Background

Aedes-borne viruses (arboviruses) have always been a major global health concern. Dengue, yellow fever, chikungunya and Zika threaten approximately 3.9 billion people living in tropical and subtropical areas [1]. Aedes aegypti and Ae. albopictus are the main vectors of these arboviruses worldwide, and their high ecological and physiological plasticity has facilitated their current global distribution [2]. Aedes aegypti originated in Africa, and its distribution in China has been limited to a few provinces, including Hainan Island and the Leizhou Peninsula in Guangdong Province [3]. However, Ae. albopictus, which originated in Asia and is also known as the Asian tiger mosquito, has spread to all continents except for Antarctica and is considered the most invasive mosquito species [4, 5]. Aedes albopictus is widespread in China, extending to Liaoning Province in the north, Gansu Province in the northwest and Hainan Province in the south [6].

The two mosquito species coexist on Hainan Island and the Leizhou Peninsula, the main dengue epidemic areas at the southernmost tip of mainland China. There were two dengue epidemics on Hainan Island at the end of the twentieth century and one on Leizhou Peninsula at the beginning of the twenty-first century. Aedes aegypti was the vector of transmission in these outbreaks [7,8,9,10]. More recently, however, Ae. albopictus has become the main vector, and the breeding areas of Ae. aegypti on these two islands have gradually decreased over the last 40 years. Guangxi was the first province in China to declare Ae. aegypti eradication. Between 1986 and 1991, Guangxi carried out comprehensive control of Ae. aegypti by application of insecticides, fish culture in water jars and other methods and achieved the goal of eliminating Ae. aegypti from the entire province in just 6 years [11]. Aedes aegypti was not found during subsequent monitoring, but Ae. albopictus densities were very high [12]. Various explanations have been proposed for the displacement of Ae. aegypti by Ae. albopictus, including interspecific competition [13], satyrization [14,15,16] and differential adaptability to environmental changes [17].

Genetic diversity and population structure are fundamental to understanding population dynamics and dispersal [18]. Genetic structure and variation are related to many factors, including vector control campaigns, levels of urbanization, trade flows between cities and the number of colonization events [19]. There are some reports on the genetic characteristics of Ae. aegypti and Ae. albopictus populations in China. For Ae. aegypti, most of the research has focused on the genetic characteristics of invaded Ae. aegypti populations in Yunnan Province [3, 20,21,22,23]. For Ae. albopictus, much research has been done on its genetic diversity and population structure in different areas of China at different scales. At the national level, some studies have shown that continuous dispersal supported by human activities has contributed to strong gene flow, inhibiting population differentiation and promoting genetic diversity among Ae. albopictus populations, and that climatic factors may also influence genetic diversity. [24,25,26,27,28,29]. There are also many provincial reports on the genetic diversity of Ae. albopictus populations in different regions of China, such as Guangdong, Zhejiang, Fujian and Hunan Provinces [30,31,32,33], which all suggest low differentiation of Ae. albopictus populations. At the regional level, the rapid expansion of high-speed railways, air routes and highways has accelerated the dispersal of mosquitoes in the Yangtze River basin, inhibiting population differentiation and promoting genetic diversity among Ae. albopictus [34]. However, in their cohabiting areas such as Hainan Island and the Leizhou Peninsula, there were no reports on the genetic diversity of Ae. aegypti, or the different dispersal pattern with Ae. albopictus in the sympatric areas, especially the genetic reasons for the change in population size of these two species in the past 40 years.

In Vietnam, a high degree of genetic polymorphism was found in invasive Ae. aegypti mosquitoes. Individual abundance of Ae. aegypti and Ae. albopictus was also influenced by climate and habitat in the sympatric region [2]. In Penang, Ae. albopictus was found in most areas, and it was postulated that the species is beginning to replace Ae. aegypti and may become the primary vector of dengue virus [35]. In Central Africa, Ae. albopictus is the dominant species in most urban areas located below 6°N where it tends to replace the native Ae. aegypti [36]. On the other hand, it was found that the coexistence of Ae. albopictus and Ae. aegypti in the same geographical areas may increase the risk of infection or co-infection for humans, especially during outbreaks or arboviral expansions [1]. Most studies focus on monitoring the densities of these two mosquito species or conduct population genetics research on a single species in China. However, there is no report on the difference in genetic diversity and dispersal patterns between Ae. albopictus and Ae. aegypti in cohabiting fields, especially based on the different shift in distribution and densities of two species.

In the present study, the genetic diversity of Ae. aegypti and Ae. albopictus collected from the cohabiting areas of Hainan Island and the Leizhou Peninsula was assessed, based on microsatellite molecular markers in DNA (SSR) and mitochondrial DNA marker (coxI). Understanding the population genetic dynamics between these two mosquitoes could help to understand why the distribution of Ae. aegypti has decreased significantly while the distribution of Ae. albopictus has increased on Hainan Island and the Leizhou Peninsula over the last 40 years. On the other hand, it also has important implications for vector control strategies in China, especially in the plan to eliminate Ae. aegypti on the Leizhou Peninsula and further reduce Ae. aegypti on Hainan Island.

Methods

Sample collection and DNA extraction

Larvae, pupae and adult Ae. aegypti and Ae. albopictus were collected from five cohabiting areas in Hainan Island and the Leizhou Peninsula from July to October 2021 (Table 1 and Fig. 1). All the developmental stages of mosquitoes were brought back to a field laboratory. The larvae and pupae were reared until adult mosquitoes emerged. The species of all adult mosquitoes were identified based on morphology [6]. Adult mosquitoes were stored in sterile tubes containing anhydrous ethanol prior to DNA extraction. Whole genomic DNA was extracted individually from each mosquito using a DNeasy® Blood & Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer’s standard protocol, and extracted DNA was stored at − 20 °C prior to subsequent experiments.

Table 1 Sampling locations and number of Aedes aegypti and Ae. albopictus, respectively
Full size table
Fig. 1
figure 1

Sampling map of Aedes aegypti and Ae. albopictus populations in Hainan Island and the Leizhou Peninsula, China

Full size image

Microsatellite DNA genotyping and data analysis

Nine microsatellite loci (AT1, AG2, AG7, AC2, AC7, B07, F06, SQM6 and SQM7) and 11 microsatellite loci (BW-P1, BW-P3, BW-P6, BW-P18, BW-P22, BW-P23, BW-P24, BW-P26, BW-P27, BW-P35 and BW-P36) (Additional file 1: Table S1) were selected for amplification by PCR using fluorescence-labeled primers for Ae. aegypti and Ae. albopictus, respectively, based on previous research [3, 28, 37]. Amplified fragments were separated by capillary electrophoresis, and the microsatellite DNA fragments were entered into Excel for analysis. GenAlex v.6.5 was used to estimate the pairwise genetic relatedness between individuals by the LRM estimator. The coefficient of relatedness r ≥ 0.25 was used to define a full sib relationship (parents and offspring, or sibs sharing the same parents) [38, 39]. To reduce the sibling bias within populations for genetic structure analysis, only one individual was selected from each putative full-sibling group within each population. In addition, genetic diversity within each cohabiting area was estimated using the average number of alleles (Na), effective number of alleles (Ne), Shannon’s diversity index (SI), observed heterozygosity (Ho), expected heterozygosity (He) and interpopulation variation assessed by AMOVA using GenAlEx v.6.5 [39]. The DAPC analysis was performed on the R platform using the “Adegenet” data analysis module and mobilizing the “inbreeding and seppop” commands to test the normality of inbreeding coefficients for different populations [40]. In addition, population genetic structure was assessed in STRUCTURE 2.3.4 software, and optimal K values were calculated using the ΔK method [41, 42], with the best K value calculated using Structure Harvester, https://taylor0.biology.ucla.edu/structureHarvester/. The output data were subjected to 1000 iterations using the greedy algorithm of CLUMPP v.1.1.2 [43] and finally visualized and analyzed using DISTRUCT v.1.1 [44]. Polymorphic information content (PIC) was assessed using the Microsatellite Toolkit [45]. The null allele frequency of each locus, deviation from Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were calculated using GENEPOP version 4.1.4 [46]. To detect bottlenecks, the SIGN test for heterozygosity excess was performed with TPM in BOTTLENECK v.1.2.02 [47]. In addition, NTSYS v2.10e was used to plot the UPGMA tree based on Nei's genetic distance, and GenAlex v.6.5 was used for the genetic correlation test (Mantel test).

Mitochondrial DNA sequencing and phylogenetic analysis

The whole mitochondrial coxI gene of Aedes mosquitoes was amplified using the following primer pairs: coxI-F: 5′GGTCAACAAATCATAAAGATATTGG3′ and coxI-R: 5′ TCCAATGCACTAATCTGCCATATTA3′ [48, 49]. The 25 µl reaction mixtures contained 12.5 µl PCR Mix (TaKaRa, Japan), 8.5 µl ddH2O (TaKaRa, Japan), 1 µl forward primers and 1 µl reverse primers (synthesized by Sangon Biotech), with 2 µl DNA template. The PCR amplification consisted of a 5-min pre-denaturation at 94 °C followed by 35 cycles of 94 °C for 30 s, 60 for 45 s and 72 °C for 60 s, with a final elongation at 72 °C for 5 min, using the BIORAD (USA) thermal cycler. All the PCR products were detected and separated by 2% agarose gel electrophoresis, and the positive PCR products were bidirectionally sequenced by Beijing Genomics Institution (BGI), China. The sequences were checked by the BioEdit and alignmented by cluster W, and the mutation sites were determined. Sequences were sorted in Mega v7 for subsequent data analysis. The base content and polymorphism were analyzed by Mega v7 [50]. Haplotype index (number of haplotypes-H, haplotype diversity-Hd, nucleotide diversity-π, average number of nucleotide differences-k) and mismatch distribution analysis of Aedes populations were calculated by DnaSP v6.12.03 [51], and the haplotype network diagram was plotted by Popart v1.7 [52]. Molecular variance (AMOVA), neutrality test (Tajima’s D and Fu’s Fs) and Fst test with the calculation Nm = (1/Fst + 1)/4 were calculated in ARLEQUIN v3.1 [53].

Results

Sampling data and species identification

Possible breeding sites of Ae. aegypti on Hainan Island and the Leizhou Peninsula from July to October 2021 were searched and surveyed, and the results were consistent with previous reports stating that the breeding sites specific for Ae. aegypti have been greatly reduced [10, 54,55,56]. Only five populations co-habiting with Ae. albopictus were collected, one from the Leizhou Peninsula and four from Hainan Island (Table 1). In contrast, Ae. albopictus was present in all sites searched. Species identification was performed 3 days after the emergence of adult mosquitoes. We collected both female and male mosquitoes because we believe that the study of genetic diversity should include both sexes, consistent with the approach of other studies [57].

Genetic diversity based on microsatellite DNA

We excluded 46 Ae. aegypti and 15 Ae. albopictus samples of full siblings at collection sites, and the remaining 140 Ae. aegypti and 130 Ae. albopictus samples were used for further molecular analysis (Table 1). The pairwise genetic relatedness of all samples within and between populations was compared using the LRM estimator (Additional file 2: Table S2). Aedes aegypti had a greater number of within-population comparisons (total percentage 1.06%) than Ae. albopictus (0.64%).

The genetic diversity of the nine microsatellite loci for Ae. aegypti and the 11 microsatellite loci for Ae. albopictus are shown in Table 2. The Na, PIC and SI values of each locus were consistent, indicating that most loci were polymorphic in both Aedes populations [27, 28]. The diversity index of Ae. albopictus was higher than that of Ae. aegypti. The results of null allele evaluation indicated that loci F06, BW-P1 and BW-P27 had a high probability of null alleles (> 0.2) [58,59,60]. The mean value of observed heterozygosity (Ho) was lower than the expected heterozygosity (He) in all the Aedes populations. A test of Hardy-Weinberg equilibrium (HWE) at each locus per population indicated that all ten populations were significantly departed from HWE (Additional file 3: Table S3). Significant results for the linkage disequilibrium (LD) test were obtained for 31 out of 180 pairs (17.2%) in Ae. aegypti and 55 out of 275 pairs (20.0%) in Ae. albopictus. The TPM model was used to assess the recent population bottleneck and showed a significant difference (P < 0.05) in the BS population of Ae. aegypti (Table 3). Analysis of molecular variance (AMOVA) showed that most of the variation occurred within the populations, with percentages of variation of 90.7% for Ae. aegypti and 96.4% for Ae. albopictus, respectively (Additional file 4: Table S4). The results of UPGMA cluster analysis were shown in Fig. 2A, D, which indicated that Ae. aegypti populations were clustered into three branches and Ae. albopictus populations were clustered into two branches. In addition, the results of the DAPC analysis were similar to those of the cluster analysis (Fig. 2B, E). The STRUCTURE analysis also suggested that Ae. aegypti could be divided into three genetic clusters, while Ae. albopictus could be divided into two (Fig. 2C, F). The Mantel test showed a positive correlation between genetic distance and geographical distance (R2 = 0.0611, P = 0.001 for Ae. aegypti and R2 = 0.0011, P = 0.250 for Ae. albopictus).

Table 2 Genetic diversity indices for nine microsatellite loci of Aedes aegypti populations and 11 microsatellite loci of Ae. albopictus populations
Full size table
Table 3 Bottleneck tests based on TPM model for Aedes aegypti and Ae. albopictus populations
Full size table
Fig. 2
figure 2

Population structure analysis based on SSR for Aedes aegypti (A–C) and Ae. albopictus (D–F). A and D: UPGMA dendrogram based on Nei's genetic distance; B and E: DAPC analysis. C and F: ΔK values and STRUCTURE bar plots

Full size image

Genetic diversity based on the mitochondrial coxI gene

Base polymorphism and haplotype diversity of the final 1330 bp coxI genes are shown in Table 4. The nucleotide composition was A + T rich for both Aedes species, consistent with the characteristics of insect mitochondrial DNA (accession numbers: OR144884-OR144906 for Ae. aegypti and OR144827-OR144871 for Ae. albopictus) [61]. High haplotype diversity was found in all the populations (Hd = 0.45977–0.77083 for Ae. aegypti, Hd = 0.77083–0.88966 for Ae. albopictus), except for the YGH population of Ae. aegypti (Hd = 0.45977), contrasting with low nucleotide diversity (π = 0.00066–0.00346 for Ae. aegypti, π = 0.00111–0.00262 for Ae. albopictus). A total of 23 haplotypes were recorded from 140 individuals of Ae. aegypti (Fig. 3). The WS population had the largest number of haplotypes (8), followed by the HW (6) and YGH (6) populations. In comparison, the number of haplotypes from Ae. albopictus was relatively higher. A total of 45 haplotypes were recorded from 130 individuals of Ae. albopictus (Fig. 3). The HW population had the largest number of haplotypes (15), followed by the YGH (14) and HT (9) populations. The two Aedes mosquito species in BS had the lowest number of haplotypes (4 and 8, respectively). There were three shared haplotypes and 20 unique haplotypes in Ae. aegypti populations with the dominant haplotypes being Hap_2. There were 4 shared haplotypes and 41 unique haplotypes in Ae. albopictus populations with the dominant haplotypes being Hap_4, Hap_18 and Hap_26.

Table 4 Base polymorphism and haplotype diversity of Aedes aegypti and Ae. albopictus
Full size table
Fig. 3
figure 3

TCS network among haplotypes based on coxI gene for A Aedes aegypti and B Ae. albopictus. Each line segment represents a single mutation. The size of the circle represents the number of samples

Full size image

In the neutrality test (Additional file 5: Table S5), Tajima’s D showed that only the HW Ae. aegypti and Ae. albopictus populations had experienced population expansion. A negative value of Fu’s FS for Ae. aegypti was obtained only for YGH, but the P values were > 0.05. In contrast, among the Ae. albopictus populations, three (YGH, HT and HW) had experienced population expansion.

AMOVA showed that most of the variation occurred within populations, with 84.6% and 87.8% percentage variations, respectively (Additional file 4: Table S4). The mismatch distribution analysis used to estimate the historical population dynamics is shown in Fig. 4 and indicated population expansion (unimodal) in the YGH and HT populations of Ae. aegypti and the YGH, HT and HW populations of Ae. albopictus.

Fig. 4
figure 4

Mismatch distributions analysis for coxI gene of Aedes aegypti (A–E) and Ae. albopictus (F–J). A–E and F–J are YGH, HT, BS, HW and WS populations, respectively

Full size image

Pairwise Fst values indicated that most pairs were significantly different (P < 0.05), except for the BS and HW, HT and HW population pairs of Ae. albopictus. The Nm calculated by Fst showed that most pairwise values were > 1, indicating frequent communication between most populations (Additional file 6: Table S6).

Discussion

Hainan Island and the Leizhou Peninsula are cohabiting fields of Ae. aegypti and Ae. albopictus in China. Aedes aegypti used to be the main vector species of dengue; however, with the development of the economy and changes in the ecological environment, Ae. albopictus has become the main vector species in these areas [62,63,64]. Only five Ae. aegypti populations were sampled that were cohabiting with Ae. albopictus, whereas Ae. albopictus was ubiquitous in all researched areas. Some studies have reported that Ae. aegypti had a relatively short active range compared to other mosquitoes [65]. In recent years, the distribution of Ae. aegypti in these areas has become increasingly restricted, and they could only be found in a few fishing villages along the coast. The sharp decline in Ae. aegypti over the last 40 years is closely linked to the vector control measures and ecological reconstruction of these villages, which have greatly altered the mosquito breeding environment. However, the distribution of Ae. albopictus in these areas might have increased because of its strong environmental adaptability. The present study investigated the reasons for the decline of Ae. aegypti and the expansion of Ae. albopictus on Hainan Island and the Leizhou Peninsula based on population genetics studies.

Genetic diversity

According to the microsatellite DNA results, the mean diversity index (PIC and SI values) of Ae. albopictus was higher than that of Ae. aegypti, indicating that the population diversity of Ae. albopictus was greater and it was better able to adapt environmental changes than populations of Ae. aegypti. Microsatellite DNA are widely used to evaluate genetic diversity and population structure because of the advantages of simple operation, easy detection and high polymorphism [66, 67]; the microsatellite DNA results in the present study showed that most loci were polymorphic [27, 28]. Mitochondrial coxI gene with strict maternal inheritance, conservative genetic structure and moderate evolution rate is also an effective molecular marker to study the genetic structure of mosquitoes [35, 68, 69]. The genetic diversity of all Ae. albopictus populations revealed by coxI gene was higher than that of Ae. aegypti in the present research. High haplotype number and haplotype diversity indicated that the population was more complex and better able to resist the effects of environmental change [70]. Aedes albopictus is a native mosquito species in China, and its adaptive evolution with the local environment might be longer than that of Ae. aegypti. Small and isolated populations are generally susceptible to negative factors such as environmental change, inbreeding and genetic randomness, which can reduce individual fitness and population viability, leading to reduced genetic diversity [71,72,73]. On Hainan Island and the Leizhou Peninsula, Ae. aegypti belongs to these small and range-restricted groups compared to Ae. albopictus. The population genetic results of this study reveal that Ae. aegypti populations with restricted range are less genetically diverse than widely distributed Ae. albopictus populations. Therefore, the elimination of breeding sites and the prevention of Ae. aegypti invasion should be continued to maintain the low genetic diversity of Ae. aegypti populations and to facilitate the complete elimination of Ae. aegypti from Hainan Island and the Leizhou Peninsula in the future.

Haplotype distribution

The haplotype diversity of all populations of Ae. albopictus was higher than that of Ae. aegypti. There were three predominant haplotypes (Hap_4, Hap_18 and Hap_26) in Ae. albopictus populations on Hainan Island and the Leizhou Peninsula, which were also found in other areas of China [25, 28, 74]. However, only one predominant haplotype was recorded in Ae. aegypti populations, from which the other 22 haplotypes evolved. High haplotype diversity and low nucleotide diversity were recorded in all the Aedes populations except the YGH population of Ae. aegypti, which may indicate rapid population growth after a bottleneck period and may have been caused by the widespread use of pesticides and the impact of human activities [25, 75]. The YGH population of Ae. aegypti exhibited low haplotype diversity and a low nucleotide diversity model and may have undergone founder events in which a new population was established by a small number of individuals drawn from a large ancestral population; the results of the UPGMA, DAPC and STRUCTURE analysis seemed to support this view (Fig. 2) [35, 76].

Population differentiation and genetic structure

Significant differentiation was found between all the Ae. aegypti populations, indicating less gene flow between populations and ultimately leading to a significant positive correlation between genetic distance and geographical distance [28, 32]. The degree of genetic differentiation varied between different populations of Ae. albopictus, with the WS population showing relatively high differentiation from other populations (Additional file 6: Table S6).

The results of both UPGMA and DAPC analysis supported the division of Ae. aegypti into three genetic clusters and Ae. albopictus into two, with the same population composition within each major genetic branch. Figure 2A, B shows that the YGH and WS populations of Ae. aegypti were genetically distant from the other three populations and formed two separate genetic clusters. The HT, HW and BS populations were genetically closer and formed a separate genetic cluster, which was also consistent with the geographical distance between the populations. Therefore, the genetic distance of Ae. aegypti populations was significantly and positively correlated with the geographic distance. Figure 2D, E shows that the Ae. albopictus population could be divided into two genetic clusters, with the WS population being genetically distant from the other four populations and forming a separate cluster. The YGH, HW, HT and BS populations formed one other large genetic cluster. The WS Ae. albopictus population was genetically distant from the other four populations, probably because the WS population was breeding on the Leizhou Peninsula, which was separated from the other four populations on Hainan Island by the Qiongzhou Strait and was the most geographically distant, so there was less gene flow with the other four populations, resulting in significant genetic differences.

Population expansion pattern

In the present study, only the HW population of Ae. aegypti showed a significant negative Tajima’s D value, which is used to detect neutral deviation caused by population bottleneck, expansion, directed selection or infiltration [77]. The result may indicate a historical expansion of the HW population of Ae. aegypti. The YGH, HT and HW populations of Ae. albopictus may experience historical population expansion events based on the Fu's Fs values, which can be used to detect historical fluctuations in population size, and the value was more sensitive [78]. The result was consistent with the mismatch distribution (Fig. 4). The other two populations, BS and WS, had negative Tajima’s D and Fu’s F values, but these were not significant, suggesting that the expansion may have been restricted to separate local areas [79].

All the populations of the two Aedes species deviated significantly from HWE. Most showed a He > Ho result, except for the BS population of Ae. albopictus, indicating a deficit in heterozygosity, which may have been caused by environmental selective pressure [27, 80, 81]. The TPM model was considered the best fit to the microsatellite data, and the results indicated that the BS population of Ae. aegypti experienced a bottleneck, which may have been related to environmental changes and the competition from Ae. albopictus. Over the past 2 years, new ports have been built in Basuo, resulting in the destruction of Ae. aegypti's breeding habitat and a sharp decline in species' numbers. At the same time, the local Ae. albopictus population has continued to invade its breeding sites, resulting in competition for space between the two species and ultimately leading to the decline of the Ae. aegypti population.

The Mantel test showed a significant positive correlation between genetic distance and geographic distance for the Ae. aegypti populations, but the correlation was not significant for Ae. albopictus populations, suggesting frequent gene flow between Ae. albopictus populations. This may be related to the rapid spread of these populations due to human activities, particularly the shipping trade [28]. Hainan Island has many trading ports in China, with cargo throughput reaching 199 million tons in 2020 [82]. The Qiongzhou Strait is an important transport link between Hainan Island and the Leizhou Peninsula, which is the only convenient gateway for maritime cargo between Hainan Island and the mainland. Frequent cargo trade inevitably leads to the continuous dispersal and gene exchange among Ae. albopictus populations in these areas.

Conclusions

The present study assessed the genetic diversity of Ae. aegypti and Ae. albopictus from cohabiting fields on Hainan Island and the Leizhou Peninsula in China and, for the first time to our knowledge, explained the reasons for the sharp decline in Ae. aegypti populations on Hainan Island and the Leizhou Peninsula in terms of population genetics. The results suggested that the population diversity of Ae. albopictus was greater than that of Ae. aegypti and that Ae. albopictus had invaded Ae. aegypti breeding sites in some places and continued to spread on these islands. The active dispersal of Ae. aegypti was smaller than that of other mosquitoes, including the continuous niche invasion of Ae. albopictus, which may inevitably lead to the decline in the population numbers and genetic diversity of Ae. aegypti. Genetic diversity is used to measure the ability of a species to adapt to environmental change and to predict the direction of its future survival and development as well as to explore when and how it arose and to speculate on routes of migration and dispersal. Low genetic diversity in Ae. aegypti populations may indicate a decline in the mosquito's ability to adapt environmental changes. Therefore, the Ae. aegypti population is more likely to be controlled on Hainan Island and Leizhou Peninsula. In terms of future vector control, the most critical and effective measure is to control the spread of Ae. albopictus and monitor the population genetic dynamics of Ae. aegypti, which could theoretically support the further elimination of Ae. aegypti in Hainan Island and Leizhou Peninsula, China.