Plant Molecular Biology

, Volume 29, Issue 4, pp 691–702 | Cite as

Members of a new family of DNA-binding proteins bind to a conserved cis-element in the promoters of α-Amy2 genes

  • Paul J. Rushton
  • Heather Macdonald
  • Alison K. Huttly
  • Colin M. Lazarus
  • Richard Hooley
Research Article

Abstract

The promoters of wheat, barley and wild oat α-Amy2 genes contain a number of conserved cis-acting elements that bind nuclear protein, we report here the isolation of two cDNAs encoding proteins (ABF1 and ABF2) that bind specifically to one of these elements, Box 2 (ATTGACTTGACCGTCATCGG). The two proteins are unrelated to each other except for a conserved region of 56–58 amino acids that consists of 25 highly conserved amino acids followed by a putative zinc finger motif, C-X4–5-C-X22–23-H-X1-H. ABF1 contains two such conserved regions, whereas ABF2 possesses only one but also contains a potential leucine zipper motif, suggesting that it could form homo- or heterodimers. ABF1 and ABF2 expressed in Escherichia coli bound specifically to Box 2 probes in gel retardation experiments; this binding was abolished by the transition-metal-chelating agent, 1,10-o-phenanthroline and by EDTA. We propose that ABF1 and ABF2 are representatives of two classes of a new family of plant sequence-specific DNA-binding proteins.

Key words

aleurone Avena fatua DNA-binding proteins Zinc finger heterologous expression leucine zipper 

Preview

Unable to display preview. Download preview PDF.

Unable to display preview. Download preview PDF.

References

  1. 1.
    Baxevanis AD, Vinson CR: Interactions of coiled coils in transcription factors: where is the specificity? Curr Opin Genet Devel 3: 278–285 (1993).Google Scholar
  2. 2.
    Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72: 248–254 (1976).Google Scholar
  3. 3.
    Dehesh K, Hung H, Tepperman JM, Quail PH: GT-2: a transcription factor with twin autonomous DNA-binding domains of closely related but different target sequence specificity. EMBO J 11: 4131–4144 (1992).Google Scholar
  4. 4.
    Devereux J, Haeberli P, Smithies O: A comprehensive set of sequence-analysis programs for the VAX. Nucl Acids Res 12: 387–395 (1984).Google Scholar
  5. 5.
    Feinberg AP, Vogelstein B: A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 132: 6–13 (1983).Google Scholar
  6. 6.
    Goldman S, Mawal YR, Tanida I, Wu R: Studies of a gibberellin-dependent DNA-binding protein related to the expression of a rice α-amylase gene. Plant Sci 99: 75–88 (1994).Google Scholar
  7. 7.
    Grasser KD, Feix G: Isolation and characterization of maize cDNAs encoding a high mobility group protein displaying a HMG-box. Nucl Acids Res 19: 2573–2577 (1991).Google Scholar
  8. 8.
    Gubler F, Jacobsen JV: Gibberellin-responsive elements in the promoter of a barley high-PI α-amylase gene. Plant Cell 4: 1435–1441 (1992).Google Scholar
  9. 9.
    Hanas JS, Hazuda DJ, Bogenhagen DF, Wu FY-H, Wu C-W: Xenopus transcription factor A requires zinc for binding to the 5 S RNA gene. J Biol Chem 258: 14120–14125 (1983).Google Scholar
  10. 10.
    Harrington RE, Winicov I: New concepts in protein-DNA recognition: sequence-directed DNA bending and flexibility. Prog Nucl Acids Res Mol Biol 47: 195–270 (1994).Google Scholar
  11. 11.
    Huang N, Sutliff TD, Litts JC, Rodriguez RL: Classification and characterisation of the rice α-amylase multigene family. Plant Mol Biol 14: 655–668 (1990).Google Scholar
  12. 12.
    Huttly AK, Baulcombe DC: A wheat α-Amy2 promoter is regulated by gibberellin in transformed oat aleurone protoplasts. EMBO J 8: 1907–1913 (1989).Google Scholar
  13. 13.
    Huttly AK, Phillips AL: Gibberellin-regulated expression of two protein kinases in oat aleurone cells which show homology to MAP kinase and a ribosomal protein kinase. Plant Mol Biol 27: 1043–1052 (1995).Google Scholar
  14. 14.
    Huttly AK, Phillips AL, Tregear JW: Localisation of cis elements in the promoter of a wheat α-Amy2 gene. Plant Mol Biol 19: 903–911 (1922).Google Scholar
  15. 15.
    Ishiguro S, Nakamura K: Characterization of a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5′ upstream regions of genes coding for sporamin and β-amylase from sweet potato. Mol Gen Genet 244: 563–571 (1994).Google Scholar
  16. 16.
    Jacobsen JV, Beach LR: Control of transcription of α-amylase and rRNA genes in barley aleurone protoplasts by gibberellin and abscisic acid. Nature 316: 275–277 (1985).Google Scholar
  17. 17.
    Jones RL, Jacobsen JV: Regulation of synthesis and transport of secreted proteins in cereal aleurone. Int Rev Cytol 126: 49–88 (1991).Google Scholar
  18. 18.
    Katargiri F, Lam E, Chua N-H: Two tobacco DNA-binding proteins have homology to CREB. Nature 340: 727–730 (1989).Google Scholar
  19. 19.
    Laemmi UK: Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227: 680–685 (1970).Google Scholar
  20. 20.
    Lam E, Kano-Murakami Y, Gilmartin P, Niner B, Chua N-H: A metal-dependent DNA-binding protein interacts with a constitutive element of a light-responsive promoter. Plant Cell 2: 857–866 (1990).Google Scholar
  21. 21.
    Lanahan MB, Ho T-HD, Rogers SW, Rogers JC: A gibberellin response complex in cereal α-amylase gene promoters. Plant Cell 4: 203–211 (1992).Google Scholar
  22. 22.
    Mitchell PJ, Tjian R: Transcriptional regulation in mammalian cells by sequence specific DNA-binding proteins. Science 245: 371–378 (1989).Google Scholar
  23. 23.
    O'Shea EK, Rutkowski R, Kim PS: Evidence that the leucine zipper is a coiled coil. Science 243: 538–542 (1989).Google Scholar
  24. 24.
    Ptashne M: How eukaryotic transcriptional activators work. Nature 335: 683–689 (1988).Google Scholar
  25. 25.
    Phillips AL, Huttly AK: Cloning of two gibberellin-regulated cDNAs from Arabidopsis thaliana by subtractive hybridisation: expression of the tonoplast water channel, γ-TIP, is increased by GA3. Plant Mol Biol 24: 603–615 (1994).Google Scholar
  26. 26.
    Rogers JC, Rogers SW: Definition and functional implications of gibberellin and abscisic acid cis-acting hormone response complexes. Plant Cell 4: 1443–1451 (1992).Google Scholar
  27. 27.
    Rogers JC, Lanahan MB, Rogers SW: The cis-acting gibberellin response complex in high-pI α-amylase gene promoters. Plant Physiol 105: 151–158 (1994).Google Scholar
  28. 28.
    Rushton PJ, Hooley R, Lazarus CM: Aleurone nuclear proteins bind to similar elements in the promoter regions of two gibberellin-regulated α-amylase genes. Plant Mol Biol 19: 891–901 (1992).Google Scholar
  29. 29.
    Sambrook J, Fritsch EF, Maniatis T: Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989).Google Scholar
  30. 30.
    Sanger F, Nicklen S, Coulsen AR: DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463–5467 (1977).Google Scholar
  31. 31.
    Schindler U, Beckmann H, Cashmore AR: HAT3.1, a novel Arabidopsis homeodomain protein containing a conserved cysteine-rich region. Plant J 4: 137–150 (1993).Google Scholar
  32. 32.
    Schmidt K, Burr FA, Aukerman MJ, Burr B: Maize regulatory gene opaque-2 encodes a protein with a ‘leucinezipper’ motif that binds to zein DNA. Proc Natl Acad Sci USA 87: 46–50 (1990).Google Scholar
  33. 33.
    Singh H, Lebowitz JH, Baldwin ASJr, Sharp PA: Molecular cloning of an enhancer binding protein: isolation by screening of an expression library with a recognition site DNA. Cell 52: 415–423 (1988).Google Scholar
  34. 34.
    Singh K, Dennis ES, Ellis JG, Llewellyn DJ, Tokuhisa JG, Wahleithner JA, Peacock WJ: OCSBF-1, a maize Ocs enhancer binding factor: Isolation and expression during development. Plant Cell 2: 891–903 (1990).Google Scholar
  35. 35.
    Skriver K, Olsen FL, Rogers JC, Mundy J: Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proc Natl Acad Sci USA 88: 7266–7270 (1991).Google Scholar
  36. 36.
    Struhl K: Helix-turn-helix, zinc finger, and leucine-zipper motifs for eukaryotic transcriptional regulatory proteins. Trends Biochem Sci 14: 137–140 (1989).Google Scholar
  37. 37.
    Sutliff TD, Lanahan MB, Ho T-HD: Gibberellin treatment stimulates nuclear factor binding to the gibberellin response complex in a barley α-amylase promoter. Plant Cell 5: 1681–1692 (1993).Google Scholar
  38. 38.
    Takatsuji H, Mori M, Benfey PN, Ren L, Chua N-H: Characterisation of a zinc finger DNA-binding protein expressed specifically in Petunia petals and seedlings. EMBO J 11: 241–249 (1992).Google Scholar
  39. 39.
    Takatsuji H, Nakamura N, Katsumoto Y: A new family of zinc finger proteins in Petunia: structure, DNA sequence recognition, anf floral organ-specific expression. Plant Cell 6: 947–958 (1994).Google Scholar
  40. 40.
    Tanida I, Kim K-J, Wu R: Functional dissection of a rice high-PI α-amylase gene promoter. Mol Gen Genet 244: 127–134 (1994).Google Scholar
  41. 41.
    Thomas PS: Hybridisation of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc Natl Acad Sci USA 77: 5201–5205 (1980).Google Scholar
  42. 42.
    Travers A: DNA-Protein Interactions. Chapman and Hall, London (1993).Google Scholar
  43. 43.
    Tregear JW, Primavesi LF, Huttly AK: Functional analysis of linker insertions and point mutations in the α-Amy2/54 GA-regulated promoter. Plant Mol Biol in press.Google Scholar
  44. 44.
    Vallee BL, Coleman JE, Auld DS: Zinc fingers, zinc clusters and zinc twists in DNA-binding protein domains. Proc Natl Acad Sci USA 88: 999–1003 (1991).Google Scholar
  45. 45.
    van Heeckeren WJ, Sellers JW, Struhl K: Role of the conserved leucines in the leucine zipper dimerization motif of yeast GCN4. Nucl Acids Res 20: 3721–3724 (1992).Google Scholar
  46. 46.
    Vinson CR, Lamarco KL, Johnson PF, Landschutz WH, McKnight SL: In situ detection of sequence-specific DNA-binding activity specified by a recombinant bacteriophage. Genes Devel 2: 801–806 (1988).Google Scholar
  47. 47.
    von Arnim AG, Deng X-W: Ring finger motif of Arabidopsis thaliana COP1 defines a new class of zinc-binding domain. J Biol Chem 268: 19626–19631 (1993).Google Scholar
  48. 48.
    Weisshaar B, Armstrong GA, Block A, da Costa e Silva O, Hahlbrock K: Light-inducible and constitutively expressed DNA-binding proteins recognizing a plant promoter element with functional relevance in light responsiveness. EMBO J 10: 1777–1786 (1991).Google Scholar
  49. 49.
    Winicov I: cDNA encoding putative zinc finger motifs from salt-tolerant alfalfa (Medicago sativa L.) cells. Plant Physiol 102: 681–682 (1993).Google Scholar
  50. 50.
    Zwar JA, Hooley R: Hormonal regulation of α-amylase gene transcription in wild oat (Avena fatua L.) aleurone protoplasts. Plant Physiol 80: 459–463 (1986).Google Scholar

Copyright information

© Kluwer Academic Publishers 1995

Authors and Affiliations

  • Paul J. Rushton
    • 1
  • Heather Macdonald
    • 2
  • Alison K. Huttly
    • 1
  • Colin M. Lazarus
    • 2
  • Richard Hooley
    • 1
  1. 1.IACR-Long Ashton Research Station, Department of Agricultural SciencesUniversity of BristolBristolUK
  2. 2.School of Biological SciencesUniversity of BristolBristolUK
  3. 3.Max-Planck-Institut für ZüchtungsforschungAbteilung BiochemieKöln 30Germany

Personalised recommendations