the DNA strand in relation to the resequencing data for which the allele-specific primer was designed. For example, scsnp00388_768[G/A]bot indicates an allele-specific primer was designed to the bottom DNA strand of contig ABC00388 for an SNP located at nucleotide position 768 in the resequencing data, with a guanosine to adenosine transition.

In addition, three TSP markers were developed for nucleotide sequence variation in the endosperm-specific β-amylase gene (Bmy1) located on the long arm of chromosome 4H. The SNPs corresponded to reported substitutions in the deduced protein sequence at amino acid positions 165, 347 and 430 (Kaneko et al. 1998), which are located at nucleotide positions 1,137, 2,856 and 3,281 in the genomic DNA sequence of cv. Haruna Nijo (GenBank D49999), respectively. Primer sequences for the TSP markers are provided in Table 1.

TSP assay

Temperature-switch PCR assays were performed in a 4 μl reaction mixture containing 0.2 mM dNTP, 1× ImmoBuffer (Bioline) (16 mM (NH4)2SO2, 0.01% Tween-20, 100 mM Tris–HCl, pH 8.3), 1.5 mM MgCl2, 100 ng/μl bovine serum albumin Fraction V (Sigma Aldrich), 0.1 μM each locus-specific primer, 0.5 μM allele-specific primer, 0.15 U Immolase DNA polymerase (Bioline), and about 20 ng dried-down genomic DNA. To dry-down the genomic template, 2 μl of diluted DNA was added to the PCR well and completely desiccated by heating at 80°C for 10 min. Following an initial denaturation step of 10 min at 95°C to heat activate the DNA polymerase, PCR was performed for a total of 35 cycles with the profile: 30 s at 94°C, 30 s at 58°C, 60 s at 72°C for 15 cycles. The next five cycles were with 10 s at 94°C, 30 s at 45°C, followed by 15 cycles with 30 s at 94°C, 30 s at 53°C, 5 s at 72°C. The PCR products were mixed with an equal volume of gel loading buffer (40% sucrose, 10 mM EDTA and 0.5% bromophenol blue as tracking dye) and the entire reaction mixture was separated by electrophoresis on a 2% agarose gel. TSP genotyping products were visualized using ethidium bromide staining.

Marker scoring

Temperature-switch PCR markers amplify two genotyping products that differ by at least 100 bp in size (Fig. 1). The genotyping products amplified from homozygous DNA samples correspond to the ‘reference SNP allele’ (smallest PCR product) or ‘alternate SNP allele’ (largest PCR product) depending on the SNP allele present. An SNP allele complementary to the allele-specific primer produced the ‘reference SNP allele’ product, while those without complementarity produced the ‘alternate SNP allele’ product. Both types of TSP product were amplified from heterozygous DNA samples.

Polymorphism information content (SNP diversity)

The polymorphism information content (PIC), of each SNP was calculated as 1 – ∑p i 2 where p i is the frequency of the ith allele for a given locus (Nei 1987).

Genetic mapping

A “minimapping” subset of 48 doubled haploid lines from the Chebec × Harrington population was used for genetic mapping of TSP markers. MapManager QTX (Manly et al. 2001) was used to integrate SNP loci into the published Chebec × Harrington genetic map (Karakousis et al. 2003) using the distribute function with P = 0.0001. Final map distances were calculated using the dataset for all 120 doubled haploid lines of the mapping population.

Genotyping accuracy

Genotyping accuracy was assessed by comparing SNP datasets generated using TSP markers with those produced using an independent genotyping method. Allele-specific primer extension assays were performed as described by Hayden et al. (2009) on the BioPlex™ microsphere suspension array platform (BioRad) to generate independent genotyping data using the same DNA samples and SNP loci.

Results

Marker development

A total of 87 TSP markers were tested on single plants for 16 barley varieties and advanced breeding lines to assess PCR amplification and SNP allele specificity. Each marker produced TSP genotyping products of the expected size indicating that the unigene sequences were successfully amplified. As all of the lines were highly inbred, homozygosity at most loci was expected for each plant making it possible to assess SNP allele specificity. The amplification of a single TSP genotyping product from most or all of the individual plants was used to infer that only the target SNP allele was amplified by the allele-specific primer (Fig. 2a). Markers consistently amplifying two TSP genotyping products from individual plants were considered to have poor SNP allele specificity, probably due to mis-extension of the allele-specific primer by DNA polymerase. Of the 87 TSP markers, six showed poor SNP allele specificity. To improve the specificity of these markers, the allele-specific primers were redesigned. This process involved substituting the 3′-nucleotide of the allele-specific primer with the nucleotide variant for the alternate SNP allele. Retesting on the same barley lines using the six new allele-specific primers found all markers were SNP allele specific. Thus, a 100% success rate was achieved for the development of the TSP markers.
Fig. 2

TSP genotyping assay performed using a marker scsnp05814_98[G/A]bot in 24 barley varieties, and b marker scsnp06172_369(G/A)bot in 24 F3 progeny of the Chebec × Harrington mapping population. Lane 1 contains pUC19/HpaII as size standard

To ensure the markers assayed the targeted SNP loci and behaved in a Mendelian fashion, 42 TSP markers revealing polymorphism between the varieties Chebec and Harrington were genotyped on 48 doubled haploid lines of a mapping population derived from a cross between these varieties. Integration of the marker loci into the published genetic map for this cross showed that the SNP loci were located on the expected chromosomes and at approximately the same map positions reported by Rostoks et al. (2005). Forty markers segregated at the 1:1 expected ratio (χ 1:1 2 non-significant at P = 0.05 and 1 df). Two markers scsnp01644_323[A/G]top and scsnp06130_208[C/T]bot showing skewed segregation mapped to a region on chromosome 2H, which also contained RFLP and SSR markers showing significant segregation distortion.

Genotyping efficacy

To assess the success rate of the assays and the accuracy of SNP allele calling, subsets of the TSP markers were scored on a diverse collection of barley plants with different levels of zygosity. First, 67 markers were scored using genomic DNA extracted from individual plants of 48 barley varieties and advanced breeding lines. These plants were expected to be homozygous at almost all SNP loci. Next, all 87 markers were genotyped on 48 unrelated F1 individuals and 40 markers, known to be polymorphic between two doubled haploid lines from the Chebec × Harrington mapping population, were scored on 96 F3 progeny derived from a cross between those two lines (Fig. 2b). The F1 and F3 plants were expected to contain both homozygous and heterozygous SNP loci. Overall, 11,232 TSP marker assays were performed, of which 98.5% produced TSP genotyping products. Missing data (1.5%) arose solely from occasional PCR failure of individual assays (i.e. absence of PCR product), rather than the amplification of TSP genotyping products of unexpected size. Comparison of the TSP genotyping results with a dataset produced using an independent method (see “Materials and methods”) for the same DNA samples and SNP loci found 100% of genotypes called in both datasets were concordant.

Marker transferability and applications

Having established that TSP markers provide robust genotyping from a technical point of view, we tested the ability for 16 randomly chosen TSP markers to distinguish among 48 cultivated barley lines and 40 H. spontaneum accessions. Each marker tested in the H. spontaneum accessions produced the expected TSP genotyping products. The PIC (SNP diversity) of the SNPs ranged from 0.00 to 0.50, with an average of 0.36 across all lines and accessions. The average SNP diversity was 0.37 in the H. spontaneum accessions, which was slightly higher than that observed (0.35) for the barley lines. All 16 markers revealed an SNP diversity greater than 0.20 in at least one of the germplasm sets. Fifteen and 13 markers showed a diversity greater than 0.20 in only the H. spontaneum and barley sets, respectively. Principal component analysis of the 88 genotypes revealed a clear separation between cultivated and wild barley, and separation of most genotypes within each type of germplasm (Fig. 3).
Fig. 3

Principal component analysis of 88 barley genotypes based on 16 TSP markers. Cultivated barley varieties (open circle) and H. spontaneum accessions (solid circles)

Discussion

Simple molecular marker assays that do not rely upon specialized equipment or reagents underpin routine plant breeding and research activities in many laboratories worldwide. With the rapid growth of genomic resources for many crop plant species, the availability of robust, simple molecular marker assays for genotyping SNPs has become increasingly important.

Temperature-switch PCR is a new method for rapid, low-tech SNP genotyping (Tabone et al. 2009). It differs from existing methods by partitioning the amplification and detection of an SNP into two distinct PCR phases that are separated by primer annealing temperature. In the first PCR phase, a target locus harboring the polymorphism is enriched from genomic template, while in the second phase, the SNP allele harbored within the enriched sequence is interrogated. This biphasic mechanism permits SNP genotyping in a single-step, closed-tube reaction that is performed under standardized reaction conditions for all markers. TSP markers provide an opportunity for laboratories with differing technical capabilities to utilize available SNP resources for marker-assisted breeding and to assess genetic relationships among individuals, populations and gene pools for the efficient management and utilization of germplasm resources. Our goal was to investigate the efficacy for TSP marker development in barley, to assess TSP assay reliability and accuracy for SNP genotyping, and to develop a resource of useful markers for distinguishing genotypes of cultivated barley cultivated barley and its wild relative H. spontaneum.

Marker development and genotyping efficacy

A 93% (81/87) success rate was achieved for developing robust TSP markers in the first round of primer design. Because TSP marker assays are performed under standardized reaction conditions, primer design should be the only factor affecting marker development. Failure of locus-specific primers to amplify a target sequence is easily recognized by the detection of no PCR product, or by the detection of TSP genotyping products of unexpected size. Similarly, poor specificity of an allele-specific primer for the target SNP allele is easily recognized by the consistent amplification of both types of TSP genotyping products from materials that are expected to be homozygous. However, this study found poor SNP allele specificity was readily resolved by targeting the alternate SNP allele. This was achieved by substituting the 3′ nucleotide of the allele-specific primer with the alternate nucleotide for the SNP variant. Using this strategy, we were able to achieve a 100% success rate for marker development. In difficult cases, an allele-specific primer could also be designed for the opposite template DNA strand. It should be noted, however, from our initial studies (Tabone et al. 2009) that the use of a secondary mismatch in the design of allele-specific primers (Chiapparino et al. 2004) had a negative impact on SNP genotyping accuracy, caused by the over-amplification of the ‘alternate SNP allele’ (largest) TSP genotyping product.

We also found that TSP markers produce reliable and accurate codominant SNP genotyping. In the present study, an SNP allele call rate of 98.5% was achieved across 11,232 assays. Occasional failure of individual reactions, resulting in the absence of PCR product, was the sole cause of missing data. Complete (100%) concordance for SNP allele calling between the TSP markers and an independent genotyping method indicated that the TSP genotypes were accurate. The technical reliability of molecular marker assays, in terms of allele calling rate and accuracy, is rarely addressed in the scientific literature, but it is known that genotyping error rates can be relatively high and variable, and that errors can affect biological inferences made from the data (Bonin et al. 2004). Average allele call rates for marker systems, which assay one locus at a time have been reported to be about 90% for SSRs (Hayden et al. 2008; Jones et al. 2008) and about 97% for SNPs (Jones et al. 2008). The reproducibility (accuracy) of genotypic data from these assays has been reported to be about 90–95% for SSRs (Jones et al. 2008; Dreisigacker et al. 2004), and 97–100% for SNPs (Jones et al. 2008). In this context, TSP markers assays can be considered to provide efficient and accurate SNP genotyping.

With the ongoing identification of SNPs in many crop species, TSP offers opportunities for the rapid development of markers to assay polymorphisms of interest. Robust, simple PCR marker assays are especially desirable for marker-assisted breeding, as they allow the direct selection of favorable alleles and allele combinations for key traits in crop improvement, without the need for specialized equipment. Increasing genomic resources will increase the availability of trait-linked SNPs that will be useful for marker-assisted breeding. TSP markers can potentially be developed for any SNP providing that sufficient flanking sequence is available. The amount of flanking sequence required depends on the resolution of the separation matrix used, with about 400 bp required for agarose gel. Only a small (>150 bp) amount of flanking sequence is required to detect TSP genotyping products by high-resolution melt analysis, as described by Tabone et al. (2009).

Marker transferability and utility

Temperature-switch PCR markers developed in this study were highly transferable from cultivated barley to its wild relative H. spontaneum. A subset of 16 markers tested on a group of 88 cultivated varieties and wild accessions showed that most barley lines could be uniquely distinguished (Fig. 3). These results indicate the utility of TSP markers for assessing genetic diversity and germplasm characterization. All 16 markers tested revealed polymorphism among the cultivated varieties and among the wild barley accessions, with an average SNP diversity of 0.36. Because the TSP markers developed in this study were designed for SNPs known to be polymorphic in diverse barley germplasm, which included seven cultivated lines and one H. spontaneum accession (Rostoks et al. 2005), it is expected that all 87 TSP markers will be useful for assessing genetic relationships among individuals, populations and germplasm collections. The markers described here provide good coverage of the barley genome, with 12, 17, 15, 8, 13, 13 and 9 loci distributed over chromosomes 1H to 7H, respectively (Table 1).

Similar to other SNP genotyping assays, a major advantage of TSP markers is that the nucleotide variant itself is interrogated. This allows results across time, laboratories and different germplasm to be readily compared without the need for inclusion of reference genotypes, as is needed for comparative sizing of SSR alleles. Similarly, TSP marker data can be directly compared with SNP data collected using different assay chemistries and platforms. By providing unequivocal genotyping, TSP markers allow information to be produced that can be directly integrated with SNP data from different sources and interpreted in a global context. Importantly, TSP markers provide opportunities for any laboratories to develop germplasm databases that are meaningful across different organizations and that will not become redundant as further improvements to SNP genotyping technologies are made.

The application of SNP markers has mostly been reported for diploid organisms, where the presence–absence of either one or both of the alternate nucleotides indicates homozygosity or heterozygosity. Their application in polyploid organisms is generally lacking owing to complications caused by the requirement to detect allele dosage at an SNP locus, which varies depending on the ploidy of the genome. For example, allohexaploid wheat contains three homoeologous copies of each gene and therefore up to six copies of an SNP allele. To reduce this complexity to a diploid situation, SNP genotyping in polyploid organisms usually relies on methods that involve a two-step process: genome-specific amplification (usually by PCR) of the target sequence harboring a polymorphism, followed by SNP detection. Two-step processes are a bottleneck for high throughput genotyping, especially in marker-assisted breeding. A perceived advantage and use of TSP marker assays is for genome-specific SNP genotyping in polyploid crop plants, because the biphasic PCR mechanism of temperature-switch PCR should allow genome-specific SNP detection to be reduced to a single-step assay (Tabone et al. 2009). The application of TSP markers for genome-specific SNP genotyping in bread wheat is currently being investigated.

Conclusion

In summary, temperature-switch PCR was shown to support the rapid development of robust allele-specific PCR markers for codominant SNP genotyping in barley. The TSP markers described represent an informative set of SNP markers that are useful for assessing genetic relationships among individuals and populations of cultivated barley and its wild relative H. spontaneum. Moreover, they are simple to use, easy to interpret and score, and are amenable to assay automation and automated data acquisition. The TSP markers developed are suited for routine deployment on agarose gel, but can easily be adapted for the detection on high-throughput systems, such as high-resolution melt analysis. These technological features that provide advantages for SNP genotyping in barley are expected to provide similar advantages for other plant and animal species.

References

  1. Bonin A, Bellemain E, Bronken-Eidesen P, Pompanon F, Brochmann C, Taberlet P (2004) How to track and assess genotyping errors in population genetics studies. Mol Ecol 13:3261–3273PubMedCrossRefGoogle Scholar
  2. Bundock PC, Cross MJ, Shapter FM, Henry RJ (2005) Robust allele-specific polymerase chain reaction markers developed for single nucleotide polymorphisms in expressed barley sequences. Theor Appl Genet 112:358–365PubMedCrossRefGoogle Scholar
  3. Chiapparino E, Lee D, Donini P (2004) Genotyping single nucleotide polymorphisms in barley by tetra-primers ARMS-PCR. Genome 47:414–420PubMedGoogle Scholar
  4. Choi IY, Hyten DL, Matukumalli L, Song Q, Chaky JM, Quigley CV, Chase K, Lark KG, Reiter RS, Yoon MS, Hwang EY, Yi SI, Young ND, Shoemaker RC, van Tassell CP, Specht JE, Cregan PB (2007) A soybean transcript map: gene distribution, haplotype and SNP analysis. Genetics 176:685–696PubMedCrossRefGoogle Scholar
  5. Dreisigacker S, Zhang P, Warburton ML, van Ginkel M, Hoisington D, Bohn M, Melchinger AE (2004) SSR and pedigree analyses of genetic diversity among CIMMYT wheat lines targeted to different mega-environments. Crop Sci 44:381–388CrossRefGoogle Scholar
  6. Gupta PK, Rustgi S, Mir RR (2008) Array-based high-throughput DNA markers for crop improvement. Heredity 101:5–18PubMedCrossRefGoogle Scholar
  7. Hayden MJ, Nguyen TM, Waterman A, McMichael GL, Chalmers KJ (2008) Application of multiplex-ready PCR for fluorescence-based SSR genotyping in barley and wheat. Mol Breed 21:271–281CrossRefGoogle Scholar
  8. Hayden MJ, Tabone TL, Nguyen TM, Coventry S, Keiper FJ, Fox RL, Eglinton JK (2009) An informative set of SNP markers for molecular characterization of Australian barley germplasm. Crop and Pasture Science (submitted)Google Scholar
  9. Hayes P, Szucs P (2006) Disequilibrium and association in barley: thinking outside the glass. Proc Natl Acad Sci USA 103:18385–18386PubMedCrossRefGoogle Scholar
  10. Howad W, Yamamoto T, Dirlewanger E, Testolin R, Cosson P, Cipriani G, Monforte AJ, Georgi L, Abbott AG, Arús P (2005) Mapping with a few plants: using selective mapping for microsatellite saturation of the prunus reference map. Genetics 171:1305–1309PubMedCrossRefGoogle Scholar
  11. Jones ES, Sullivan H, Bhattramakki D, Smith JSC (2008) A comparison of simple sequence repeat and single nucleotide polymorphism marker technologies for the genotypic analysis of maize (Zea mays L.). Theor Appl Genet 115:361–371CrossRefGoogle Scholar
  12. Kaneko T, Kihara T, Ito K (1998) Genetic variation of β-amylase thermostability among varieties of barley. Hordeum vulgare L., and relation to malting quality. Plant Breed 117:425–428CrossRefGoogle Scholar
  13. Karakousis A, Gustafson JP, Chalmers KJ, Barr AR, Langridge P (2003) A barley consensus map integrating SSR, RFLP and AFLP markers. Aust J Agric Res 54:1173–1185CrossRefGoogle Scholar
  14. Konieczny A, Ausubel FM (1993) A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific markers. Plant J 4:403–410PubMedCrossRefGoogle Scholar
  15. Kota R, Rudd S, Facius A, Kolesov G, Thiel T, Zhang H, Stein N, Mayer K, Graner A (2003) Snipping polymorphisms from large EST collections in barley (Hordeum vulgare L.). Mol Genet Genomics 270:24–33PubMedCrossRefGoogle Scholar
  16. Kwok PY (2001) Methods for genotyping single nucleotide polymorphisms. Annu Rev Genomics Hum Genet 2:235–258PubMedCrossRefGoogle Scholar
  17. Lijavezky D, Cabezas JA, Ibanez A, Rodriguez V, Martinez-Zapater JM (2007) High throughput SNP discovery and genotyping in grapevine (Vitis vinifera L.) by combining a re-sequencing approach and SNPlex technology. BMC Genomics 8:424CrossRefGoogle Scholar
  18. Manly KF, Cudmore RH, Meer JN (2001) Map Manager QTX, cross-platform software for genetic mapping. Mamm Genome 12:930–932PubMedCrossRefGoogle Scholar
  19. Nei M (1987) Molecular evolutionary genetics. Columbia University Press, New YorkGoogle Scholar
  20. Pavy N, Pelgas B, Beauseigle S, Blais S, Gagnon F, Gosselin I, Lamothe M, Isabel N, Bousquet J (2008) Enhancing genetic mapping of complex genomes through the design of highly-multiplexed SNP arrays: application to the large and unsequenced genomes of white spruce and black spruce. BMC Genomics 9:21PubMedCrossRefGoogle Scholar
  21. Ponting RC, Drayton MC, Cogan NIO, Dobrowolski MP, Spangenberg GC, Smith KF, Forster JW (2007) SNP discovery, validation, haplotype structure and linkage disequilibrium in full-length herbage nutritive quality genes of perennial ryegrass (Lolium perenne L.). Mol Genet Genomics 278:585–597PubMedCrossRefGoogle Scholar
  22. Rafalski JA (2002) Application of single nucleotide polymorphisms in crop genetics. Curr Opin Plant Biol 5:94–100PubMedCrossRefGoogle Scholar
  23. Rogowsky PM, Guidet FLY, Langridge P, Sheperd KW, Koebner RMD (1991) Isolation and characterization of wheat-rye recombinants involving chromosome arm 1DS of wheat. Theor Appl Genet 82:537–544CrossRefGoogle Scholar
  24. Rostoks N, Mudie S, Cardle L, Russell J, Ramsay L, Booth A, Svensson JT, Wanamaker SI, Walia H, Rodriguez EM, Hedley PE, Liu H, Morris J, Close TJ, Marshall DF, Waugh R (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Mol Genet Genomics 274:515–527PubMedCrossRefGoogle Scholar
  25. Rozen S, Skaletsky HJ (2000) Primer3 on the WWW for general users and for biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics methods and protocols: methods in molecular biology. Humana Press, Totowa, pp 365–386Google Scholar
  26. Schneider K, Kulosa D, Soerensen TR, Mohring S, Heine M, Durstewitz G, Polley A, Weber E, Lein JJ, Hohmann U, Tahiro E, Weisshaar B, Schulz B, Kock G, Jung C, Ganal M (2007) Analysis of DNA polymorphisms in sugar beet (Beta vulgaris L.) and development of an SNP-based map of expressed genes. Theor Appl Genet 115:601–615PubMedCrossRefGoogle Scholar
  27. Tabone TL, Mather DE, Hayden MJ (2009) Temperature Switch PCR (TSP): amplification and detection of SNPs in a single-step, closed-tube system. BMC Genomics (under review)Google Scholar
  28. van Orsouw NJ, Hogers RCJ, Janssen A, Yalcin F, Snoeijers S, Verstege E, Schnieders H, van der Poel H, van Oeveren J, Verstegen H, van Eijk MJT (2007) Complexity reduction of polymorphic sequences (CRoPS™): a novel approach for large-scale polymorphism discovery in complex genomes. PLoS ONE 2:e1172PubMedCrossRefGoogle Scholar

Copyright information

© Springer-Verlag 2009

Authors and Affiliations

  • Matthew J. Hayden
    • 1
    • 2
    • 3
    Email author
  • T. Tabone
    • 1
    • 2
    • 4
  • D. E. Mather
    • 1
    • 2
  1. 1.Molecular Plant Breeding Co-operative Research CentreGlen OsmondAustralia
  2. 2.School of Agriculture, Food and WineThe University of AdelaideGlen OsmondAustralia
  3. 3.Primary Industries Research Victoria, Victorian AgriBioscience CenterLa Trobe Research and Development ParkBundooraAustralia
  4. 4.Ludwig Institute for Cancer ResearchRoyal Melbourne HospitalParkvilleAustralia

Personalised recommendations