Abstract
Background
Increasing evidence indicates that microRNAs (miRNAs) are involved in inflammatory response and immune regulation following pathogen invasion. The purpose of this study was to elucidate the roles played by Gallus gallus microRNA-1306-5p (gga-miR-1306-5p) in host responses against potential invasion by Salmonella enteritidis (SE) in chickens and the underlying mechanisms.
Results
In present study, the expression levels of gga-miR-1306-5p were determined in both tissues and HD11 cells. The results showed that gga-miR-1306-5p was significantly increased following SE infection or lipopolysaccharide (LPS) stimulation. The dual luciferase reporter assay further validated that gga-miR-1306-5p targeted the Toll-interacting protein (Tollip), and thereby participated in the regulation of immune response against SE or LPS stimulation through binding with the 3′-untranslated region (3’UTR) of Tollip. Additionally, the expression of Tollip was significantly blocked by over-expressed gga-miR-1306-5p. The underlying mechanisms by which gga-miR-1306-5p modulated the production of pro-inflammatory cytokines were also investigated. Molecular biological assays demonstrated that overexpression of gga-miR-1306-5p promoted the production of pro-inflammatory mediators, including NF-κB, TNF-α, IL-6, and IL-1β, which produced effects similar to those of Tollip knockdown.
Conclusions
Taken together, gga-miR-1306-5p induced by SE or LPS, regulates the immune response by inhibiting Tollip, which activates the production of inflammatory cytokines. This study has provided the first direct evidence that gga-miR-1306-5p targets Tollip, and is involved in the host response against SE.
Similar content being viewed by others
Background
Salmonella enteritidis (SE) is currently the only Salmonella serotype that frequently causes human illness via meat or egg contamination [1]. The on-farm environment of chickens is a rich source of multiple Salmonella serotypes, which can pose a severe threat to food safety [2]. Although SE contamination can be effectively controlled through various measures in the poultry industry, the number of reported SE cases continues to increase [3]. Additionally, the resistance of SE to multiple antimicrobial agents has been a great challenge in the treatment of animal and human diseases [4]. Therefore, it is necessary to develop novel preventive and therapeutic strategies for SE infection.
Innate immunity is the first line of host defense barriers against invading infectious pathogens [5]. The recognition of microbial pathogens is an essential step in activation of the host innate immune response, which relies on several kinds of germline-encoded pattern recognition receptors (PRRs) [6]. Toll-like receptors (TLRs) are the most extensively studied PRRs and crucial players required for hosts to eliminate invading microbial pathogens [7, 8]. The Toll interacting protein (Tollip), a TLR-associated signaling protein, is an endogenous regulator in the TLR signaling pathway [9]. Increasing evidence suggests that Tollip is required to maintain immune homeostasis and control the MyD88-dependent NF-κB activation pathway during inflammation by suppressing IRAK-1 activity, confirming a modulatory role of Tollip in the immune response [10].
miRNAs are a group of small non-coding RNA molecules (18–25 nucleotides in length), that regulate a variety of biological processes by reducing gene expression at the post-transcriptional level [11]. As reported previously, up to 60% of all protein-coding genes have been predicted to be regulated by miRNAs to a certain extent [12]. Furthermore, miRNAs induce mRNA degradation or repress protein translation mainly through binding to the 3′-untranslated region (3′UTR) of target mRNAs [13]. Compelling evidence based on data analyses and experimental verification reveals that miRNAs not only regulate protein-encoding genes, but are also closely correlated with increasing complexity in multi-cellular organisms [14]. Therefore, these small RNAs have been demonstrated to play critical roles in diverse biological processes, including the cell cycle, proliferation and differentiation, apoptosis, and pathogenesis [15]. Moreover, studies have reported that miRNAs have important functions in regulating the innate immune response induced by bacteria [16, 17]. Presently, an array of miRNAs have been researched in the regulation of TLR pathways at different levels, including regulation of TLR expression, TLR-associated signaling proteins, TLR-induced transcription factors, and the production of functional cytokines [18].
In present study, our data show that Gallus gallus microRNA-1306-5p (gga-miR-1306-5p) was increased not only in various tissues following SE infection but also in HD11 cells stimulated by lipopolysaccharide (LPS). A subsequent molecular study confirmed that gga-miR-1306-5p targeted Tollip, and the highly expressed gga-miR-1306-5p significantly blocked the expression of Tollip. Furthermore, overexpression of gga-miR-1306-5p upregulated the release of pro-inflammatory mediators, including nuclear factor kappaB (NF-κB), tumor necrosis factor (TNF-α), interleukin (IL)-6, and IL-1β, which ultimately produced effects similar to those of Tollip silence. Taken together, gga-miR-1306-5p induced by SE or LPS, regulates the immune response by inhibiting Tollip, which activates the production of inflammatory cytokines. Our data provide valuable information on the roles of miRNAs during the development of SE infection, as well as new insight into the defense mechanisms of the innate signaling pathway in chickens.
Methods
Sampling and challenge
Specific-pathogen-free white leghorn chickens were obtained from the Beijing Laboratory Animal Research Center (Beijing, China) and were raised in climate-controlled, fully enclosed isolation facilities at the experimental center of China Agricultural University (Beijing, China) under identical management conditions. These healthy chickens were randomly divided into two groups for the stimulation experiment. The experimental group was orally challenged with 1 mL PBS containing 108 CFU of SE and the other group was correspondingly challenged with 1 mL PBS as the control. The chickens were respectively killed at 0, 12, 48, and 72 h after treatment, and tissues (spleen, caecum, cecal tonsil, and bursa fabricius) were dissected, snap-frozen and preserved at − 80 °C for later use.
Cell culture and LPS exposure
HD11 cells were grown at 37 °C and 5% CO2 in RPMI-1640 medium containing 10 mmol/L HEPES, 1 mmol/L sodium pyruvate, 1% glutamine, 1% MEM NEAA, 10% fetal bovine serum, and 5% chicken serum (Gibco, USA). HEK293 cells were cultured in DMEM high-glucose medium (HyClone, USA) containing 10% fetal bovine serum under 5% CO2 and 37 °C.
For the LPS exposure, we used the LPS (Sigma, USA) from Salmonella enterica serotype enteritidis to stimulate HD11 cells in vitro. HD11 cells were challenged with 100 ng/mL LPS and harvested at different times (0, 3, 6, 12, and 24 h) for RNA extraction. Non-stimulated HD11 cells were collected as the control, and each experiment had three biological replicates.
Real-time quantitative PCR for miRNA and mRNA
Total RNA was extracted from tissues or HD11 cells using the MiniBEST Universal RNA Extraction Kit (Takara, Japan). RNA was quantified using a NanoDrop ND-2000 spectrophotometer (NanoDrop Products, USA). cDNA for mRNA was synthesized from 100 μg RNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific, USA), and the harvested cDNA was stored at − 20 °C for later use.
Real-time quantitative PCR using SYBR® Premix Ex Taq™ (Takara, Japan) was performed on a QuantStudio™ real-time PCR system (Applied Biosystems, USA). The amplification reaction volume of 12 μL contained 6.0 μL SYBR® Premix Ex Taq™, 1 μL cDNA sample, 0.24 μL ROX Reference Dye, 0.5 μL of each primer (10 mmol/L), and 3.76 μL ddH2O. The thermal cycling conditions were 30 s at 95 °C, followed by 40 cycles of 3 s at 95 °C and 34 s at 60 °C. A dissociation curve was conducted after each assay to determine target specificity. Primers of the target genes were designed with Primer Premier 5 software, and β-actin was used as the reference gene [19].
To synthesize the cDNA for the miRNA analysis and quantify mature gga-miR-1306, the specific stem-loop primer for gga-miR-1306 (GTCGTATCCAGTGCGTGTCGTGGAGTCGGCAATTGCACTGGATACGACACTGGAC) and the 5S rRNA reverse primer were incubated together with the total RNA of each sample, and then reverse transcribed with SuperScript® III Reverse Transcriptase (Invitrogen, USA). The relative miRNA expression level was normalized to 5S rRNA expression.
The primer sequences used for mRNA and miRNA quantification are listed in Table 1. And the primers for TNF-α were referenced from the excellent work by Rohde et al. [20]. The relative mRNA and miRNA expression levels were calculated using the 2−ΔΔCt method [21]. Three independent replications were used for each assay and data are presented as means ± SEM.
Plasmid construction
To construct a Tollip-3′UTR reporter vector, the full length 3′UTR region of Tollip was amplified from cDNA derived from healthy chickens. The PCR products were digested with NotI and XhoI, which were then cloned into the psiCHECK™-2 luciferase reporter vector (Promega, USA). The mutant of Tollip-3′UTR was constructed using the Fast Site-Directed Mutagenesis Kit (Tiangen, China) with specific primers. The putative binding site (TTGC … … GAGGTTGG) for gga-miR-1306-5p was mutated into TTGC … … TATGTTTG. All recombinant plasmids were extracted with the Endotoxin-Free Plasmid DNA Miniprep Kit (Tiangen, China) and confirmed by Sanger sequencing before the dual-luciferase reporter assay.
miRNA mimics and inhibitor
The gga-miR-1306-5p mimics (double-stranded chemically modified RNA oligonucleotides) and inhibitor (single-stranded chemically modified RNA oligonucleotides) obtained from Ribobio (Guangzhou, China) were respectively utilized to over-express or inhibit miRNA activity in cells, respectively. Negative control mimics or negative control inhibitors were transfected as the respective controls. The gga-miR-1306-5p mimic sequences were 5′-ACCACCUCCCCUGCAAACGUCCAGU-3′ (sense), 5′-UGGACGUUUGCAGGGGAGGUGGUUU-3′ (antisense); negative control mimic sequences were 5′-UUCUUCGAACGUGUCACGUTT-3′ (sense), 5′-ACGUGACACGUUCGGAGAATT-3′ (antisense); gga-miR-1306-5p inhibitor sequence was 5′-ACUGGACGUUUGCAGGGGAGGUGGU-3′ and the negative control inhibitor sequence was 5′-CAGUACUUUUGUGUAGUACAA-3′. Transfection for each kind of oligonucleotide in HD11 cells was performed with the TransIT-TKO® reagent (Mirus Bio, USA) in accordance with the manufacturer’s instructions. HD11 cells were seeded into 12-well plates and incubated overnight. The cells were subsequently transfected with 100 nmol/L of each kind of oligonucleotide for 36 h, and then stimulated with LPS for another 3 h.
Target mRNA prediction
To further explore the underlying molecular mechanisms of gga-miR-1306-5p regulating the innate immune response, its downstream targets were predicted by the bioinformatics databases, including Findtar (http://bio.sz.tsinghua.edu.cn) and RNAhybrid (http://bibiserv.techfak.uni-bielefeld.de/rnahybrid/submission.html).
Transient transfection and dual-luciferase reporter assays
To verify the hypothesis that gga-miR-1306-5p targets Tollip, we performed the cotransfections and dual-luciferase reporter assays. Specifically, HEK293 cells were seeded and cultured in 12-well plates. A 100 nmol/L concentration of the miRNA mimics, or controls were co-transfected with the wild-type or mutated Tollip-3′UTR luciferase reporter vector into HEK293 cells to identify the miRNA target. We determined the concentrations of plasmids by Nanodrop 2000 spectrophotometer (Thermo Scientific, USA), and the amount of wild-type or mutant-type Tollip-3′UTR plasmid was about 3 μg. Transient transfections were performed using Lipofectamine 3000™ (Invitrogen, USA) according to the manufacturer’s protocol. The cells were collected after 36 h for the dual-luciferase reporter assay system (Promega, USA) according to the manufacturer’s instructions and the relative luciferase activity value was achieved against the Renilla luciferase control. The results were obtained from three independent experiments performed in triplicate.
RNA interference
The Tollip-specific small interfering RNA (siRNA) sequences were 5′-GGAACAAGAAUGCAGCUAUTT-3′ (sense) and 5′-AUAGCUGCAUUCUUGUUCCTT-3′ (antisense). The Tollip-specific siRNA transfection was performed with TransIT-TKO® reagent (Mirus Bio, USA) in accordance with the manufacturer’s instructions. HD11 cells were first seeded into 12-well plates and incubated overnight. The cells were subsequently transfected with 100 nmol/L siRNA against Tollip or control siRNA for 24 h, and then stimulated with LPS for another 3 h.
Western blotting
After each transfection, HD11 cells were collected and lysed with the RIPA buffer. Proteins were then extracted from the cells. Whereafter, SDS-PAGE was performed with equal amounts of protein, after which the proteins were transferred onto polyvinylidene difluoride membranes in a semidry manner. The membranes were blocked with 5% non-fat milk at room temperature for 1 h, and then incubated with primary antibodies against Tollip (Abcam, UK) or β-actin (Abcam, UK) for 1 h at room temperature. Subsequently, the membranes were incubated with the secondary antibody conjugated with HRP at room temperature for 1 h. At last, the immunoreactive proteins were detected using the Tanon 5200 instrument, and digital imaging was performed with a cold CCD camera.
Statistical analysis
All data are presented as mean ± SEM, and Student’s t-test was applied to compare the difference of means between two groups in the GraphPad Prism 7 software. A P-value < 0.05 was considered as statistically significant.
Results
SE infection significantly promotes gga-miR-1306-5p expression
The expression levels of gga-miR-1306-5p in four SE infected chicken tissues, including the spleen, bursa fabricius, cecal tonsil, and cecum were measured.
The results showed that after infection by SE, the expression levels of gga-miR-1306-5p in all these four tissues were significantly increased (Fig. 1). Specifically, gga-miR-1306-5p was rapidly promoted and reached a peak at 12 h after SE infection in the spleen and cecal tonsil samples. The expression of gga-miR-1306-5p in the cecum was significantly increased and reached a peak at 48 h post-infection. Consistently, the expression profile of gga-miR-1306-5p in bursa fabricius samples was also determined, showing significant time-dependent upregulation.
gga-miR-1306-5p facilitates LPS-induced inflammatory cytokine production
As shown in Fig. 2a, LPS stimulated HD11 cells and activated gga-miR-1306-5p expression, which was significantly up-regulated over time, with gga-miR-1306-5p reaching a peak value at 6 h post-infection.
The mRNA expression profiles of gga-miR-1306-5p (a), and downstream pro-inflammatory mediators including NF-κB (b), TNF-α (c), IL-6 (d), and IL-1β (e) after LPS stimulation in HD11 cells are given. The data are expressed as the mean ± SEM from three independent experiments performed in triplicate. *P<0.05, **P<0.01, ***P<0.001
Additionally, the expression profiles of four pro-inflammatory mediators including NF-κB, TNF-α, IL-6, and IL-1β in vitro were measured. As shown in Fig. 2b-e, the pro-inflammatory cytokines were rapidly induced and subsequently released after LPS stimulation in HD11 cells. The expression levels of NF-κB, TNF-α, IL-6, and IL-1β were all significantly up-regulated in HD11 cells, reaching the peak values of release after being stimulated at 3 h.
Tollip is the target of gga-miR-1306-5p
The preliminary prediction indicated that Tollip was a candidate target of gga-miR-1306-5p, and the potential binding site in the 3′UTR of Tollip was found for gga-miR-1306-5p (Fig. 3a). A more intuitive diagram demonstrated the binding between the target of Tollip 3′UTR and gga-miR-1306-5p (Fig. 3b).
Tollip is a target of gga-miR-1306-5p. a The sequence alignment of miR-1306-5p and one target site in the 3’UTR of Tollip are shown. b The illustration demonstrates the binding between the target of Tollip 3’UTR and gga-miR-1306-5p. c HEK293 cells were cotransfected with 3 μg of psiCHECK-2 or Tollip 3’UTR luciferase reporter plasmid (WT or MT), along with control mimics or gga-miR-1306-5p mimics as indicated. Firefly luciferase activity was measured and normalized by Renilla luciferase activity to finally calculate the Relative luciferase activity, after 36 h post transfection. d Effects of gga-miR-1306-5p mimics on Tollip expression at both protein and mRNA levels compared with negative control. e Effects of gga-miR-1306-5p inhibitor on Tollip expression at both protein and mRNA levels compared with control inhibitor. *P<0.05, **P<0.01, ***P<0.001
Additionally, we performed the dual-luciferase reporter assays on HEK293 cells 36 h post-cotransfection to validate the binding of gga-miR-1306-5p with the candidate target Tollip. As shown in Fig. 3c, the gga-miR-1306-5p mimics down-regulated the luciferase activity compared with the control mimics when cotransfected with the Tollip-3′UTR reporter plasmid in HEK293 cells. Nevertheless, the inhibition of luciferase activity was attenuated after cotransfection with the mutant-type vector of Tollip 3′UTR and gga-miR-1306-5p. Collectively, the luciferase reporter assays demonstrate that gga-miR-1306-5p may be the regulator of Tollip in chickens.
To confirm the functions of gga-miR-1306-5p in the regulation of Tollip, we explored the protein and mRNA expression levels of Tollip in HD11 cells treated with the mimics and inhibitor of gga-miR-1306-5p. As shown in Fig. 3d and e, overexpression of gga-miR-1306-5p suppressed Tollip expression at the protein and mRNA levels, whereas the suppression of Tollip was restrained in the presence of the gga-miR-1306-5p inhibitor. Combined with the results of the luciferase reporter assays, these data collectively reveal that gga-miR-1306-5p targets the 3′UTR of Tollip.
gga-miR-1306-5p regulates Tollip and downstream inflammatory mediator expression
To evaluate the effects of gga-miR-1306-5p on the bacteria-induced inflammatory response, the mimics, negative control, inhibitor, or control inhibitor were respectively transfected into HD11 cells. And then 36 h post-transfection, the expression levels of four pro-inflammatory mediators were assessed (Fig. 4). The data showed that LPS stimulation promoted the significant upregulation of cytokines and induced the release of inflammatory mediators in HD11 cells. The gga-miR-1306-5p mimics further promoted the release of inflammatory cytokines after transfection compared to the negative control. In contrast, decreases in the NF-κB, TNF-α, IL-6, and IL-1β expression were observed following the introduction of gga-miR-1306-5p inhibitor. The same trends were observed after LPS stimulation. Taken together, these results indicate that gga-miR-1306-5p acts as a positive regulator of the innate immune response in chickens.
The HD11 cells were transfected with gga-miR-1306-5p mimics or negative control and gga-miR-1306-5p inhibitor or control inhibitor within a final concentration of 100 nmol/L. At 36 h posttransfection, HD11 cells were stimulated with LPS and after another 3 h, the expression levels of four pro-inflammatory mediators including NF-κB (a), TNF-α (b), IL-6 (c), and IL-1β (d) were then analyzed by qPCR. The data are expressed as the mean ± SEM from three independent experiments performed in triplicate. *P<0.05, **P<0.01, ***P<0.001
Tollip siRNA increases the production of inflammatory cytokines
To confirm the function of Tollip in the regulation of pro-inflammatory cytokines, HD11 cells were transfected with Tollip-specific small interfering RNA (siRNA). The results demonstrated that siRNA efficiently suppressed Tollip expression at both mRNA and protein levels (Fig. 5a). We silenced Tollip and detected the expression profiles of downstream pro-inflammatory factors in HD11 cells stimulated with LPS. As shown in Fig. 5b-e, knockdown of Tollip significantly promoted the release of downstream inflammatory mediators, including NF-κB, TNF-α, IL-6, and IL-1β. Further stimulation using LPS exacerbated the inflammatory response, which was consistent with the effects of gga-miR-1306-5p overexpression.
The expression levels of Tollip and inflammatory cytokines after Tollip interference. a The mRNA and protein levels of Tollip in HD11 cells transfected with control siRNA (si-Ctrl) or siRNA against Tollip (si-Tollip). The mRNA expression of four downstream pro-inflammatory mediators including NF-κB (b), TNF-α (c), IL-6 (d), and IL-1β (e) in HD11 cells, which were transfected with si-Ctrl or si-Tollip for 24 h, and then stimulated with LPS for another 3 h. The data are expressed as the mean ± SEM from three independent experiments performed in triplicate. *P<0.05, **P<0.01, ***P<0.001
As illustrated in Fig. 6, the results of our study collectively demonstrate that the upregulation of gga-miR-1306-5p induced by pathogen infection or LPS stimulation participated in the immune response by inhibiting Tollip, and subsequently promoting the production of inflammatory factors.
A proposed model of gga- miR-1306-5p regulation on activation of pro-inflammatory responses via targeting Tollip in chickens (Red arrow: up-regulation or down-regulation). Tollip is required to maintain immune homeostasis and control the MyD88-dependent TLR signaling pathway during inflammation. Following pathogen or LPS stimulation, Tollip firstly binded with IRAK-1, and this Tollip-IRAK-1 complex interacted with IRAK-4. The results generated from our study showed gga-miR-1306-5p were significantly increased following SE infection or LPS stimulation. The highly expressed gga-miR-1306-5p could significantly suppress the target Tollip, and subsequently facilitate the downstream pro-inflammatory mediators including NF-κB, TNF-α, IL-6 and IL-1β
Discussion
Growing evidence demonstrates that miRNAs are involved in the regulation of innate and adaptive immunity responses to various bacterial infections, particularly the Gram-negative enteric pathogen SE [22]. The specific roles of diverse miRNAs in response to SE infection have been explored in chickens. Several novel miRNAs, including gga-miR-125b-5p, gga-miR-34a-5p, gga-miR-1416-5p, and gga-miR-1662 play an important role in SE infection by regulating their target genes in the cecum of laying chickens [23]. Several studies have revealed that miR-155 acts as a component of the inflammatory response and plays important roles in the development and activation of immune-related cells [24, 25]. Despite these studies, there is limited information about the function of miRNAs with regard to the host responses following SE infection in chickens. Thus, more investigations are needed to identify the specific roles and functions of miRNAs in regulating the inflammatory responses against SE infection in chickens, with the aim of exploring pathogenesis, protecting animal welfare, reducing economic losses in the poultry industry and keeping food safe.
To date, no study has reported on the specific regulation of immune responses by miRNA-1306-5p, particularly during SE infection in chickens. In other words, the specific functions of miR-1306-5p in the regulation of innate immunity during infection are an undiscovered and verifiable topic that warrants further investigation. Our preliminary deep sequencing data revealed that 32 miRNAs, including gga-miR-1306-5p, exhibited significantly different expression among healthy and SE-infected chickens [26]. Accordingly, we speculate that gga-miR-1306-5p was involved in the regulation of host immune response against SE infection. Moreover, this could be a novel finding on the mechanisms of gga-miR-1306-5p regulating the inflammatory response in chickens. Above all, the expression and functional mechanisms of one miRNA mainly rely on the regulation of the targeted gene in the pathway [27]. Consequently, identifying the target mRNA of each miRNA is critical to thoroughly understand the biological functions of miRNAs due to the nature of their post-transcriptional regulatory effects.
The spleen is the largest immune organ in the body, playing a major role in an immediate innate reaction after recognizing pathogens through filtering antigens from the blood [28]. Bursa fabricius is an immune organ unique to birds, and the cecum tonsil is the largest intestinal-related lymphoid tissue in poultry. In addition, the cecum is the invading pathway for SE infection. Therefore, in the present study, we first detected gga-miR-1306-5p expression levels in these four tissues to identify the roles played by gga-miR-1306-5p. Subsequently, the expression levels of gga-miR-1306-5p were determined in HD11 cells in vitro. Our results showed that gga-miR-1306-5p were increased in both various tissues following SE infection and in HD11 cells stimulated by LPS. Thus, the underlying mechanisms by which gga-miR-1306-5p modulated the production of pro-inflammatory cytokines were further investigated. Subsequently, a molecular study confirmed that the nucleotide sequence in the 3′UTR of Tollip is the potential target site of gga-miR-1306-5p. As previously mentioned, the expression and functional mechanisms of one miRNA mainly rely on regulation of the targeted gene in the pathway [29]. We provide a more intuitive demonstration in Fig. 6. In the current study, the expression of Tollip was significantly inhibited by highly expressed gga-miR-1306-5p. Interestingly, overexpression of gga-miR-1306-5p upregulated the release of pro-inflammatory cytokines, which produced effects similar to that of Tollip silence. Collectively, gga-miR-1306-5p, induced by SE or LPS, regulates immune responses by inhibiting Tollip, which activates the production of inflammatory cytokines. According to previous reports, Tollip limits the production of pro-inflammatory mediators during inflammation and infection [30], and not only has been implicated as a negative regulator of the NF-κB signaling pathway but also controls the magnitude of inflammatory cytokine production in response to LPS [10]. Consistent with these studies, our data more definitely confirm that Tollip silence significantly promotes the release of downstream inflammatory cytokines, acting as a negative regulatory mediator. One innovative point of our study is addressing the precise molecular mechanisms by which Tollip modulates cytokine production.
In the long term, in-depth investigations are necessary to discover the novel targets of miR-1306-5p during SE and other types of bacterial infections. Additionally, our data provide us some hints, more thorough studies are indispensable to develop new techniques, such as a vaccine to specifically modulate the expression of one specific miRNA associated with pathogen infection, which will provide new methods to prevent or even treat bacterial infections with a promising application prospect and huge economic value for practical production.
Conclusions
The results of this study preliminarily confirmed that upregulation of miR-1306-5p in tissues infected by SE or in HD11 cells stimulated with LPS, promote pro-inflammatory cytokine release by suppressing the target Tollip, which is conducive to deepen the understanding of the pathogenesis of SE infection in chickens. In summary, our study provides new insight into understanding the mechanisms of the host immune response to Salmonella infection through miRNA-induced systems, and provides guidance on potential vaccine targets.
Availability of data and materials
All data generated or analyzed during this study are included in this published article.
Abbreviations
- 3’UTR:
-
3′-untranslated region
- gga-miR-1306-5p:
-
Gallus gallus microRNA-1306-5p
- IL:
-
Interleukin
- LPS:
-
Lipopolysaccharide
- miRNA:
-
MicroRNA
- NF-κB :
-
Nuclear factor kappaB
- PRR:
-
Pattern recognition receptor
- SE:
-
Salmonella enteritidis
- siRNA:
-
Small interfering RNA
- TLR:
-
Toll-like receptor
- TNF-α :
-
Tumor necrosis factor
- Tollip :
-
Toll-interacting protein
References
Karacan Sever N, Akan M. Molecular analysis of virulence genes of Salmonella Infantis isolated from chickens and turkeys. Microb Pathog. 2018;126:199–204.
Lin L, Xue L, Duraiarasan S, Haiying C. Preparation of ε-polylysine/chitosan nanofibers for food packaging against Salmonella on chicken. Food Packaging Shelf. 2018;17:134–41.
Harb A, Habib I, Mezal EH, Kareem HS, Laird T, O'Dea M, et al. Occurrence, antimicrobial resistance and whole-genome sequencing analysis of Salmonella isolates from chicken carcasses imported into Iraq from four different countries. Int J Food Microbiol. 2018;284:84–90.
Kuang X, Hao H, Dai M, Wang Y, Ahmad I, Liu Z, et al. Serotypes and antimicrobial susceptibility of Salmonella spp. isolated from farm animals in China. Front Microbiol. 2015;6:602.
Chu Q, Sun Y, Bi D, Cui J, Xu T. Up-regulated of miR-8159-5p and miR-217-5p by LPS stimulation negatively co-regulate TLR1 in miiuy croaker. Dev Comp Immunol. 2017;67:117–25.
Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell. 2006;124(4):783–801.
Hopkins PA, Sriskandan S. Mammalian toll-like receptors: to immunity and beyond. Clin Exp Immunol. 2005;140(3):395–407.
Rifkin IR, Leadbetter EA, Busconi L, Viglianti G, Marshak-Rothstein A. Toll-like receptors, endogenous ligands, and systemic autoimmune disease. Immunol Rev. 2005;204:27–42.
Capelluto DG. Tollip: a multitasking protein in innate immunity and protein trafficking. Microbes Infect. 2012;14(2):140–7.
Didierlaurent A, Brissoni B, Velin D, Aebi N, Tardivel A, Kaslin E, et al. Tollip regulates proinflammatory responses to interleukin-1 and lipopolysaccharide. Mol Cell Biol. 2006;26(3):735–42.
Ambros V. The functions of animal microRNAs. Nature. 2004;431(7006):350–5.
Friedman RC, Farh KK, Burge CB, Bartel DP. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009;19(1):92–105.
Bayraktar R, Van Roosbroeck K. miR-155 in cancer drug resistance and as target for miRNA-based therapeutics. Cancer Metastasis Rev. 2018;37(1):33–44.
Zeng Y, Wang KX, Xu H, Hong Y. Integrative miRNA analysis identifies hsa-miR-3154, hsa-miR-7-3, and hsa-miR-600 as potential prognostic biomarker for cervical cancer. J Cell Biochem. 2018;119(2):1558–66.
Bai X, Han G, Liu Y, Jiang H, He Q. MiRNA-20a-5p promotes the growth of triple-negative breast cancer cells through targeting RUNX3. Biomed Pharmacother. 2018;103:1482–9.
Kishore D, Omar G, Subramanian D. Modulation of host miRNAs by intracellular bacterial pathogens. Front Cell Infect Microbiol. 2016;6:79.
Maudet C, Mano M, Eulalio A. MicroRNAs in the interaction between host and bacterial pathogens. FEBS Lett. 2014;588(22):4140–7.
Li Y, Shi X. MicroRNAs in the regulation of TLR and RIG-I pathways. Cell Mol Immunol. 2013;10(1):65–71.
Li P, Xia P, Wen J, Zheng M, Chen J, Zhao J, et al. Up-regulation of the MyD88-dependent pathway of TLR signaling in spleen and caecum of young chickens infected with Salmonella serovar Pullorum. Vet Microbiol. 2010;143(2–4):346–51.
Rohde F, Schusser B, Hron T, Farkasova H, Plachy J, Hartle S, et al. Characterization of chicken tumor necrosis factor-alpha, a long missed cytokine in birds. Front Immunol. 2018;9:605.
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 2001;25(4):402–8.
Eulalio A, Schulte L, Vogel J. The mammalian microRNA response to bacterial infections. RNA Biol. 2012;9(6):742–50.
Wu G, Qi Y, Liu X, Yang N, Xu G, Liu L, et al. Cecal MicroRNAome response to Salmonella enterica serovar Enteritidis infection in white Leghorn layer. BMC Genomics. 2017;18(1):77.
O'Connell RM, Taganov KD, Boldin MP, Cheng G, Baltimore D. MicroRNA-155 is induced during the macrophage inflammatory response. Proc Natl Acad Sci U S A. 2007;105(5):1604–9.
Vigorito E, Kohlhaas S, Lu D, Leyland R. miR-155: an ancient regulator of the immune system. Immunol Rev. 2013;253(1):146–57.
Li P, Fan W, Li Q, Wang J, Liu R, Everaert N, et al. Splenic microRNA expression profiles and integration analyses involved in host responses to Salmonella enteritidis infection in chickens. Front Cell Infect Microbiol. 2017;7:377.
Chendrimada TP, Finn KJ, Ji X, Baillat D, Gregory RI, Liebhaber SA, et al. MicroRNA silencing through RISC recruitment of eIF6. Nature. 2007;447(7146):823–8.
Smith KG, Hunt JL. On the use of spleen mass as a measure of avian immune system strength. Oecologia. 2004;138(1):28–31.
Pauley KM, Chan EK. MicroRNAs and their emerging roles in immunology. Ann N Y Acad Sci. 2008;1143:226–39.
Rebl A, Hoyheim B, Fischer U, Kollner B, Siegl E, Seyfert HM. Tollip, a negative regulator of TLR-signalling, is encoded by twin genes in salmonid fish. Fish Shellfish Immunol. 2008;25(1–2):153–62.
Acknowledgements
Not applicable.
Funding
This study was supported by grants from the National Natural Science Foundation of China (No. 31572393); the National Key Technology R&D Program (2015BAD03B03); the China Agricultural Science and Technology Innovation Project (ASTIPIAS04); and the earmarked fund for Modern Agro-Industry Technology Research System (CARS-41).
Author information
Authors and Affiliations
Contributions
GZ designed the study and supervised the project. WS contributed to the design and performance of the study, and writing of the manuscript. RL, PL, and QL contributed to the design of the study and assisted in animal handling. HC contributed to the data analysis. MZ and JW contributed to modifying the manuscript. All authors submitted comments on drafts, and read and approved the final manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
This study was conducted in accordance with the Guidelines for Experimental Animals established by the Ministry of Science and Technology (Beijing, China). All experimental protocols were approved by the Science Research Department (in charge of animal welfare) of the Institute of Animal Sciences, Chinese Academy of Agricultural Sciences (CAAS), Beijing, China.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Rights and permissions
Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
About this article
Cite this article
Sun, W., Liu, R., Li, P. et al. Chicken gga-miR-1306-5p targets Tollip and plays an important role in host response against Salmonella enteritidis infection. J Animal Sci Biotechnol 10, 59 (2019). https://doi.org/10.1186/s40104-019-0365-2
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s40104-019-0365-2