1 Background

Known plant extracts that potentially reduce the risk of illnesses have been added to foods and supplements to promote vitality aside from intentions to increase product marketability [1]. Herbs, classified as “beneficial” plant extracts could enhance the use of foods, cosmetics, drinks, or personal care products [2, 3]. Herbs from the tropical region such as Eurycoma longifolia (E. longifolia) known as Tongkat ali, Labisia pumila (L. pumila) known as Kacip fatimah, and Ortosiphon stamineus (O. stamineus) known as Misai kucing are considered botanical labels for good health [4]. However, the diverse availability of products and price range raises questions about the authenticity of the ingredients (especially plant components or extracts) in supply chains [5].

In the age of the fourth industrial revolution, necessities fuelled the generation, innovation, and research on dietary supplements [6]. Swift solutions through adulteration are promising to overcome resource shortages aside from the incremental revision in supply pricing [7]. Therefore, irresponsibility (label switching) could begin with the plant or extract itself either from the cultists, suppliers, or during production [6]. Herbal ingredients circulate as powders, dried materials, pills, capsules, and tea bags after being cleaned, dried, or minced and in this form, the source plant could not be directly identified [8, 9]. The use of traditional methods such as microscopy, spectrometry, and thin-layer chromatography has been introduced to identify the source plant in a crude [10]. However after modern processing techniques that alter the chemistry and biochemical profiles for long-term storage, the traditional identification means by morphological and microscopic identification seems irrelevant [11]. Similarly, methods that compare biochemical profiles with chemical standards are challenged by noise due to cultivation methods [7, 12].

Admixture can occur through several deliberate and accidental practices, such as blatant and obvious adulteration, typically done for benefit due to a lack of adequate quality control steps [13]. These practices are common in plant species that are in low supply but have great demand [14, 15]. If left uncontrolled, adulteration can severely impact the reputation of the place of origin and the export trade of medicinal plants in question [14]. Despite this, accidental contamination of herbal products can happen due to misidentification, confusion, or the use of vernacular names, underscoring the need for more care to assure purity and authenticity [16]. Misidentification of plant species is fairly common as macroscopic in the form of morphological identification of plant species is confusing and requires the expertise of a qualified specialist [9, 17]. Furthermore, it may be challenging to identify extracted natural product materials to the species level using morphology as the product is in processed form [18, 19].

Several genetic methods have been explored to enhance species recognition and move beyond the bounds of morphological identifications. With the help of molecular methods like the polymerase chain reaction (PCR), it is now possible to distinguish between different species based on their genetic information [20]. polymerase chain reaction–restriction fragment length polymorphism (PCR–RFLP) is a method for generating polymorphic pieces that can be used as identifiers for identifying species by relying on the digestion of PCR amplicons with the appropriate restriction enzymes [21]. Following this, restriction enzymes are used to cleave the amplified DNA fragments at precise locations [22]. The generated fragments are size-separated by gel electrophoresis, and the pattern of the created fragments is compared with reference patterns to either identify the species or discover variations within the species [22]. PCR—RFLP has been utilised in various investigations to identify and authenticate herbal products. PCR–RFLP was used in various investigations to identify the species of Ginkgo biloba, Panax ginseng, and Echinacea purpurea in herbal products [23, 24].

In light of the absence of standardised quality assessment techniques and the fierce competition within the herbal product market, there is an increasing drive to employ undisclosed fillers and substitutes [16]. To address this issue, DNA molecular diagnostics has emerged as a powerful tool for ongoing market analysis [25]. Thus, this study aimed to develop a straightforward, dependable, and precise PCR–RFLP DNA molecular method to supervise E. longifolia, L. pumila, and O. stamineus herbal products, guaranteeing consumer health and efficacy without resorting to time-consuming and expensive DNA sequencing. Ultimately, the goal of this PCR–RFLP authentication method is to verify the presence of E. longifolia, L. pumila, and O. stamineus in herbal products, ensuring their integrity.

2 Methods

2.1 Plant samples and herbal products samples collection

The fresh leaves of three plant species, E. longifolia, L. pumila, and O. stamineus were obtained from a local nursery in Shah Alam and the botanical gardens in Seri Kembangan, Selangor, Malaysia. Morphologica confirmation and species labelling were conducted with the help of local expert taxonomists. The voucher specimen from each collections were deposited in the herbarium of the Universiti Pendidikan Sultan Idris (UPSI), Perak Malaysia. To prevent DNA degradation, a twig of leaves was placed in a zip lock bag, transported back to the laboratory, and kept in the −20°C freezer for further analysis.

In the present study, 106 herbal products were successfully acquired from different retail stores, pharmaceutical companies, and e-commerce in Malaysia. Product samples were collected according to accessibility, ensuring the most comprehensive range possible covering different parts of Malaysia. The product was in the form that includes (62 powders, four pastes, 16 liquids, four pills, nine capsules, and 11 teabags) (Table 1) representing three plant species: E. longifolia, L. pumila and O. stamineus. An overview of the products was listed according to the front of their pack name, the name presented in the list of ingredients containing the target species, E. longifolia, L. pumila, and O. stamineus, and their product form. To retain sample identification and prevent sample mixing between the time of collection and DNA sequencing, each sample was assigned a coded number.

Table 1 Herbal products used in this study

2.2 DNA extraction

Approximately ~ 300 mg of each plant specimen was subjected to total genomic DNA (tgDNA) extraction using the Nucleospin Plant II Kit (Macherey–Nagel™, Düren, Germany), following minor modifications to the manufacturer's instructions. Likewise, approximately ~ 200 mg of each herbal product underwent extraction using the Nucleospin® Food kit (Macherey–Nagel), with slight adjustments to the manufacturer's guidelines. The quality of the extracted gDNA from both the plant specimens and herbal products was assessed using 1% agarose gel electrophoresis, incorporating GelRed as the gel stain. Subsequently, the obtained genomic data were utilised for PCR amplification.

2.3 ITS2 Barcode amplification

Internal transcribed spacer 2 (ITS2) non-coding region DNA was amplified with 10 µM primer ITS2_F: GGGGCGGATATTGGCCTCCCCTTGC and primer ITS2_R: GACGCTTCTCCAGACTACAAT [26]. PCR reactions were carried out with an Applied Biosystems Thermal Cycler, in a total volume of 50 µl reaction mixtures containing 25 µl of Green Taq Mix, 0.5 µl of 10 µM bovine serum albumin (BSA), and 2.5 µl of DNA template. Thermal cycling was performed under the following conditions: initial denaturation at 95 °C for 2 min, then 30 cycles of denaturation at 95 °C for 1 min, annealing at 56 °C for 15 s, extension at 72 °C for 1 min, and finally elongation at 72 °C for 5 min. The PCR products were visualised on 2% agarose gel electrophoresis. Fragment sizes were estimated using a 50 bp and 100 bp [27] size ladder (GeneDirex, Inc, Taiwan). The amplicons that were successfully obtained were forwarded to Apical Scientific Sdn Bhd in Malaysia for sequencing.

2.4 Product identification and analysis

The acquired sequences were manually modified in MEGA 11 and used as a query sequence in NCBI to identify the closest match with a minimum cut-off of 97% to the GenBank nucleotide database. For identifying each DNA sequence obtained from this investigation, the NCBI Basic Local Alignment Search Tool (BLAST) search (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used.

2.5 Restriction analysis of the PCR products

Seven restriction enzymes (TaqI, BamHI, HinfI, EcoRI, EcoRV, Mbol, and Mspl) were used to analyse the PCR-amplified ITS2 region products. NEBcutter V2.0 web server [28] was used to predict potential restriction sites by performing restriction mapping on the ITS2 sequences. The 20 l reaction volume used for the digesting procedure contained 15 l of ddH2O, 2 l of PCR products, 1 l of restriction enzymes, and 2 l of enzyme buffers. The digestions were conducted at 37 °C for an hour, as instructed by the manufacturer. Using a 50 bp DNA ladder from GeneDirex, Inc., Taiwan, and 1 × Tris–Borate-EDTA buffer (TBE buffer), the resultant DNA fragments were separated by electrophoresis on 2% agarose gels stained with GelRed nucleic acid gel stain.

2.6 Application of the PCR–RFLP on herbal products

To confirm the existing methodologies, 106 bought herbal products were verified using the recognised PCR–RFLP and diagnostic PCR systems, utilising the methods outlined above. The ITS2 barcode region of these samples was sequenced and analysed with the barcode of life data system (BOLD) identification search engine. The BOLD retrieval findings were used to validate the efficiency of the developed approaches. Furthermore, for the identification of these samples, DNA barcoding was used.

3 Results

3.1 Species sequence identification for plant species

DNA barcoding was employed successfully to achieve accurate identification (100%), with the high percentage sequence identification obtained for O. stamineus, L. pumila, and E. longifolia using ITS2 (Table 2), a single PCR product about 316, 315, and 315 bp was amplified (Fig. 1).

Table 2 Species sequences identification using GenBank
Fig. 1
figure 1

Agarose gel electrophoresis of PCR results from leaves of E. longifolia (EL), L. pumila and O. stamineus (OS), negative control (–C), and 100 bp DNA ladder (L)

For certain plants, like E. longifolia, L. pumila, and O. stamineus, their ITS2 reference sequence database was found to be insufficient as only a handful of sequences were based upon ITS2. BLAST query top scores show the number of sequences that were of high similarity with studied sample sequence, i.e. four samples for E. longifolia, five samples for L. pumila, and six samples for O. stamineus (Table 3).

Table 3 Result of GenBank ITS2 reference sequence that deposited for identification of E. longifolia, L. pumila and O. stamineus

3.2 Identification results of herbal products

DNA extraction only successfully extracted from 60out of 106 tested herbal products (56.6%). Successful PCR product shows a relatively higher chance of using ITS2 region which amplified 50 herbal products (47.16%). The following Fig. 2 shows a successful PCR product using ITS2 DNA barcoding.

Fig. 2
figure 2

Agarose gel electrophoresis of successful PCR results from the herbal product and 50 bp DNA ladder (L)

The herbal product sequences were queried in GenBank using BLAST, with the highest sequence similarity amongst samples, and the most likely related species are presented in Table 4. Under optimised conditions, a single, distinct, and brightly resolved band of range with minimum read length was 177 bp with a maximum of 479 bp for 50 of the tested herbal products (Table 4), remaining 10 samples of amplifiable DNA of samples were designated as “No sequence” and were not considered for further analysis.

Table 4 Identification results of herbal product based on ITS2 GenBank BLAST

Forty-six out of 106 (43.4%) of the tested herbal products did not produce amplicons even after repeated attempts. The recovery of genomic DNA from degraded samples of herbal products was insufficient, making it challenging to amplify DNA barcodes from samples.

3.3 Authentication of the herbal products

The species identification and their authenticity are summarised in Table 5, which result shows 15.09% of the products were considered as authentic, whereas 39.62% of the herbal products were considered substituted, and 52.83% of the herbal products were unable to be identified..

Table 5 DNA barcoding for the authenticity of 50 amplified herbal products

The identity of sequencing recovered from the products was determined according to Shanmughanandhan [25], Tnah [29]. If a sequence matched the species and was present on the label of the products, these herbal products were declared as “Authentic". The herbal products were declared "Substituted" if additional identification species other than those listed on the herbal products were discovered with species identified for the primary component. Finally, the herbal product is labelled as “no sequence” (NS) if the sequence could not be extracted from the examined herbal products [25, 30].

Identification analysis shows that out of 42 herbal products are substitution by other plant species and no detection of contamination of plant species (Table 5). The identity of other plant taxa in substitution of the product's primary listed ingredient on the label, which was not detected in the sample, was the criteria utilised to determine product substitution. Nehal [31] has highlighted that labels alone may not be sufficient to be aware of the precise components or content of a product because of the risk of illegal substitutions, which can harm not only the image of the manufacturer but also the well-being of the consumer.

Sequence identification from HMP124, HMP125, HMP92, and HMP98 was revealed to contain Anethum foeniculum (A. Foeniculum), confirming substitution. A. foeniculum (synonym as Foeniculum vulgare) is used for managing female sterility and for its antiseptic, palliative, and anti-inflammatory properties in traditional medicine. The content of HMP127 and HMP118 is believed to have been substituted with Anethum graveolens (A. graveolens). A. graveolens is suggested for the management of diabetic patients [32]. HMP101 was revealed to contain substituted Hordeum vulgare. H. vulgare is a species of cereal plant, and is used for medicinal and therapeutic purposes.

Sequence identification of HMP18, HMP19, and HMP67 revealed to contain Coriandrum sativum (C. sativum), which is identified as authentic as presented on the labelling. Meanwhile, HMP46, HMP60, HMP87, and HMP88 are thought to have been replaced by C. sativum. C. sativum is most widely used for seasoning, but it is also well recognised for its antioxidant, antidiabetic, antimutagenic, antianxiety, and antibacterial action, which promotes a variety of health advantages [33].

Furthermore, HMP109 was revealed to contain substituted Deverra tortuosa (D. tortuosa). D. tortuosa is popularly used to treat conditions that are prevalent in Saudi Arabia, such as fever, hepatitis, diabetes, stomachache, rheumatism, and asthma. [34]. HMP05 was revealed to contain substituted Pedicularis lachnoglossa (P. lachnoglossa). Pedicularis species are appealing as ornamental and melliferous plants, and they also have great therapeutic potential, displaying antiphlogistic, antipyretic, detoxication, diuretic, choleretic, antibacterial, and antioxidant properties [35]. Next, the ingredient of HMP139 is believed to have been substituted with Salacia menglaensis (S. menglaensis). S. menglaensis is known as new species from China [36], but a number of Salacia species' roots and stems have been used in traditional medicine to cure conditions such as diabetes, arthritic conditions diarrhoea, and skin diseases [37].

Sequences identification for HMP01, HMP02, HMP13, HMP15, HMP16, HMP17, HMP21, HMP22, HMP26, HMP27, HMP32, HMP33, HMP39, HMP40, HMP41, HMP42, HMP43, HMP44, HMP45, HMP53, HMP61, HMP79, HMP116, HMP135, HMP136, and HMP137 was revealed to contain with substituted Orthosiphon stamineus. Sequence analysis from HMP14, HMP24, HMP38, HMP78, and HMP52 was revealed to contain Orthosiphon stamineus, confirming authenticity as it presented on the labelling. O. stamineus has been known used as traditional medicine for diuretics and treating catarrh of the bladder [38]. Lastly, HMP140 and HMP142 contents were substituted with Orthosiphon aristatus. O. aristatus is a synonym to O. stamineus.

From this identification of the species, findings imply that manufacturers committed misleading and deceptive conduct by adding inferior species. There are several possible explanations for the presence of non-listed species but not restricted to intentional adulteration and accidental substitution, which can occur at any point in the medicinal plant supply chain, from initial cultivation and storage to final product packaging and distribution [40]. The substitution of those plant species may have contributed to medicinal value but may pose serious health risks, as the efficiency of the substituted plant species compound with the other species cannot be determined. Moreover, the finding shows that a parasite was found in the herbal product, thus indicating the need to follow a quality standard protocol during the manufacturing process.

3.4 Restriction enzyme digestion

Seven restriction enzymes were used to digest the PCR-amplified products of the ITS2 region: TaqI, BamH I, Hinfl, EcoRI, EcoRV, Mbol, and Mspl. Restriction fragments after digestion of the ITS2 region are shown in Fig. 3. Amplified fragment was subjected to restriction digests and the products ranged from 50 to 300 bp. Restriction profiles for each plant species, E. longifolia, O. stamineus, and L. pumila exhibited by enzyme EcoRI, EcoRV, and BamHI, failed to yield fragments; hence, this restriction enzyme has been ruled out from further analysis. MboI, TaqI, MspI, and HinfI digestion profiles and in silico prediction are summarised in Table 6.

Fig. 3
figure 3

Restriction fragment patterns of the PCR-amplified ITS2 region of E. longifolia (EL), L. pumila, and O. stamineus (OS) species on a 2% agarose gel. L1: 100 bp, L2: 100 bp DNA ladder, RE1: EcoRI, RE2: EcoRV, RE3: BamHI, RE4: HinfI, RE5: Mspl, RE6: Taql,and RE7: Mbol

Table 6 The fragment size (bps) by in silico restrictions predictions and restriction profiles exhibited by these enzymes MboI, TaqI, MspI, HinfI, EcoRI, EcoRV, and BamHI on plant species specimen

The resultant fragment after digestion is equal in quantity; hence, the band brightness is lesser as the shorter the fragment is. It should be noted that the fragment's weak bands are compatible with the expectations. Thus, the result shows certain restriction enzymes with PCR product has resulted in incomplete digestion and may be due to unsuitability.

3.5 Application of the PCR–RFLP assay for identification of herbal products derived from O. stamineus, E. longifolia, and L pumila

To determine the plant origins of the herbal products, the established PCR–RFLP assay was used. Based on the species identification of herbal products, only 32 herbal products have a high identification of O. stamineus. Figure 4 shows the agarose gel profile on a 2% agarose gel for fragments of PCR product of 32 samples corresponding to fragments of O. stamineus. The PCR–RFLP assay results of all samples show restriction profiles for herbal products using MboI digestion (Fig. 5). The resulting fragments are in a faint band since the herbal product was highly degraded DNA.

Fig. 4
figure 4

Agarose gel profile on a 2% agarose gel of PCR products herbal products identification to be O. stamineus (codes listed in material and method), showing the resulting fragments. L: 50 bp DNA ladder

Fig. 5
figure 5

Agarose gel profile on a 2% agarose gel of PCR products herbal products identification to be O. stamineus (codes listed in material and method), after digestion with Mbol, showing the resulting fragments. L: 50 bp DNA ladder

4 Discussion

This study revealed successful DNA barcoding identification for E. longifolia, L. pumila, and O. stamineus using ITS2 barcode region. The ITS2 region may be amongst the most promising standard DNA barcodes for identifying medicinal plants, according to an earlier study by Chen et al. [41]. The highest success rates for species identification were 78% and 100% at the species and genus levels, respectively, according to colleagues [34] who looked at the ITS2 locus for closely related species in several Rosaceae species [42]. The study also demonstrated that the use of ITS2 is particularly effective in the detection of adulterants or substitutes including species that are difficult to tell apart based on their morphological and/or phytochemical similarities.

Highlighting the importance of a good barcode pattern, Hou [43] emphasised that effective barcodes should exhibit high interspecific divergence and low intraspecific variability. Hence, the effectiveness of a barcode depends on its ability to differentiate between closely related species, an accomplishment that can only be accomplished when the genetic dissimilarity between species is significantly greater than the genetic similarity within a single species [55]. Research showed that the rhubarb species' intraspecific variation in the ITS2 region was surprisingly minimal, measuring just 0.0036, both within and between the species. This discovery offers a substantial benefit for precisely identifying herbal products and plant species, verifying their validity, and separating them from adulterants. A significant downside is the high interspecific divergence of 0.0970 found between officinal rhubarb and its adulterants, which may make the identification and authentication procedure more difficult. [44]. The results of this study have demonstrated that there is genetic differentiation between the three species of E. longifolia, L. pumila, and O. stamineus, with the intraspecific genetic distance between each species being only 0.00 and the interspecific genetic distance between the three species being 0.32. This outcome has established ITS2 as a useful barcode. A previous study has pointed out that prominent factors for characterising a suitable barcode include the intraspecific and interspecific divergence that has been explicitly mentioned. The finding has summaries that when comparing averages across species, interspecific variation in barcodes was found to be greater than intraspecific variation. Furthermore, the ITS region had the highest rate of correct identifications using the closest distance approach, followed by the ITS2 area, psbA-trnH, matK, and rbcL regions [45]. A BLAST search was performed against GenBank databases which have been employed in identifying all query sequences. Samples acquired from the raw market were authenticated using the best-match method. The BOLD and NCBI nucleotide databases were searched using BLAST to analyse the unmatched specimens. This study made it possible to identify accurate matches for both unambiguous and ambiguous. One of the most prevalent causes of incorrect identifications was that the species in question was either not included in the reference library, or there was insufficient variation in the sequences being compared [46].

Species identifications are crucial in these situations, but the analysis is frequently hampered by an absence of taxonomic specialists. As a result, there is growing interest in using DNA-based methods to identify species [47]. Our study proposes that it would be beneficial to create a Barcode REF library with a carefully curated set of verified entries for each species to improve BOLD's capacity to offer accurate identifications. To effectively match unidentified query sequences and facilitate accurate species-level identification, it is imperative to develop a thorough and reliable reference sequence database [48].

The development of DNA-based identification systems would benefit from the availability of sequence information that is readily available in public databases. The GenBank entries in this study need to be submitted and to be used as supplemental material for publication. However, many medicinal plant species are still absent from the BOLD index, and many of the medicinal species do not have full coverage of numerous barcode regions, especially ITS2 [49]. A study by Bell [50] has found that since they have successfully established a repository for ITS2 and rbcL in combination, most species in the mixtures could be distinguished. [50].

The study's findings show that manufacturers' mislabelling of herbal products and incorrectly labelled sequences submitted to GenBank are realistic variables to examine. Howard [49] recognised the occurrence of mislabelled sequences and emphasised the disadvantages associated with the amount of publicly available sequence information, which impedes the improvement of DNA-based identification systems. As a result, relying merely on the top BLAST result for species verification is no longer sufficient; users need to develop particular criteria for accepting sequences obtained from databases to assure their legitimacy. As a result, it is critical to have the original data in order to evaluate and replicate the analysis described in the paper. To address comparable concerns, the current study emphasises the importance of increasing data contributions to these database systems [49].

The amplification of the expected length ITS2 region was effective in comparison with fresh plant DNA due to the mostly intact genomic DNA. This was not the case with herbal products. Only 61 (60.4%) of the 101 herbal products examined produced amplifiable DNA. Despite several tries, the remaining 40 products (39.6%) failed to yield amplifiable DNA. This lack of amplification could be linked to DNA degradation during manufacturing procedures. According to Abubakar and colleagues [2], in processed goods, DNA is subjected to heat, physical, and chemical treatments, which frequently results in DNA disintegration, in order to extract bioactive components from herbal plants. Market herbs' harvesting, processing, and storage all contributed to DNA degradation and made it difficult to extract intact DNA. These factors are all probable sources of DNA degradation, according to Han and colleagues [16]. On the other hand, using conserved primers, the ITS2 region may be amplified and sequenced quickly [51].

The decreased extraction success rates seen in this study for market samples are not surprising, given that herbalists often do not prioritise approaches that improve DNA preservation in their plant product handling. It has been claimed that the material containing cells containing DNA is frequently destroyed during the extraction procedure, leaving only the phytochemical components. As a result, any remaining DNA in plant extracts is typically of poor quality and quantity. This is because of the high concentration of secondary metabolites such as polysaccharides, phenolic compounds, and other proteins, which may interfere with DNA extraction and preservation [52, 53], this has hindered high-quality DNA extraction suggested that the only possible.

In order to solve this problem, our study's findings suggest that the presence of many short DNA fragments may be a factor in certain samples' inability to be amplified, possibly as a result of the primer used in this study's use not being uniformly effective for amplifying all species. Sequences must be able to distinguish between species at the genus and species levels and be simple to amplify in order to function as DNA barcodes [54]. As suitable DNA barcodes for amplification, we used ITS2, rbcL-1, rbcL-2, matK, and psbA-trnH. However, the rbcL sequence is longer than the ITS2 sequence, and recovering full DNA from herbal products is difficult owing to DNA loss during processing and storage. As a result, this study concentrated on using the ITS2 region to differentiate between E. longifolia, L. pumila, and O. stamineus, as well as validating species identification in both fresh specimens and herbal products. Previous research has shown that the ITS2 region is suitable for the amplification and identification of these species [26, 30, 55].

Using the ITS2 sequence information of E. longifolia, O. stamineus, and L. pumila, a simple PCR–RFLP approach was used to develop a quick, simple, and dependable method for identifying these plant species [21]. Because it only takes a single unique site between the primers to identify the target species from others, PCR–RFLP is a powerful method of testing. This process is straightforward and affordable, making it a good option for identifying different species.

According to Diguta and colleagues [56], the PCR–RFLP approach is effective in differentiating various species of genera like Alternaria, CladosporiumBotrytis, FusariumPilidiellaEpicoccum, and Thanatephorus. The researchers distinguished these fungi effectively by using the endonucleases SduI and HaeIII. In addition, the researchers discovered that this method may be used with a variety of samples and provides routine, sensitive, and reliable identification in contrast to conventional morphological identification techniques. In this work, it was discovered that using just one restriction enzyme was enough to identify the species and produce a molecular diagnostic profile. This strategy is consistent with a prior work by Sarin and colleagues that made use of a related technique and demonstrated the capacity to accurately identify three Phyllanthus species (P. amarus, P. fraternus, and P. urinaria) that had comparable morphological characteristics [57]. Additionally, this method was used to successfully identify a subset of 32 herbal items as O. stamineus. It is important to note that all digested fragments produced during the PCR–RFLP experiment have equimolar ratios. Shorter fragments have lesser band intensity; hence, the brightness of the bands is proportional to fragment length [37]. Fragments that were very faintly evident in the findings showed that the herbal items had degraded. These barely discernible bands were notable because they agreed with the theoretical predictions, demonstrating the accuracy of the PCR–RFLP approach in identifying O. stamineus [58].

5 Conclusion

In the current work, we have shown that the in vitro digestion of PCR amplicons using digestive enzymes and passing the samples via gel electrophoresis make up the entirety of the sample processing time in the developed ITS2 barcode-based PCR–RFLP technique. While the majority of enzymes take 60 min to digest, others, like HinfI, only need 30. In this investigation, we prolonged the incubation period by an extra day (about 16 h), as per the manufacturer's recommendations. It is important to keep in mind that PCR–RFLP may appear to be a slower procedure in some circumstances due to its prolonged incubation duration with endonucleases. Because various recombinant DNA manufacturing methods are used by different producers, there can be substantial variance in the kind and quality of synthesised enzymes. Therefore, although having comparable recognition sequences, restriction enzymes from two distinct providers may vary in terms of cost, shelf life, transit conditions, digestive efficiency, incubation length, and other aspects. To authenticate O. stamineus, L. pumila, and E. longifolia, we have created a reliable ITS2 barcode-based PCR–RFLP approach. These methods create a thorough system for the authentication and identification of these plant species when paired with DNA barcoding technology and macroscopic identification.