Introduction

In Thailand, Chitralada 3 tilapia is a strain of tilapia developed from GIFT (Genetic Improvement of Farmed Tilapia), a Philippine ICLARM unit’s fifth generation (tilapia GIFT has traditional Thai Chitralada species mixed with it). Since breeding via the group selection approach was said to have been successful most recently in 2007, “Chitralada 3” has been consistently bred. Noteworthy for its impressive yield, excellent survival rate, and robust growth, “Chitralada 3” is characterized by its small, thick, dense, and highly meaty heads [1].

Streptococcosis, induced by a group B Streptococcus agalactiae, stands out as one of the most detrimental bacterial infections affecting Chitralada 3 strain Nile tilapia. This infection has the potential to result in a mortality rate as high as 90% [2, 3]. The bacteria generate the streptolysin S and O for blood hydrolysis and adhesion of cell surfaces, protect lysozyme, and replicate in serum or blood into target organs [4,5,6]. An infected fish exhibits external signs through abnormal behavior (swirling behavior, lethargy, bent bodies, and disorientation) and eye lesions (endophthalmia or exophthalmia), abscesses, skin hemorrhages around the mouth or at the base of the fin, and ascites [7]. The clinical signs and lesions effects of S. agalactiae infection include septicemia, hemorrhages, and inflammation in the liver, spleen, kidney, heart, brain, eye, intestinal tract, and peritoneum. Adhesions to the peritoneal cavity occur in severe infections, resulting in high mortality and severe economic damage. The epidemiology of this disease is caused by stress conditions (high water temperature, suboptimal oxygen, and overcrowding), horizontal transmission from feces, bacteria via lesions, and weakfish [8]. Accordingly, several antibiotic products and probiotics have been used to control this disease, risking beneficial bacteria equivalence often administered through food and environmental conditions. More environmentally friendly methods must be developed to relieve the problem, and the S. agalactiae vaccine is an exciting option for amendments to this prevalent pandemic [9].

While S. agalactiae attacks the tilapia by leading to immune response as a pathogen exposure response, two different parts exist in the immune system: innate and acquired immunity with cell-mediated and humoral responses. The innate immune system functions as a physical barrier, encompassing elements such as integumentary system, skin, scales, slime and chemicals defenses. Subsequently, it initiates a generalized response characterized by inflammation, opsonization, and phagocytosis. Macrophages and nonspecific cytotoxic cells serve as effectors within this system. In contrast, acquired immunity (AC) involves specific responses to antigen molecules, with B-cell, a subtype of lymphocytes, generating immunoglobulins or antibodies. T-cells and regulator cells acts as effectors in the context of acquired immunity [10].

Immunoglobulin M (IgM), a classical antibody isotype found in most vertebrates, plays a critical role in the host immune response, performing a variety of functions such as neutralizing specific antigens and activating the complement system [11], agglutination, binding of mannose binding lectin [12], and mediating cellular cytotoxicity [13]. IgM serves as the primary antibody produced in response to antigens and represents the initial antibody isotype to emerge during ontogeny.

IgM is classified as the primordial immunoglobulin of the adaptive immune response and is found in monomeric and tetrameric forms in circulating blood [14]. IgM can exist in 2 forms, sIgM and membrane-bound (mIgM), which are generated via alternative RNA splicing of the primary transcript of the μ gene [15]. sIgM consists of the variable region and 4 constant domains in the heavy chain, whereas mIgM contains variable region, 3 constant domains and 2 additional transmembrane domains (TM1 and TM2) and acts as a B cell receptor for initial antigen binding [16]. Together with innate immunity factors, it offers the initial line of defense against microbial infection. Until date, the immunoglobulin heavy (IGH) chain gene complex has encoded three primary types of immunoglobulins (Igs) in teleost: IgM [17], IgD [18], and IgT/IgZ. The considerable increase in IgM expression in Nile tilapia following bacterial challenge [13].

Despite the reality that tilapia culture frequently uses S. agalactiae vaccinations. These vaccinations come in several forms, such as DNA, recombinant, live attenuated, and whole-cell inactivated vaccines; each has a unique preparation and bacterial specificity [19, 20]. However, formalin-killed cell vaccine (FKCV) is a whole-cell inactivated vaccine successfully developed for tilapia and comprises the whole cell and a subunit of dead bacterial cells [21]. The intraperitoneal administration of the formalin-killed vaccine in tilapia has been extensively shown to produce highly effective outcomes, as evidenced by the relative percent survival (RPS). The FKC vaccine involves adaptive immunity to release immunoglobulin M (IgM) for primary defense with immunological memory. Therefore, the S. agalactiae vaccination is an extensively recognized process to prevent streptococcosis outbreaks and reduce fish mortality in the tilapia industry [22,23,24].

This research aimed to compare the immunoglobulin gene expression immune responses of tilapia infected with different S. agalactiae (serotype Ia) concentrations and effective dose of FKC vaccine as an alternative prevention approach in tilapia against S. agalactiae.

Materials and methods

Streptococcus agalactiae isotype Ia

S. agalactiae (serotype Ia) obtained from Kidchakan Supamattaya Aquatic Animal Health Research Center, Department of Aquatic Science, Faculty of Natural Resources, Prince of Songkhla University, Thailand. Multiplex PCR molecular serotyping was used to identify and validate the S. agalactiae serotype [25]. Prior to the experimental challenge, the bacterial isolation was passage through the fish with 0.1 ml of 108 CFU/ml by intraperitoneal (IP) injection twice to enhance their virulence post storage (-80oC). The bacteria were recovered from the blood of freshly dead fish and were cultured on Trypticase soy agar (TSA) media with 5% sheep blood at 37oC for 18 h. The activated bacteria were identified using specific primers (Forward: GAGTTTGATCATGGCTCAG and Reverse: ACCAACATGTGTTAATTACTC) for S. agalactiae [26]. Briefly, the amplification condition included a holding step at 95 oC for 15 min, 35 cycles of denaturation at 95 oC for 30 s, annealing at 55 oC for 30 s, extension at 72 oC for 1 min and finally extension at 72 oC for 5 min. The PCR product was investigated by using 1% agarose gel electrophoresis using 1× TBE buffer and 100 bp DNA ladder ready to load (Solis biodyne, Tartu, Estonia). Following bacterial confirmation, the bacteria were diluted in phosphate-buffered saline, PBS (Calbiochem, USA). The optical density (OD) at 600 nm, set at 1.00 (equivalent to 2.5 × 1012 CFU), was utilized to formulate the treatment [27].

Experimental tilapia

Healthy Nile tilapia of chitralada 3’s strain (approximately 20 g weight) was obtained from a private fish farm in Nakhon Si Thammarat province, Thailand. They were acclimated for ten days in the experimental zone in 500-liter tanks with a density of 100 fish per tank with aeration. Tanks were supplied with flow-through dechlorinated tap water and air stones to maintain desired water temperature, dissolved oxygen (DO) and pH levels. Water quality (temperature, DO, and pH) was measured daily and maintained at 28–30 °C for water temperature, > 4 ppm for DO, and pH 7–8. During the acclimation period, the fish were fed with a commercial diet (THAILUXE® comprised 40.17% protein, 4.32% lipid, 18.74% ash, and 15.84% moisture) twice daily at 9.00 am and 4.00 pm at 5% of body weight and maintained and handled according to Institutional Animal Care and Use Committee–approved guidelines. Five tilapias were randomly tested for S. agalactiae infection using PCR to ensure they were free of infection before the experiments.

Prior to investigation of severity, blood puncture, vaccination performance, the fish were anesthetized with buffered TMS (MS-222, Sigma, Cat: A5040). The experiment was conducted in strict accordance with the guidelines of the Animal Care and Use Committee of Walailak University and the regulations governing the use of animals in experimentation, and the protocol was approved by the Animal Ethics Committee, Walailak University (Protocol No. WU-AICUC-63-042) and all of the experiments were conducted in accordance with the guidelines and regulations of the Management and Use of Laboratory Animals of the Animal Ethics Committee, Walailak University. All efforts were made to minimize suffering and stress. Any fish that showed signs of disease or abnormal behavior (lethargy, bloating, disoriented swimming) or moribund was euthanized by using the hypothermal shock method in accordance with the guidelines outlined in the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals: 2020 Edition. In brief, the fish were gently captured and subsequently immersed in a container filled with cold water (2–4 °C) for 5–10 min, inducing loss of consciousness and eventual euthanasia. Following the prescribed time interval, the cessation of opercular movement was monitored to confirm euthanasia. Dead fish were then securely placed in plastic bags and frozen for further study. At all sampling times, fish were almost completely exsanguinated during blood collection and also euthanized with the hypothermal shock method.

Investigation of severity (pathogenicity)

The acclimated Nile tilapia fish was used to determine mortality after S. agalactiae infection at different bacterial concentrations. The fish were randomly divided into six groups with four replicates per group and 15 fish for each replicate, and they were held in an 80-liter plastic tank with aeration. One group was designated as the control (PBS injection), and the others were inoculated with five different concentrations (102, 104, 106, 108, or 1010 CFU/fish) of the S. agalactiae stock. The fish in the challenge groups were intraperitoneally injected with 0.2 ml of S. agalactiae dilutions which appropriate volume for 20–30 g Nile tilapia. In contrast, the fish in the control group were injected with 0.2 ml of PBS. During the experimental period, the fish were fed twice daily, and the water was changed every three days. Cumulative mortality, clinical signs were observed and recorded twice daily after challenge for 14 days. To verify the presence of S. agalactiae infection in the dead or moribund and the surviving fish, PCR tests using F1 (GAGTTTGATCATGGCTCAG) and IMOD (ACCAACATG TGTTAATTACTC) were conducted [26]. Water quality was measured daily and maintained at 28–30 °C for water temperature > 4 ppm for DO and pH 7–8. During the acclimation period, the fish were fed with a commercial diet twice daily at 9.00 am and 4.00 pm at 5% of body weight.

In this challenge test, mortality data following bacterial infection were derived from three replicates within each group. The remaining replicate in each group was utilized to investigate the immune response through fish replication.

Blood puncture and smear

After 72 h post-challenge, 500 to 1,000 μl of blood was collected from the individual caudal vein of ten infected fish from each group to measure antibody titers, gene expression, and blood smears. One drop of blood was spotted on a cleaned slide, and a glass cover equalized it. The blood slide was fixed with methanol by dipping 3–4 times and stained with commercial Dip Quick Stain (M&P IMPEX, Thailand). The fixed slide was dipped in eosin solution for ten seconds and cleaned with distilled water. Afterward, it was dropped in methylene blue for ten seconds and rewashed with water. The stained slide was air-dried for 400x microscopic observation. The erythrocyte, leucocyte, and thrombocyte counts were determined from the blood.

Agglutination techniques

For bacterial agglutination, 200 μl of blood was used following modified agglutination methods [27]. Blood was collected in 200 μl samples for bacterial agglutination. The blood was centrifuged at 6,000 xg− 1 for 5 min to separate the serum, and serial dilution of the serum was started at 1:10 (10 μl serum and 90 μl 1x PBS). Two-fold serial serum dilution was prepared in 96 well-round bottom microtiter plates (Nunc™ 96-Well Polystyrene Round Bottom Microwell Plates Thermo Scientific™). The remaining well plates were dropped in 50 μl of PBS. The serum was diluted until 1:320. The 50 μl of S. agalactiae at OD 1.0 was added to the well. In the experiment, the serum mixed with PBS and bacteria combined with PBS were used as controls. The plates were coned with a plastic cover and incubated at room temperature for 18 h. The endpoint of cell agglutination was observed as the last serum dilution compared to the positive control. The visible agglutination was reported as log 2 of the previous serum.

Immunoglobulin gene expression analysis

The remaining blood was dropped into a 1,500 μl Eppendorf tube with 3.2% sodium citrate in a 9:1 proportion. The total blood was centrifuged at 6,000 xg− 1 for five min for plasma removal and RNA isolation, following the GENEzol™ reagent (Geneaid) procedure. A NanoDrop 2000c spectrophotometer measured RNA quantity and quality (Thermo Fisher Scientific, Wilmington, DE, USA) at 260 and 280 nm wavelengths. The RNA sample was equally diluted to 500 μg/μl and was combined in each treatment to synthesize the cDNA with the iScript™ cDNA Synthesis Kit protocol (BIO-RAD, USA). The cDNA quality was examined with elongation factor 1, housekeeping gene (Forward: GCACGCTCTGCTGGCCTTT, Reverse: GCGCTCAATCTTCCATCCC), and immunoglobulin gene (Forward: GGGAAGATGAGGAAGGAAATGA, Reverse: GTTTTACCCCCCTGGTCCAT), producing PCR product of 250 and 120 bp, respectively [28]. The PCR reaction involved holding at 95oC for 15 min, 35 cycles of denaturation at 95oC for 30 s, annealing at 60oC for 30 s, extension at 72oC for 30 s, and a final extension at 72oC for five min. The cDNA quality was examined via PCR products using 1% agarose gel electrophoresis. Real-time PCR was employed to examine the expression of the immunoglobulin gene using the ABI 7300 Real-Time PCR System from Applied Biosystems. The amplified gene in 10 μl comprised 1.0 μl of cDNA, 2.0 μl of master mix (5× HOT FIREpol Probe qPCR Mix Plus (ROXX) (Solis Biodyne, Tartu, Estonia)), 0.25 μl of each primer (10 μM), and 6.5 μl of nuclease-free water. The cycling continued for 15 min at 95 °C, followed by 40 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72oC for 30 s. The expression level was calculated according to the 2−ΔΔCT method [29].

Formalin-inactivated Streptococcus agalactiae vaccine preparation

Trypticase soy broth (TSB) was used to culture active S. agalactiae and incubated at 37oC in a shaker for 36 h to a final concentration of 1.819 at OD 600 nm. The incubation was conducted at 37oC for 48 h and centrifuged to gather the cells before washing with sterile PBS five times. The bacteria were collected by centrifugation at 3,500 ×g for 10 min, and the cell pellets were washed with 1x PBS five times. The PBS was diluted in the bacterial solution until OD 1.000 with a total volume record. The serial dilution technique counted the bacteria cells and combined them again by adding formaldehyde at 0.5% in the solution. The vaccine underwent verification to ensure there was no contamination, utilizing TSA agar and stored at 4oC until use.

Vaccination performance

Tilapias were divided into seven groups for testing with S. agalactiae vaccination. In each group, 40 fish were injected with formalin-killed S. agalactiae at 102, 104, 106, 108, or 1010 CFU/fish concentrations. After 14 days of stimulation, the tilapias were injected with 200 μl of S. agalactiae (2.17 × 107 CFU/fish). Conversely, the positive control was injected with active S. agalactiae and the negative control with PBS. Cumulative mortality was recorded for the 14-day trial to calculate the relative percent survival as follows: RPS = [1 - (% mortality of vaccinated fish) × (% mortality of control fish)] × 100.

Statistical analysis

The software SPSS Statistics for Windows (Version 20.0) was utilized to analyze cumulative mortality, survival rate, antibody titers, blood cell and immunoglobulin gene expression data through one-way analysis of variance (ANOVA) and Duncan’s multiple range test. The results were presented in triplicate, depicting mean and standard deviation values. Significant differences among treatments were determined at p < 0.05.

Results

Challenge test of Streptococcus agalactiae for tilapia

The challenge test was estimated for 14 days. After infection with S. agalactiae, the death of tilapia occurred only around 3–12 days (Fig. 1). The cumulative mortality of tilapia was 25.08%, 21.75%, 65.56%, 58.41%, and 31.75% within 14 days post-infection with S. agalactiae, at doses of 1010, 108, 106, 104 and 102 CFU/fish, respectively (Fig. 1). The accumulative mortality shown in Fig. 1 indicates elevated mortality from Days 4 to 7 post-infection, with survival observed on the 6th day following injections of 104 and 106 CFU/fish, as detailed in Table 1.

Table 1 The survival rate following injections of varying concentrations of S. agalactiae in Nile tilapia
Full size table
Fig. 1
figure 1

Cumulative mortality of Nile tilapia under different concentrations of S. agalactiae injection. Each value is displayed as mean ± SD (n = 3)

Full size image

Serum agglutination titers

We observed that the various antibody levels in the tilapia having a significant (p < 0.05) difference compared to the control group. Figure 2 presents the antibody titers with the bacterial challenge. The highest titers were shown in 1010 CFU/fish of the S. agalactiae injection, but no significant (p > 0.05) differences were found in 104, 106, and 108 CFU/fish. The 102 CFU/fish injection revealed a higher antibody level than the control group (PBS).

Fig. 2
figure 2

Serum antibody titers in tilapia were evaluated using bacterial agglutination techniques with different concentrations of S. agalactiae injection, comparing them to the control (PBS injection). Distinct superscript letters denote statistically significant differences (p < 0.05) among the treatments

Full size image

The total blood count results by the blood smear technique variously depicted erythrocytes and white blood cells (WBCs) of each type (Fig. 3). Increased bacterial concentration caused WBCs accumulation. Therefore, statistical analysis demonstrated a significant (p < 0.05) difference between the control and injection treatments. The high bacterial inoculum concentration impacted the increase in lymphocyte, neutrophil, and monocyte counts (Fig. 4). The control was revealed to have total lymphocytes at 0.66%, while the 102 CFU/fish injection had total lymphocytes at 2.24%, with significant differences between the two groups (Table 2). Figure 5 depicts a positive correlation between the expression of the immunoglobulin gene and the total leucocyte count.

Fig. 3
figure 3

Peripheral blood cell morphology of Nile tilapia on blood smears was performed using light microscopy with 40x. Early immature erythrocytes (EE), Mature erythrocytes (ME), Large immature erythrocytes (LE), Clusters of fragmented thrombocytes (CT), Monocytes (M), Oval thrombocytes (OT), Neutrophils (N), Small lymphocytes (SL), and large lymphocyte (LL). Scale bars = 12.5 μm

Full size image
Fig. 4
figure 4

The blood cell composition of Nile tilapia under different concentrations of S. agalactiae injection. Each value is presented as mean ± SD (n = 10)

Full size image
Table 2 Percent of erythrocytes/leucocytes of different concentrations of the S. agalactiae injection compared with the control (PBS) under the blood smear technique at 40x microscopic performance for Nile tilapia
Full size table
Fig. 5
figure 5

The correlation between immunoglobulin gene expression and total leucocyte cells in Nile tilapia. The data is presented as mean ± SD from triplicate samples

Full size image

Immunoglobulin gene expression levels

Figure 6 depicted immunoglobulin gene expression of the tilapia blood after injection with different concentrations of bacteria. The expression gradually increased in the bacteria injection groups more than in the control group injected with PBS. However, the expression levels of the immunoglobulin gene in fish groups injected with 104-108 CFU/fish did not reveal a significant difference (p > 0.05) among the groups. The higher significance levels (p < 0.05) were distinguished in the 1010 CFU/fish injection. The expression of 102 CFU/fish also did not significantly (p > 0.05) differ from the control groups.

Fig. 6
figure 6

The relative expression of the immunoglobulin gene in tilapia blood under different concentrations of the S. agalactiae injection compared with the control (PBS injection). Different superscript letters indicate statistically significant (p < 0.05) differences among the treatments

Full size image

Vaccine efficacy

As depicted in Table 3, tilapia immunized with the S. agalactiae vaccine was demonstrated in 106 CFU/fish; the survival rate was 86.67%. The vaccination with the 102 and 104 CFU/fish illustrated that no fish survived after the S. agalactiae injection. The RPSs were highly demonstrated in 106 CFU/fish vaccination, but statistically significant (p > 0.05) differences did not occur with 108 and 1010 CFU/fish. The corresponding RPSs were 86.67, 83.33, and 76.67%, respectively.

Table 3 Survival rate and relative percent survival of vaccinated performance of Nile tilapia
Full size table

*The data is presented as mean ± standard deviation (n = 3 fish). Distinct superscript letters in the same row signify statistically significant difference (p < 0.05) among the treatments, determined through one-way ANOVA, followed by Duncan’s multiple range test.

Discussion

S. agalactiae is one of the most important pathogens and causes high mortality in Nile tilapia. The immune responses of Nile tilapia infected S. agalactiae in this study has led to the understanding of a specific immune responses including antibody levels, hematological parameters, and immunoglobulin gene expression of Nile tilapia when infected with S. agalactiae. After challenge, the results indicate that the challenge with S. agalactiae can cause clinical signs and lesions in Nile tilapia, when the bacteria were delivered intramuscularly inoculation, mortality was initially observed within 72 h. A linear dose response was not seen. This result suggests that the elevated bacterial concentration did not lead to disease, as evidenced by higher tilapia survival rates at 108 and 1010 CFU/fish compared to 102, 104, and 106 CFU/fish. The results also showed that a high concentration of bacteria could activate the adaptive immune system concerning the expression of the IgM gene. The number of lymphocytes increased in the high bacterial concentration treatments. The decrease of mortality at higher dilution of S. agalactiae was possibly due to factors effecting immunological tolerance, especially the increasing of IgM level which the expression of the IgM gene in the blood demonstrated that the high bacteria injection resulted in extremely high levels of expression. The IgM gene relates to acquired immunological response antibodies with a role in bacterial defense [13, 30]. Additionally, the IgM gene is expressed in various tissues, including the head kidney, spleen, intestine, skin, and gill. Vital tissues for producing antibodies for B and T cells in bony fish, the head kidney, and spleen had the highest IgM expression. Moreover, the IgM gene was detected in the skin and intestine’s mucosal immune system [31]. The mucosal immune system is the first line of defense against pathogen invasion and is susceptible to bacterial stimulation of phagocytosis via the mucosal surface [13]. The experiment detected bacteria from the blood throughout the target organs (brain, liver, spleen, and kidney). The IgM heavy chain gene was thoroughly expressed in all tested tissues, but higher levels were expressed in the peripheral blood leukocyte. Thus, the blood sample was the appropriate example of IgM gene expression to reduce the experimental fish mortality from tissue collection [32].

Antibody titers demonstrated that varying bacterial concentrations increased the augmentation of antibody levels; however, no statistically significant differences (p > 0.05) existed among 104–1010 CFU/fish. The lymphocyte and immunoglobulin produced antibodies with diverse functions in serum and mucus, and they participated in the B cell surface complex and antigen signaling function [33, 34]. The IgM titer should increase bacterial activation based on the quantities of bacteria found in the experiment. The dosages of bacteria also affected the immune protection response [35] The results exhibited a strong relationship between bacterial concentrations and antibody levels.

The number of leucocytes, observed by the blood smear technique, increased directly with the quantities of bacteria, according to the study. We determined the increments of lymphocytes, neutrophils, and monocyte counts. Lymphocytes, thrombocytes, monocytes, granulocytes, and nonspecific cytotoxic cells existed among the white blood cells. Leucocytes contributed to functional retardation and pathogen elimination via the immune system during pathogen assessment, commonly suggesting a contrary relationship with the fish’s condition or health [36]. Individually infected fish produced many leucocytes for antibody generation and phagocytosis. Lymphocytes appear to be made by the thymus, spleen, and kidney. The primary functions of antibody production and phagocytic activity induce the macrophage with this efficacy, where the antibodies were proportional to the number of lymphocytes [37, 38]. Therefore, excessive lymphocyte increase affects the survival of tilapia [36].

Furthermore, fish thrombocytes were accountable for the precursors of blood clotting in circulating fluids. Fish thrombocytes come in various shapes (oval, spindle, spiked, and cluster of fragmented thrombocytes), and every thrombocyte was sharp on blood smear slides [37]. A small proportion of the white blood cell population comprises monocytes or macrophages. Thought to originate in the kidney, they are competent in killing a category of pathogens and bacteria. In addition, neutrophils are one type of granulocyte elucidating up to 25% of the overall leukocyte population. Teleost produces granulocytes in the kidney and spleen [39]. Neutrophils migrate to the site of bacterial infection, where they may be phagocytic or bactericidal and frequently correlate with stress [40].

Moreover, vaccination demonstrated the effectiveness of S. agalactiae resistance 14 days following the induction of immunity. The intraperitoneally vaccinated injection with the whole-cell inactivated S. agalactiae vaccine resulted in high survival at 106 CFU/fish concentration and no significant difference (p > 0.05) at 108 and 1010 CFU/fish. In contrast, no fish survived in 102 and 104 CFU/fish after the S. agalactiae injection for 14 days of observation. Through intraperitoneal injection, formalin-killed vaccines exhibited excellent protection and a high relative percent survival (75–100%). Although no finding regarding the immune system existed, the fish experiment can be seen as a sign of success [41].

Conclusion

Our experiment has demonstrated the effect of highly concentrated S. agalactiae injections on immunological induction and survival, including an increase in the immunoglobulin gene expression and antibodies and an increase in leucocytes. The research indicated that injections of highly concentrated S. agalactiae reduce virulence and reverse immunological activation. Therefore, different vaccination concentrations had varying effects. We advocate vaccinating juvenile tilapia with 106 CFU/fish of S. agalactiae vaccination to reduce S. agalactiae outbreaks in the tilapia farm industry and for convenience. Furthermore, we propose vaccination as an alternative method to safeguard tilapia population against S. agalactiae infection.