ps-2, the gene responsible for functional sterility in tomato, due to non-dehiscent anthers, is the result of a mutation in a novel polygalacturonase gene
- 1.2k Downloads
- 12 Citations
Abstract
The recessive mutation ps-2, which appeared spontaneously in tomato, confers functional male sterility due to non-dehiscent anthers. In this study, we isolated and characterized the PS-2 gene. A single nucleotide mutation in a novel tomato polygalacturonase gene is responsible for the ps-2 phenotype. The mutation in ps-2 is responsible for an alternative splicing during maturation of the pre-mRNA, which leads to an aberrant mRNA. Differentiation between ps-2 and wild type (PS-2) anthers only appears in the final developmental stage in which the stomium remains closed in the mutant. To our knowledge, this is the first functional sterility gene isolated in the Solanaceae family. The specific expression of the Arabidopsis homolog of PS-2 in the anther dehiscence zone suggests a conserved mode of action over the plant kingdom, which means that the repression of PS-2 homologs may be a potential way to introduce functional sterility in other species.
Keywords
Abscission Zone Recombinant Population Recognition Splice Site Dehiscence Zone Polygalacturonase GeneIntroduction
In higher plants mature pollen are released from the anther by dehiscence, which consists of a succession of cell destructions occurring successively in the tapetum, the septum and ultimately in the stomium. In tomato, after degeneration of the tapetum, exothecium cells are reinforced, creating a breaking force in the stomium that eventually leads to pollen release (Keijzer 1987).
Recent progress was made in understanding the molecular control of anther dehiscence, which involves mainly the discovery of the implication of jasmonic acid (JA) and ethylene. Several mutants affecting diverse steps in the synthesis of JA in the anthers were identified in Arabidopsis. These mutants displayed a delay of anther dehiscence (reviewed by Scott et al. 2004). The role of ethylene signaling in this phenomenon was highlighted by Rieu et al. (2003) who observed a delay in the dehiscence of anthers of ethylene insensitive tobacco plants.
Polygalacturonases (PGs) belong to one of the largest hydrolase families (Torki et al. 2000; Markovic and Janecek 2001). The PG activities are associated with a wide range of plant developmental programs (reviewed by Hadfield and Bennett 1998), among them, anther dehiscence. The activity of PGs has been observed in the dehiscence zone of anthers of maize, tobacco, oilseed rape and Arabidopsis (Dubald et al. 1993; Sander et al. 2001). However their role in the dehiscence process has never been studied in detail.
We have recently fine-mapped the positional sterility-2 gene, conferring non-dehiscent anthers in tomato (Gorguet et al. 2006). Here, we report the isolation of the ps-2 gene by positional cloning. A single mutation in the coding sequence of a novel polygalacturonase gene is responsible for this phenotype. We found that this mutation affects one of the intron splicing recognition sites of the gene, giving rise to an aberrant mRNA, lacking one of the exons. Microscopic observation of the ps-2 phenotype revealed similarities with what was already found in Arabidopsis and tobacco mutants (reviewed by Scott et al. 2004; Rieu et al. 2003). This new PG gene, is also expressed in maturing fruits, which opens the way to speculation on the possible role of Ps-2 in fruit maturation.
Materials and methods
Plant material
The F2 recombinant sub-population developed from the cross between ps-2ABL (S. lycopersicum, homozygous for the ps-2 mutation) and S. pimpinellifolium, was used for genetic mapping. This population, segregating for ps-2, is composed of 146 F2 recombinant plants in the ps-2 locus region (Gorguet et al. 2006).
Another 176 advanced breeding lines (ABLs), 8 of them being ps-2/ps-2, were used to test the association between the identified SNP and the ps-2 locus.
Anthers of ps-2ABL and cv. Moneymaker were used for microscopic observations.
Microscopy
Plant material was fixed for 24 h at 4°C in 0.1 M phosphate buffer, pH 7.0, containing 4% paraformaldehyde. Samples for scanning electron microscopy (SEM) were processed as described in Dornelas et al. (2000), and digital images were obtained using an Orion Framegrabber (Matrox Electronic Systems, Unterhaching, Germany). Samples for light microscopy were embedded in Technovit 7100 (Hereaus Kulzer, Wehrheim, Germany), sectioned, stained with toluidine blue, and mounted in Euparal (Chroma-Gesellschaft, Kongen, Germany).
BAC library screening and contig construction
We used the tomato HindIII BAC library constructed from genomic DNA of the cultivar accession Heinz 1706. The Heinz library is a 15-genome equivalent with an average insert size of 114.5 kb (Budiman et al. 2000). Screening of the BAC library was performed by PCR amplification, first on plate pools and then on individuals. Plasmid DNA of the positive BAC clones was then isolated and used for further analysis.
PCR markers used in the genetic linkage maps
| Marker name | Use | Primer sequence | Size (bp) | Restriction enzyme |
|---|---|---|---|---|
| Markers developed from BAC ends sequences | ||||
| 67F23-T | CAPS | Fw: CTACTCTTCCGCCATAACTG | 599 | HincII |
| Rv: GATCCAAACGAACAAAAGTCA | ||||
| 67F23-S | CAPS | Fw: TCATTCCGTTGCTGAATGAGA | 413 | DraI |
| Rv: ATAACTTATATCACTCCCAATCA | ||||
| 69C22-T | dCAPS | Fw: TCTTTCGATATTTTTCAGAACTAA | 200 | DdeI |
| Rv: TGAGATGTTTGCAATAACATTCT | ||||
| 143M15-S | CAPS | Fw: CATCGAAGTAACAGAGATATTA | 369 | MwoI |
| Rv: CCATAGGGATTATGATGTGTA | ||||
| 114C15-T | CAPS | Fw: GCACTGAAGAATGGATAGACTC | 457 | MnII |
| Rv: GGAATTGACCAAAAAGGATAGC | ||||
| 118A17-T | CAPS | Fw: GGCATGGTGAAGTCCACATT | 739 | HaeIII |
| Rv: GTGTCACAGGTTTGGTTCAT | ||||
| 15N23-T | CAPS | Fw: GGCAGATATCTGCAATACGT | 576 | TaqI |
| Rv: ATCATGAACAGCAAAACAACCA | ||||
| Markers developed from BAC 143M15 sequence | ||||
| ORF1 | CAPS | Fw: CTGTATCTATGACGAGGAGA | 625 | HaeIII |
| Rv: GATCCTGAAGCTGAAGCTT | ||||
| ORF2 | CAPS | Fw: AATATTTTCAACTTTCAAATCTCTT | 206 | MnlI |
| Rv: ACGAAGGCATGATTGTCGTTA | ||||
| ORF3 | CAPS | Fw: GTTGAACTTATACCACTAGGA | 937 | NdeI |
| Rv: GTGCGGTCTCATCAACTCAA | ||||
| ORF4 | dCAPS | Fw: GAACACTTAGGTTAAAATATAGC | 217 | AluI |
| Rv: CCTACTATCCTTCTTGTAATCT | ||||
| ORF5 | CAPS | Fw: CTTAAAGGCACACTTAGATTCA | 962 | HpyCH4IV |
| Rv: CTGAGAATTCTCTTGACTGCA | ||||
| ORF4(1) | SCAR | Fw: GCTTTATTCATAGTAAATTCTGT | 805/ 885 | |
| Rv: TCAGACAAATCATCGTATATTGA | ||||
| ORF4(2) | SCAR | Fw: TCCATTTGTAGTTTCATAAAGC | 465/ 515 | |
| Rv: CCAAGCGGATAATTAATGTCA | ||||
| Marker developed for ps-2ABL allele identification within S. lycopersicum | ||||
| ps-2 marker | CAPS | Fw: CAAATTGGATGAGAGTTTTGAA | 695 | HpyCH4IV |
| Rv: CATTTTACAAGTGTAACAACTTG | ||||
Fingerprinting patterns of individual BAC clones were generated essentially as described by Brugmans et al. (2006), using the HindIII/TaqI enzyme combination.
BAC DNA sequencing and candidate gene analysis
The size of BAC clone 143M15 was estimated by pulse field gel electrophoresis. The BAC clone 143M15 was sequenced via the shotgun-sequencing method by Greenomics (The Netherlands). PCR markers derived from the candidate genes identified on the BAC sequence were developed as described by Gorguet et al. (2006). To identify putative genes, the final BAC DNA sequence was scanned against the tomato Unigene database from SGN (Mueller et al. 2005) and the Arabidopsis gene models database from TAIR (http://www.Arabidopsis.org; Huala et al. 2001), using the TBLASTX interface of SGN (Mueller et al. 2005), with a significance threshold of 1E−10. The PCR markers based on putative ORF sequences were developed and screened on the recombinant population as described by Gorguet et al. (2006). Details of these PCR markers are given in Table 1.
The complete genomic DNA sequence of ORF4, as well as up-stream and down-stream sequences containing, respectively, promoter and terminator was amplified and sequenced from Moneymaker and ps-2ABL using several successive overlapping primer pairs giving products of around 900 bp. The resulting DNA sequences of Moneymaker and ps-2ABL were assembled with DNAStar. The FGENESH software was used to identify the putative exons and introns of the candidate gene (Salamov and Solovyev 2000).
Phylogenetic analysis
Tomato polygalacturonase protein sequences with known tissue expression, as well as the best hits of a protein BLAST search with the candidate protein, were selected to conduct a phylogenetic analysis. Only the Pfam glycosyl hydrolase 28 domains, of the selected protein sequences, were used for the analysis. The Pfam GH28 domain of each protein sequence was identified with the protein BLAST interface of NCBI. Selected amino acid sequences of Pfam GH28 domains were aligned using ClustalW multiple sequence alignment software (Higgins et al. 1994).
PAUP software package version 4 (Swofford 2002) was used to construct a 50% majority-rule consensus phylogenic tree using maximum parsimony (1,000 bootstrap replicates and 250 addition sequences replicates). Cedar PG protein sequence was used and defined as outgroup.
The accession numbers of the amino acids sequences in the phylogenetic tree (Fig. 5) are as follows; Kiwi fruit (AAC14453), grape berry fruit (AAK81876), soybean pods (AAL30418), peach fruit (CAA54448), apple fruit (AAA74452), pear fruit (BAC22688), Arabidopsis dehiscence zone ADPG1 (CAA05525), oilseed rape dehiscence zones RDPG1 (CAA65072), oilseed rape pod (CAA90272), turnip silique valve desiccation (CAD21651), bell pepper fruit (BAE47457), tomato fruit TFPG (CAA32235), tomato pistil (AAC70951), tomato abscission zones TAPG1, 2, 4, 5 (AAC28903, AAB09575, AAB09576, AAC28906), tomato wound leaf (AAD17250) and tomato seed (AAF61444). The accession number of the tomato β-actin is: BT013524.
Total RNA isolation, cDNA synthesis and quantitative PCR analysis
The total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany). Between 50 and 100 mg of each tissue (anthers, fruit, flower abscission zone and leaf abscission zone) was used per RNA isolation reaction. Only 1 μg of total RNA, after DNase I treatment (Boehringer Manheim), was used per sample for the synthesis of cDNA. First strand cDNA template was synthesized using random hexamers as primers and Multiscribe reverse transcriptase (Applied Biosystems). The nearly complete coding sequence of ORF4 was amplified to study the intron splicing using the forward primer: TAGCTCCAAAGCTATCCACAT, located on the first exon, starting 47 nucleotides down-stream the start codon and the reverse primer: TGGAGAATGTGAAATTGTTAGG, located on the last exon, stopping 100 nucleotides up-stream the stop codon (Fig. S1). Nearly complete CDS of ORF4 was amplified with standard PCR reaction (55°C annealing temperature and 35 cycles).
Real-time experiments were conducted in an iCycler MyiQ detection system (Bio-Rad), using the SYBR green PCR master mix kit (Applied Biosystems). The primer sequences were: forward primer 5′-TTTTGCCATTGCCATTGATA-3′, reverse primer 5′-TGTGGTGTCCCAGAACAAGA-3′ (ORF4); and forward primer 5′-ACCACTTTCCGATCTCCTCTC-3′, reverse primer 5′-ACCAGCAAATCCAGCCTTCAC-3′ (β-actin). Relative quantification of the ORF4 transcript level was calculated with the internal β-actin control by applying the 2−∆CT formula. The purity of the PCR products was verified with their melting curves. The experiment was performed twice with true biological replicates. The PCR controls were performed in the absence of added reverse transcriptase to ensure that the RNA samples were free of DNA contamination. In addition, the ORF4 primers were designed on either sides of an intron so that the PCR product obtained on genomic DNA was significantly longer than on cDNA and that the difference could easily be observed on gel.
The sequence of the tomato positional sterility-2 (Ps-2) genomic DNA was deposited in GenBank (accession number EU111748).
Results
Microscopic observation of the ps-2 phenotype
Transverse sections of anthers of wild type (Moneymaker) and mutant (ps-2ABL) were prepared and stained with toluidine blue to identify the stage at which anther development/dehiscence in the mutant is blocked. Anthers at anthesis were prepared for SEM.
Microscopic observation of anthers of ps-2ABL and wild type (WT; Moneymaker). a Cross-section of anthers at late flower bud (FB), early pre-anthesis (PA) stained in toluidine blue. Arrows refer to the crystals that can be seen in the septum cells of WT and ps-2ABL. s septum, st stomium, p pollen. b Cross-section of anthers at anthesis stained in toluidine blue. Arrows indicate the opening of the anther in WT and the stomium that remains closed in ps-2ABL because stomium cells are not torn apart. Note the rigid locule walls in wild type and the flattened ones in the mutant (arrowheads). c Longitudinal view of anther cones at anthesis observed by SEM. Arrows indicate the longitudinal opening of the anthers in WT with pollen presented along the opening edges, and the closed anthers in ps-2ABL. Some pollen is visible in the mutant anther at the right-hand side, due to cutting during preparation
Physical mapping and candidate gene identification
Cloning of the ps-2 gene, from genetic map to gene structure. a Genetic map developed in a recombinant F2 population (ps-2ABL × S. pimpinellifolium; Gorguet et al. 2006). In white are the numbers of recombinant plants between each marker. b Physical map: arrows in dashed represent the computational anchoring of BACs. Arrows in full line represent the anchoring of BACs by molecular markers (S: SP6; T: T7). c Genetic positions of the ORFs on BAC clone 143M15. d Structure of candidate gene ORF4. Cylinders with roman numbers represent exons. Positions of the putative TATA box and PolyA signal sequence are indicated by an inverted triangle at the beginning of the sequence and a rhombus at the end of the sequence, respectively
Identification of candidate genes present on BAC 143M15 based on Arabidopsis gene models
| Candidate gene | Tomato | Arabidopsis | |||||
|---|---|---|---|---|---|---|---|
| Unigenes acc. no. | Accession no. | Gene function | Chr. | AGI coordinates (bases) | TBLASTX | ||
| E value | Score | ||||||
| ORF1 | U323899 | AF014399 | Magnesium-chelatase | 1 | 2696415–2700961 | 0 | 214 |
| ORF2 | NM112785 | Transcriptional factor B3 family | 3 | 6548875–6551847 | 3E-21 | 105 | |
| ORF3 | U317249 | AF326883 | Remorin family protein | 2 | 17477944–17480014 | 9E-37 | 110 |
| ORF4 | NM111676 | Polygalacturonase | 3 | 21294315–21296918 | 1E-79 | 108 | |
| ORF5 | AB017502 | Glycosyl hydrolase family 3 | 5 | 7107378–7111311 | 0 | 276 | |
In order to localize the candidate genes in the high-resolution map, we converted the putative gene sequences (or the sequences nearby) into PCR markers and mapped them in the recombinant population. Every candidate gene mapped at a different position in the high-resolution linkage map and therefore we could easily identify the likeliest candidate for ps-2 based on their positions in the genetic map. ORF4, a putative polygalacturonase gene, mapped the closest to the ps-2 locus (Fig. 2). Subsequently, the putative introns and exons were identified using the FGENSH software of Softberry. The candidate gene ORF4 is composed of nine exons and eight introns, covering a genomic distance of 6,716 nucleotides from putative start to stop codon, for a coding sequence of 1,179 nucleotides. The SNP used to develop the PCR marker ORF4 was located in the second putative intron. We developed and mapped two extra PCR markers, one based on a deletion of 76 bp in the first intron in the S. pimpinellifolium allele [ORF4(1)] and one based on an insertion of 38 bp in the sixth intron in the S. pimpinellifolium allele [ORF4(2)]. The three PCR markers, ORF4(1), ORF4 and ORF4(2) mapped at an interval of one recombinant between each other, indicating that at least two recombinations had occurred within the candidate gene ORF4 in the recombinant population (Fig. 2). The ORF4(2) co-segregated with the ps-2 locus on the high-resolution map.
Mutation in ORF4 and molecular marker development
To consolidate the hypothesis that ORF4 corresponds to the ps-2 gene, we searched for sequence alterations in the ps-2ABL allele. The entire 9 kb, from the putative promoter to the putative terminator of ORF4 was sequenced from cv. Moneymaker and ps-2ABL. One single mutation was identified in the last nucleotide of the fifth putative exon of ORF4, in which the nucleotide guanine was replaced by cytosine. To test the association between the identified SNP in ORF4 and the ps-2 trait, we developed a molecular marker based on that SNP, in such a way that the ps-2ABL allele and the wild type allele in S. lycopersicum could easily be differentiated on gel. This marker was tested on a set of 176 ABLs among which eight were ps-2/ps-2. These eight male sterile plants showed the same marker pattern, distinct from the other ABLs, which confirms that the SNP is present in the ps-2 lines tested. This marker can now easily be used for molecular-assisted introduction of the ps-2 trait into modern tomato lines.
Alternative intron splicing
Size of the nearly complete coding sequence of ORF4 in Moneymaker and ps-2ABL. The positions of the primers on the gene sequence are indicated on the Fig. S1
Intron splicing between exon IV and VI of ORF4, in Moneymaker (WT) and in ps-2ABL. The mutated nucleotide (G → C) is circled by a dashed rectangle
ORF4 sequence analysis
Phylogenetic tree for 20 angiosperm and one gymnosperm PG aa sequences. The phylogram is the result of a 50% majority-rule consensus of 3,296 trees (using tree weights). The PG sequences segregate into two major clades identified as the well characterized clades A and B. The candidate protein (PS-2) is part of clade B
Alignment of Pfam GH28 domain of TFPG, ORF4 and ps-2 (mutant of ORF4). Color code is only effective for the comparison between TFPG and ORF4: In reverse color are the identical amino acids. In gray are the conserved substitutions. In bold underlined are the four conserved domains of polygalacturonase as defined by Rao et al. (1996), identified by roman numbers
The putative derived protein of ORF4 contains the four conserved domains characteristic of PG proteins, as presented by Rao et al. (1996; Fig. 6). The first conserved domain is located on the fifth exon, which is absent in the mutant protein and the three others domains are located more C-terminally and therefore not in frame in the mutant sequence. Thus, the mutant protein does not contain any of the four conserved domains that play a major role in the function of the protein.
Expression of ORF4 in anther, fruit and other tissues
Tissue-specific expression of ORF4. cDNA of Moneymaker from diverse tissues was subjected to PCR amplification using primers dedicated to quantitative PCR analysis. 1 Leaf abscission zone, 2 flower abscission zone, 3 anthers at anthesis, 4 fruit at mature stage, gDNA genomic DNA control
Real-time PCR expression data of ORF4 at different stages of anthers development on Moneymaker and ps-2ABL (left) and during fruit development and ripening of Moneymaker (right). DAP days after pollination
Discussion
The ps-2 ABL produces anthers that do not undergo dehiscence. In this study, we showed that anther dehiscence of ps-2ABL is blocked in the ultimate phase.
This phenotypic mutation is recessive and under the control of one single locus. In a previous study we fine-mapped the ps-2 gene on the short arm of chromosome 4 (Gorguet et al. 2006). Here, we report the isolation and functional characterization of the ps-2 gene. This is the first functional sterility gene isolated in the Solanaceae family. The high resolution of the linkage map developed on the recombinant population allowed us to narrow down the position of the ps-2 gene to one single candidate gene on the BAC sequence. The presence of at least two recombinations within ORF4 allowed us to restrict the location of the ps-2 mutation to the end of the gene sequence. Still, we analyzed the complete gene and putative promoter sequence.
We found that the ps-2 phenotype is the result of a single nucleotide mutation in a polygalacturonase gene unknown to date, composed of nine exons. This single nucleotide mutation is located on the last nucleotide of the 3′ end of the fifth exon, affecting the intron splicing recognition site, which is changed from CAG/GTATCG to CAC/GTATCG (exon 3′/intron 5′). Though the cytosine base is present in 11% of the intron splice sites at this specific position in plants, the combination “CAC” at the exon 3′end has never been detected in any splice site in plants (Brown 1986). The fifth exon is spliced out together with the two flanking introns. Analysis of Arabidopsis mutants with mutations around splice sites has revealed several examples of exon skipping in plant splicing (reviewed by Brown and Simpson 1998). Most of these mutations are located in the intron part of the recognition splice sites. To our knowledge, in plants, the only mutant showing exon skipping due to a mutation in the exon part of a recognition splice site, to date, was the spy-1 mutant in Arabidopsis (Jacobsen et al. 1996) in which the CAG/GTTTGA (exon 3′/intron 5′) recognition splice site at the end of the eighth exon was mutated into CAA/GTTTGA. The exon skipping observed in the mutated allele of ORF4 induces a frame-shift in the rest of the sequence, which has as consequence to create an early stop codon 14 aa further. The complete mutant protein is therefore 154 aa long in comparison to 392 aa long for the wild type, and does not contain any of the four domains characteristic of PGs.
We did not clone the genomic sequence of ORF4 with its respective promoter, in order to perform a complementation experiment with the ps-2ABL. A complementation test would be the ultimate proof to determine whether the mutation identified in ORF4 is causing the non-dehiscent phenotype of ps-2ABL. However, based on the accuracy of the high-resolution map, the specific expression pattern of ORF4 in anthers and the non-functionality of ORF4 in ps-2 ABL we believe to have proved that the mutation found in ORF4 is responsible for the functional sterility observed in ps-2ABL.
ps-2 is a PG of clade B
The isolated gene responsible for the ps-2 phenotype is a PG unknown to date. The phylogenetic analysis of PS-2 amino acids sequence revealed a close similarity with PGs of clade B as defined by Hadfield and Bennett (1998). Clade B is here composed of fruit PGs, among them the tomato fruit PG, as well as silique or pod dehiscence PGs. ADPG, the Arabidopsis homolog of PS-2 is also expressed in the anther dehiscence zone (Sander et al. 2001). This suggests a conserved role of PS-2 homologs over the plant kingdom. We suggest that the repression of PS-2 homologs in other plant species may procure functional sterility in species where such a trait does not exist.
The other tomato PGs cluster in different clades. In accordance with the assertion that the divergence of PG family members occurred prior to the separation of the angiosperm species (Hadfield and Bennett 1998), PS-2 is here more closely related to proteins of the same clade, from other species, than to tomato PGs from other clades. Most of the other tomato PGs is related to abscission (TAPG). In our study, expression of PS-2 was not detected in flower and leaf abscission zones. However, in addition to anther tissues, we detected mRNA transcript of PS-2 in fruits.
PS-2 transcript accumulation increases along with the development of the anthers
We measured the relative level of PS-2 transcript at different stages in anthers. The PS-2 transcript is already detected in the anthers of Moneymaker at the flower bud stage. The transcript level increases over stages to reach a maximum at post-anthesis, when anthers are dehisced. This increase of PS-2 transcript accumulation is parallel to the septum and stomium degeneration observed in the anthers. The ps-2 transcript level in ps-2ABL anthers was detected from pre-anthesis on, but the transcript level remained very low in comparison to Moneymaker, at anthesis and post-anthesis. Very likely the mutant mRNA is recognized as non-sense and degraded by non-sense-mediated mRNA decay (NMD). The NMD functions as a quality control mechanism to eliminate abnormal transcripts (Lejeune and Maquat 2005). Although unlikely, our findings do not exclude the possibility that the mutant phenotype is caused by the truncated protein derived from the mutant mRNA.
PS-2 may also play a role in tomato fruit ripening
TFPG, the only tomato fruit polygalacturonase identified to date, has been characterized as one of the main actors in the process of fruit softening. Anti-sense repression of TFPG has lead to the production of tomato fruit with longer shelf life but the fruits did undergo ripening indicating that other actors also play a relevant role in the process of fruit softening (Smith et al. 1988). The PS-2 may well be one of these actors by contributing to the fruit cell wall degradation. The PS-2 transcript was detected in the late stages of fruit development in Moneymaker (Fig. 8). The maximum transcripts were found at mature stage (57 DAP). Similarly, TFPG has been detected only at ripening stages, starting at mature green or at breaker stage (Thompson et al. 1999; Eriksson et al. 2004). The level of TFPG was also found to increase over time from breaker stage to mature fruit, in cv. AC and Liberto (Thompson et al. 1999).
The expression of Ps-2 in fruits does not prove that this gene has an effect in fruit maturation. The comparison of fruit maturation and shelf life, between ps-2ABL after hand pollination and Moneymaker or any other normal tomato line is unreliable due to the difference of genetic background. Knock-out of PS-2 by anti-sense RNA or RNAi in tomato, or double mutants in which both PS-2 and TFPG are impaired, could provide new insights to answer that question. The time between hand pollination to mature fruit stage and fruit shelf life could be measured and compared to the untransformed control in order to evaluate the effect of PS-2 in the fruit. Knock-outs of homologs of PS-2 in other plants species are also of valuable interest to verify whether the control of anther dehiscence in its ultimate phase is conserved among species.
Notes
Acknowledgments
This project was sponsored by Western Seed BV, The Netherlands. We thank Henk Kieft for assistance with microscopic analysis of the anthers, Antoine Deniau for generating the phylogenetic tree, Dr. Anne Kortstee and Marian Oortwijn for providing cDNA of Moneymaker fruits and Prof. Dr. Gerco Angenent for critical reading of the manuscript and useful suggestions.
Open Access
This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
Supplementary material
References
- Brown JWS (1986) A catalogue of splice junction and putative branch point sequences from plant introns. Nucleic Acids Res 14:9549–9559PubMedCrossRefGoogle Scholar
- Brown JWS, Simpson CG (1998) Splice site selection in plant pre-mRNA splicing. Annu Rev Plant Physiol Plant Mol Biol 49:77–95PubMedCrossRefGoogle Scholar
- Brugmans B, Hutten RGB, Rookmaker ANO, Visser RGF, Van Eck HJ (2006) Exploitation of a marker dense linkage map of potato for positional cloning of a wart disease resistance gene. Theor Appl Genet 112:269–277PubMedCrossRefGoogle Scholar
- Budiman MA, Mao L, Wood TC, Wing RA (2000) A deep-coverage tomato BAC library and prospects toward development of an STC framework for genome sequencing. Genome Res 10:129–136PubMedGoogle Scholar
- Dornelas M, van Lammeren A, Kreis M (2000) Arabidopsis thaliana SHAGGY-related protein kinases (AtSK11 and 12) function in perianth and gynoecium development. Plant J 21:419–429PubMedCrossRefGoogle Scholar
- Dubald M, Barakate A, Mandaron P, Mache R (1993) The ubiquitous presence of exopolygalacturonase in maize suggests a fundamental cellular function for this enzyme. Plant J 4:781–791PubMedCrossRefGoogle Scholar
- Eriksson EM, Bovy A, Manning K, Harrison L, Andrews J, De Silva J, Tucker GA, Seymour GB (2004) Effect of the colorless non-ripening mutation on cell wall biochemistry and gene expression during tomato fruit development and ripening. Plant Physiol 136:4184–4197PubMedCrossRefGoogle Scholar
- Gorguet B, Schipper D, van Heusden AW, Lindhout P (2006) High resolution fine mapping of ps-2, a mutated gene conferring functional male sterility in tomato due to non-dehiscent anthers. Theor Appl Genet 113:1437–1448PubMedCrossRefGoogle Scholar
- Hadfield KA, Bennett AB (1998) Polygalacturonases: many genes in search of a function. Plant Physiol 117:337–343PubMedCrossRefGoogle Scholar
- Higgins D, Thompson J, Gibson T, Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22:4673–4680PubMedCrossRefGoogle Scholar
- Huala E, Dickerman AW, Garcia-Hernandez M, Weems D, Reiser L, LaFond F, Hanley D, Kiphart D, Zhuang M, Huang W, Mueller LA, Bhattacharyya D, Bhaya D, Sobral BW, Beavis W, Meinke DW, Town CD, Somerville C, Rhee SY (2001) The Arabidopsis Information Resource (TAIR): a comprehensive database and web-based information retrieval, analysis, and visualization system for a model plant. Nucleic Acids Res 29:102–105PubMedCrossRefGoogle Scholar
- Jacobsen SE, Binkowski KA, Olszewski NE (1996) SPINDLY, a tetratricopeptide repeat protein involved in gibberellin signal transduction in Arabidopsis. Proc Natl Acad Sci USA 93:9292–9296PubMedCrossRefGoogle Scholar
- Keijzer CJ (1987) The processes of anther dehiscence and pollen dispersal. I. The opening mechanism of longitudinally dehiscing anthers. New Phytol 105:487–498CrossRefGoogle Scholar
- Lejeune F, Maquat LE (2005) Mechanistic links between nonsense-mediated mRNA decay and pre-mRNA splicing in mammalian cells. Curr Opin Cell Biol 17:309–315PubMedCrossRefGoogle Scholar
- Markovic O, Janecek S (2001) Pectin degrading glycoside hydrolases of family 28: sequence-structural features, specificities and evolution. Protein Eng 14:615–631PubMedCrossRefGoogle Scholar
- Mueller LA, Solow TH, Taylor N, Skwarecki B, Buels R, Binns J, Lin C, Wright MH, Ahrens R, Wang Y, Herbst EV, Keyder ER, Menda N, Zamir D, Tanksley SD (2005) The SOL genomics network. A comparative resource for Solanaceae biology and beyond. Plant Physiol 138:1310–1317PubMedCrossRefGoogle Scholar
- Rao MN, Kembhavi AA, Pant A (1996) Implication of tryptophan and histidine in the active site of endo-polygalacturonase from Aspergillus ustus: elucidation of the reaction mechanism. Biochim Biophys Acta 1296:167–173PubMedGoogle Scholar
- Rieu I, Wolters-Arts M, Derksen J, Mariani C, Weterings K (2003) Ethylene regulates the timing of anther dehiscence in tobacco. Planta 217:131–137PubMedGoogle Scholar
- Salamov AA, Solovyev VV (2000) ab initio gene finding in Drosophila genomic DNA. Genome Res 10:516–522PubMedCrossRefGoogle Scholar
- Sander L, Child R, Ulvskov P, Albrechtsen M, Borkhardt B (2001) Analysis of a dehiscence zone endo-polygalacturonase in oilseed rape (Brassica napus) and Arabidopsis thaliana: evidence for roles in cell separation in dehiscence and abscission zones, and in stylar tissues during pollen tube growth. Plant Mol Biol 46:469–479PubMedCrossRefGoogle Scholar
- Scott RJ, Spielman M, Dickinson HG (2004) Stamen structure and function. Plant Cell 16:S40–S60CrossRefGoogle Scholar
- Smith CJS, Watson CF, Ray J, Bird CR, Morris PC, Schuch W, Grierson D (1988) Anti-sense RNA inhibition of polygalacturonase gene expression in transgenic tomatoes. Nature 334:724–726CrossRefGoogle Scholar
- Swofford DL (2002) PAUP*. Phylogenetic analysis using parsimony (*and other methods). Version 4. Sinauer Associates, SunderlandGoogle Scholar
- Thompson AJ, Tor M, Barry CS, Vrebalov J, Orfila C, Jarvis MC, Giovannoni JJ, Grierson D, Seymour GB (1999) Molecular and genetic characterization of a novel pleiotropic tomato-ripening mutant. Plant Physiol 120:383–390PubMedCrossRefGoogle Scholar
- Torki M, Mandaron P, Mache R, Falconet D (2000) Characterization of a ubiquitous expressed gene family encoding polygalacturonase in Arabidopsis thaliana. Gene 242:427–436PubMedCrossRefGoogle Scholar







