Abstract
Germ granules are membrane-less organelles essential for small RNA biogenesis and germline development. Among the conserved properties of germ granules is their association with the nuclear membrane. Recent studies demonstrated that LOTUS domain proteins, EGGD-1 and EGGD-2 (also known as MIP-1 and MIP-2 respectively), promote the formation of perinuclear germ granules in C. elegans. This finding presents a unique opportunity to evaluate the significance of perinuclear localization of germ granules. Here we show that loss of eggd-1 causes the coalescence of germ granules and formation of abnormal cytoplasmic aggregates. Impairment of perinuclear granules affects certain germline classes of small RNAs including Piwi-interacting RNAs. Transcriptome profiling reveals overexpression of spermatogenic and cuticle-related genes in eggd-1 hermaphrodites. We further demonstrate that disruption of germ granules activates HLH-30-mediated transcriptional program in somatic tissues. Collectively, our findings underscore the essential role of EGGD-1 in germ granule organization and reveal an unexpected germ granule-to-soma communication.
Similar content being viewed by others
Introduction
Germ cells play a vital role in transmitting genetic and epigenetic information to future generations. Development and maintenance of metazoan germ cells requires electron-dense and membrane-less germ granules1,2,3,4,5,6. Germ granules are described as a hub for RNA metabolism and post-transcriptional gene regulation. Specific components, such as small RNAs, are produced during gametogenesis, deposited into germ granules, and passed on to the offspring. Transmission of germ granules influences gene regulation and phenotypic traits in the progeny. In some cases, the regulatory effect persists for many generations, demonstrated in studies of RNA-induced epigenetic silencing in worms7,8,9,10. Unlike other membrane-less organelles, germ granules across metazoa preferentially reside at the nuclear periphery. For example, germ granules in C. elegans associate with the cytoplasmic face of nuclear pores11,12. The association of germ granules with nuclear membranes has also been reported in zebrafish and mammals13,14. However, the significance of their perinuclear localization remains not fully understood.
In C. elegans, germ granules exhibit a distinctive organization into perinuclear sub-compartments. So far at least four types of sub-compartments have been discovered: P granules, Z granules, SIMR foci, and Mutator foci11,15,16,17. Although these sub-compartments are in close proximity to one another, genetic analyses and proteomic studies revealed distinct components within each sub-compartment3,6. Specifically, P granules contain RNA binding protein PGL-1, Piwi proteins (known as PRG-1 in C. elegans) and piRNAs (Piwi-interacting RNAs)18,19,20. Z granules, on the other hand, are characterized by the presence of Argonaute protein WAGO-4 (Worm Argonaute protein) and the RNA helicase ZNFX-19,16,21,22. SIMR foci exhibit the enrichment of the tudor domain protein SIMR-117. Mutator foci harbor several mutator proteins, including MUT-7 and MUT-16, which play essential roles in the generation of endogenous siRNAs (small interfering RNAs)15,23.
Our lab recently employed a proximity-based labeling method in combination with mass spectrometry to define P granule constituents24,25. Among newly identified components, we have characterized several key regulators including LOTUS domain and IDR (Intrinsically Disordered Regions)-containing proteins EGGD-1 and −2 (Embryonic and Germline P Granule Detached), also referred to as MIP-1 and −2 (MEG-3 interacting protein) by Gunsalus’s lab24,26. EGGD-1 and EGGD-2 act partially redundantly to promote the perinuclear localization of P granules and promote fertility24,26. We showed that EGGD-1 is intrinsically capable of self-assembling into perinuclear granules24. Remarkably, EGGD-1 is not only necessary but also sufficient to recruit GLH-1, a DEAD-box helicase Vasa homolog, to the nuclear periphery24,26. GLH-1 is subsequently required for the proper localization of the scaffold protein PGL-1 to P granules20,27.
The discovery of LOTUS domain proteins provides a unique opportunity to investigate the importance of the perinuclear localization of germ granules. In this study, we thoroughly characterized phenotypes of eggd-1 mutants. Specifically, we show that loss of eggd-1 leads to coalescence of germ granules and mis-localization of P granules, Z granules, and Mutator foci, collectively referred to as PZM granules, within the adult gonad. We find that EGGD-1 is dispensable for RNAi (RNA interference), but essential for the PRG-1/piRNA mediated silencing and production of specific types of endogenous siRNAs. Our small RNA and transcriptome profiling revealed that male-specific small RNA pathways—ALG-3/4 and spermatogenic genes are aberrantly expressed in eggd-1 hermaphrodites. Unexpectedly, depletion of eggd-1 or other P granule components causes the nuclear accumulation of the conserved transcription factor HLH-30 in the soma28,29. Our results show that activation of HLH-30 enhances the transcription of one cuticle-related gene in somatic tissues. Taken together, our work reveals essential roles of EGGD-1 in small RNA biogenesis and gene regulation and highlights the communication between germ granules and soma.
Results
Loss of eggd-1 causes coalescence of germ granules
C. elegans germ granules are known to associate with the nuclear membrane of germ cell nuclei and demix to distinct perinuclear sub-compartments, referred to as PZM granules3. Each sub-granule contains specific proteins. For example, PGL-1, ZNFX-1, MUT-16 are enriched at P-, Z-, M- granules, respectively15,16,21. While EGGD-1 and EGGD-2 act partially redundantly, EGGD-1 plays a more dominant role in promoting the perinuclear localization of P granules24,26. Therefore, we focused on EGGD-1 and interrogated its role in the organization of PZM granules. To this end, we examined the expression of endogenous ZNFX-1, PGL-1, and MUT-16 with fluorescent tags in wild-type and eggd-1 mutants containing deletion of its full open reading frame24. Germ cell nuclei in C. elegans are situated along the surface of the gonadal tube and share a common cytoplasmic core called the rachis30. Given that the dynamics of PGL-1 foci can change when tagged with different fluorescent proteins31, we inspected both PGL-1::RFP and PGL-1::GFP fluorescence on the surface and at the rachis of adult gonad. In wild-type animals, PGL-1::RFP or PGL-1::GFP foci were primarily associated with the periphery of germ cell nuclei (Fig. 1a, b and Supplementary Fig. 1a). However, when eggd-1 was deleted in either pgl-1::gfp or pgl-1::rfp strains, it resulted in the dispersal of perinuclear PGL-1 and accumulation of PGL-1 aggregates at the rachis (Fig. 1a, b)24. The remaining PGL-1::GFP foci at the eggd-1 nuclear periphery appeared to associate with the nuclear pore protein NPP-11 (Supplementary Fig. 1a)32. Of note, the dispersal of PGL-3, another member of the PGL family, was previously observed when mip-1/eggd-1 was depleted26. Furthermore, we sought to examine GFP::ZNFX-1 and GFP::MUT-16 expression and found weaker fluorescence signals at the periphery of germ cell nuclei in eggd-1 mutants relative to wild-type animals (Fig. 1a, b). Similar to PGL-1::GFP and PGL-1::RFP foci, both GFP::ZNFX-1 and GFP::MUT-16 foci were accumulated at the rachis upon deletion of eggd-1 (Fig. 1a, b).
We next measured the volume of PZM granules at wild-type nuclear membranes, eggd-1 nuclear membranes, and eggd-1 rachis. The mean volume of PGL-1::RFP granules at the eggd-1 nuclear membrane was 2.64-fold smaller than that of wild-type animals, decreasing from 0.482 µm3 to 0.183 µm3 (Supplementary Fig. 1b). In contrast, there was a 1.96-fold increase in the mean volume of PGL-1::RFP granules at the eggd-1 rachis (0.947 µm3) compared to that at the wild-type nuclear membrane (0.482 µm3) (Supplementary Fig. 1b). This increase was due to the presence of abnormally large PGL-1::RFP granules which could reach up to 25 µm3 in the eggd-1 rachis (Fig. 1b and Supplementary Fig. 1b). We also noted a similar expression pattern for PGL-1::GFP foci. The mean volume of PGL-1::GFP granules at the eggd-1 nuclear periphery was 2.77-fold smaller than that of wild-type animals, reducing from 0.332 µm3 to 0.120 µm3 (Supplementary Fig. 1c). While large PGL-1::GFP foci were observed at the eggd-1 rachis, their size was smaller than cytoplasmic PGL-1::RFP foci (Supplementary Fig. 1b, c). For GFP::ZNFX-1 granules, the mean volume at the eggd-1 nuclear periphery and rachis decreased 2.32 fold and 1.64 fold respectively, when compared to wild-type perinuclear granules (Supplementary Fig. 1d). On the other hand, the mean volume of GFP::MUT-16 in eggd-1 mutants only modestly changed compared to wild-type (Supplementary Fig. 1e). We next examined the organization of PGL-1::RFP and GFP::ZNFX-1 granules. Consistent with previous findings16, GFP::ZNFX-1 granules were separated from and adjacent to PGL-1::RFP foci in wild-type animals (Fig. 1c). Despite reduced signals, PGL-1::RFP and GFP::ZNFX-1 foci remained compartmentalized at the eggd-1 nuclear periphery (Fig. 1c). At the eggd-1 rachis, PGL-1::RFP and GFP::ZNFX-1 foci remained separate. Notably, multiple GFP::ZNFX-1 foci were often found to localize to the surface of a single large PGL-1::RFP granule (Fig. 1c). Considering the impact of fluorescent tags on protein phase-transition properties31, we proceeded to evaluate the organization of PGL-1::GFP and RFP::ZNFX-1 granules. PGL-1::GFP and RFP::ZNFX-1 remained separate at the nuclear peripheries of wild-type and eggd-1, as well as at the eggd-1 rachis (Supplementary Fig. 1f). These findings suggest that P granules and Z granules demix into distinct sub-compartments, regardless of their association with the nuclear membrane.
We next asked how large cytoplasmic granules are formed in the eggd-1 mutant germ line. To answer this question, we utilized time-lapse DIC and confocal fluorescence microscopy to examine dynamics of PGL-1::RFP. We observed that PGL-1::RFP granules at the eggd-1 rachis (indicated by yellow and cyan arrows) were more mobile than those at the nuclear periphery (indicated by magenta arrow) (Fig. 1d). Over time, PGL-1::RFP granules at the rachis transited the gonad—originating in mitotic region of the germ line and accumulating in maturing oocytes—presumably through cytoplasmic streaming (Fig. 1d)33. Time-lapse microscopy further revealed that large PGL-1::RFP granules were formed by collision and subsequent coalescence of smaller granules in the mitotic regions of the eggd-1 germ line (Fig. 1e). However, we also noted examples where PGL-1::RFP granules remained in contact but did not coalesce, suggesting that collision between granules does not always result in coalescence (Supplementary Fig. 1g). Taken together, our data suggest that EGGD-1 promotes the perinuclear localization of PZM granules, and that the coalescence of PGL-1::RFP foci can drive the formation of large cytoplasmic granules in the eggd-1 germ line.
Loss of eggd-1 affects a subset of endogenous RNAi pathways
Germ granules host different types of small RNAs3,5,34. RdRPs (RNA-dependent RNA Polymerases), such as RRF-1 and EGO-1, produce antisense siRNAs that target many germline expressing transcripts10,35,36,37. These siRNAs are mainly 22-nts (nucleotides) in length and start with 5′ guanine residues, are therefore referred to as 22G-RNAs34,38. 22G-RNAs are loaded into distinct AGO (Argonaute) proteins, including CSR-1 and WAGO-1 which localize to P granules, WAGO-4 which localizes to Z granules, the nuclear WAGO-9/HRDE-122,38,39,40. PRG-1/piRNAs recognize hundreds of germline transcripts and recruit RdRPs to initiate production of 22G-RNAs that are loaded into WAGOs7,8,41,42,43. The accumulation of WAGO class 22G-RNAs depends on MUT-16, a key component of Mutator foci15,44.
We sought to determine whether aberrant PZM granules in eggd-1 mutants lead to the mis-regulation of small RNAs. To this end, we cloned and sequenced small RNAs from synchronized wild-type and eggd-1 mutant adults. Our analysis revealed that 608 transcripts exhibited downregulated 22G-RNAs and 280 transcripts exhibited upregulated 22G-RNAs in eggd-1 mutants relative to wild-type (4-fold-change, p value < 0.05, Two-tailed t-test test) (Fig. 2a). To determine the affected AGO pathways in eggd-1 mutants, we categorized differentially expressed 22G-RNA loci based on the AGOs they associate with or the factors their biogenesis depends on (Fig. 2b). CSR-1 22G-RNAs and WAGO-4 (Z granule specific AGO) class 22G-RNAs were underrepresented in both upregulated and down-regulated gene sets, suggesting neither small RNA pathway was strongly disrupted in eggd-1 animals. In contrast, WAGO-1 class 22G-RNAs (1.4-fold enrichment), HRDE-1/WAGO-9 class 22G-RNAs (2.0-fold enrichment), PRG-1 dependent 22G-RNAs (1.9-fold enrichment), and MUT-16 dependent 22G-RNAs (1.8-fold enrichment) were overrepresented in the downregulated set, but underrepresented in the upregulated set (Fig. 2b). These data indicate that EGGD-1 is required for the production of 22G-RNAs in the WAGO pathway.
C. elegans piRNAs are derived from over 15,000 discrete piRNA producing loci19,45,46,47. After 5′ and 3′ processing, mature piRNAs have a uniform length of 21-nts, start with a 5′ monophosphorylated uridine, and are 2′ O-methylated at the 3′ end48,49,50,51. We found that the overall abundance of piRNAs was slightly increased in eggd-1 mutants, with a 1.56-fold increase in median abundance compared to wild-type (Fig. 2c). In C. elegans, specific piRNAs are enriched in male or female germ lines52,53. While the abundance of female and gender-neutral piRNAs was comparable between eggd-1 mutants and wild-type, male-specific piRNAs were elevated in eggd-1 mutants. (Supplementary Fig. 2). Because PARN-1 (the piRNA 3′ trimming enzyme) and HENN-1 (The piRNA 3′ methyltransferase) are enriched in perinuclear granules48,54, we next examined if piRNA 3′ processing is altered upon loss of eggd-1. In both wild-type and eggd-1 animals, piRNAs are 21-nts in length (Fig. 2d). To determine the methylation status of piRNAs, we carried out sodium periodate-mediated oxidation experiments and sequenced oxidation-resistant small RNAs. The vicinal diol at 3′ termini of unmodified RNAs can be oxidized to a dialdehyde, rendering them poor substrates for small RNA cloning whereas RNAs with terminal 2′-O-methylation are resistant to oxidation. piRNAs in both wild-type and eggd-1 animals are comparably enriched by oxidation when normalized to total number of reads (Fig. 2e). Taken together, our results indicate that piRNA biogenesis is mostly unaltered in eggd-1 mutants, but there is an abnormal accumulation of male-specific piRNAs.
The unexpected finding that eggd-1 hermaphrodites aberrantly express male piRNAs prompted us to examine male-specific ALG-3/4 siRNA pathways. Argonaute proteins—ALG-3 and ALG-4—are loaded with 26G-RNAs that target a set of male transcripts55,56,57. ALG-3/4 class 26G-RNAs are exclusively expressed during spermatogenesis and are required for male fertility at elevated temperatures55,56,57. In wild-type animals, the median abundance of 26G-RNAs per gene was 0.13 RPM (Reads per Million) (Fig. 2f). However, their median abundance was increased to 0.47 RPM when eggd-1 was mutated (Fig. 2f). We conclude that male specific piRNAs and ALG-3/4 26G-RNAs are also expressed in eggd-1 hermaphrodites.
Expression of Argonaute proteins in eggd-1 mutants
Next, we investigated whether the expression of individual AGOs is affected by loss of eggd-1. To this end, We introduced a full eggd-1 open reading frame deletion allele into strains of prg-1, wago-1, wago-9/hrde-1, and csr-1, which were endogenously tagged with GFP58. Germ granules have reduced retention at nuclear periphery and become dispersed at the rachis when eggd-1 was depleted (Fig. 1)24,26. Therefore, to assess the impact of eggd-1 loss on each GFP::AGO protein, we quantified GFP signals of individual germ nuclei and signals at the rachis (Supplementary Fig. 3a, b). Given that AGO proteins exhibit varying expression levels, we adjusted the exposure times and laser intensities accordingly to capture the individual GFP::AGO proteins, while maintaining the identical experimental conditions between the wild-type and eggd-1 strains. We found less perinuclear GFP::WAGO-1, GFP::PRG-1 and GFP::CSR-1 in eggd-1 mutants compared to wild-type (Fig. 3a, b, c and Supplementary Fig. 3a). Specifically, the median intensity of GFP::WAGO-1, GFP::PRG-1 and GFP::CSR-1 reduced by 1.34-, 1.38- and 1.22-fold, respectively (Supplementary Fig. 3a). In contrast, the nuclear GFP::WAGO-9/HRDE-1 signals were comparable between wild-type and eggd-1 mutants (Fig. 3d and Supplementary Fig. 3b), even though GFP::WAGO-9/HRDE-1 class 22G-RNA levels were reduced (Fig. 2b). When quantifying the rachis versus total signals from cross-section images of the gonad, we observed a general increase from strains expressing GFP::WAGO-1, GFP::PRG-1, GFP::CSR-1 upon loss of eggd-1 (Fig. 3a, b, c and Supplementary Fig. 3b). Notably, not all the AGOs are affected to the same degree in eggd-1 mutants. For example, GFP::PRG-1 exhibited the strongest accumulation in the rachis (median ratio was increased from 0.336 in wild-type to 0.570 in eggd-1 animals) (Fig. 3b and Supplementary Fig. 3b), while GFP::CSR-1 showed only a modest accumulation in the rachis (Fig. 3c and Supplementary Fig. 3b). Taken together, our findings suggest that EGGD-1 is required for proper perinuclear localization of AGOs, particularly the PRG-1 protein.
EGGD-1 is required for piRNA-mediated gene silencing
The finding that PRG-1 is mis-localized in eggd-1 mutants prompted us to investigate if eggd-1 mutants are defective in piRNA-mediated transgene silencing. Through base-pairing interactions, C. elegans piRNAs target newly introduced transgenes and some endogenous transcripts, and initiate 22G-RNA production7,8,41,42,59. PRG-1/piRNAs complexes are required for initiating the silencing of transgenes, but not for maintaining it7,8,41,42. We employed an established piRNA sensor strain to determine the role of eggd-1 in initiation of piRNA-mediated silencing60,61. The piRNA sensor was 100% silenced in wild-type germ line (Fig. 4a)60,61. However, when transcription factors involved in piRNA expression, such as TOFU-5 and SNPC-4, were depleted by RNAi62,63,64, the sensor became de-silenced (Fig. 4a, b). Depletion of eggd-1 by RNAi also led to de-silencing of the piRNA sensor (Fig. 4b), indicating that EGGD-1 is necessary for piRNA-mediated silencing.
To further test if EGGD-1 is involved in the initiation or maintenance of piRNA-mediated silencing, we used reporter strains with gfp::h2b transgenes containing or lacking a piRNA target site8. Consistent with previous studies8, gfp::h2b became silenced only when the piRNA target site was present (Supplementary Fig. 4a, b). We introduced prg-1 or eggd-1 mutations to the silenced transgene by genetic crosses and propagated the strains for approximately 16 generations. In the absence of prg-1, the reporter remained 100% silenced. Similarly, the reporter was not de-silenced in eggd-1 mutants (Supplementary Fig. 4b, c). Therefore, once transgene reporter became silenced, neither prg-1 nor eggd-1 is required for maintaining silencing. Combined with the observations of reduced PRG-1-dependent 22G-RNAs (Fig. 2b) and mis-localization of PRG-1 (Fig. 3b) in eggd-1 mutants, our findings suggest that perinuclear PRG-1/piRNAs may be crucial for the initiation of piRNA-mediated silencing.
EGGD-1 is dispensable for initiation and inheritance of RNAi
After identifying defects in the expression of germline AGOs (Fig. 3), we next asked if eggd-1 mutants are defective in RNAi (RNA interference)65. In C. elegans, RNAi can be induced experimentally by feeding worms bacteria that express dsRNAs (double stranded RNAs) targeting specific transcripts66. To test RNAi competency, we exposed worms to dsRNA against the pos-1 gene, which must be expressed maternally to support embryonic development67. Exposure of wild-type animals to pos-1 dsRNA led to 100% embryonic lethality (Fig. 4c)68. Consistent with previous findings68, deletion of rde-1, which encodes the primary AGO required for exogenous RNAi, rendered animals fully resistant to pos-1 RNAi (Fig. 4c). Mild embryonic lethality was observed in eggd-1 and eggd-1; eggd-2 mutant animals exposed to control RNAi (Fig. 4c)26. Upon pos-1 dsRNA treatment, eggd-1, eggd-2, and eggd-1; eggd-2 double mutants produced no viable progeny (Fig. 4c). We conclude that eggd-1 and eggd-2 mutants are RNAi competent and that germ granule integrity may not be essential for RNAi.
In C. elegans, the introduction of dsRNAs can trigger gene silencing that can persist for multiple generations, even in the absence of further dsRNA exposure, a process known as RNAi inheritance40,69,70. To evaluate the role of EGGD proteins in dsRNA-induced RNAi inheritance, we employed a reporter strain that expresses a gfp::h2b transgene under a germline specific promoter10,16,71,72. We crossed eggd-1 and eggd-2 mutants to the reporter strain. The eggd-1; eggd-2 double mutants were excluded from this analysis due to their severe germline atrophy and rapid decline in fertility over generations24,26. As expected, exposure of wild-type animals to gfp dsRNAs led to the complete silencing of gfp::h2b at the P0 generation. After dsRNA triggers were removed, gfp::h2b were gradually de-silenced. The silencing lasted for up to ~5 generations (Fig. 4d)10,16,71,72. Similar to wild-type animals, eggd-1 and eggd-2 mutants displayed fully penetrant GFP::H2B silencing at the P0 generation. Surprisingly, GFP::H2B silencing persisted longer in eggd-1 and eggd-2 mutants, suggesting enhanced transgenerational RNAi inheritance (Fig. 4d). Such prolonged RNAi heritance was also observed in prg-1 mutants73. Taken together, our findings indicate that the LOTUS domain proteins EGGD-1 and EGGD-2 limit RNAi inheritance.
Spermatogenic genes are upregulated in eggd-1 hermaphrodites
The finding of the aberrant expression of small RNAs in eggd-1 mutants motivated us to profile their transcriptome. To this end, we prepared and sequenced ribosomal RNA depleted RNA samples from synchronized wild-type and eggd-1 mutant adults. Applying DESeq2 for differential expression analysis74, we identified 1024 upregulated transcripts and 133 downregulated transcripts (including the eggd-1 transcript itself) in eggd-1 animals compared to wild-type (fourfold-change, p adjusted value < 0.05) (Fig. 5a). Two analyses were conducted to investigate the upregulated gene dataset (n = 1024). First, we performed tissue enrichment analysis75, which revealed a significant enrichment of genes involved in male development (Fig. 5b). Second, we compared our dataset with a previously published study in which spermatogenic, oogenic, and gender-neutral germ line-expressed genes were defined76. Notably, there was a considerable overlap of eggd-1 upregulated genes with spermatogenic genes, while there were few overlaps with oogenic genes (Fig. 5c). It was intriguing that certain spermatogenic genes were significantly upregulated while some appeared unchanged in eggd-1 mutants (Fig. 5a, c). To further investigate this finding, we plotted the fold-change of transcripts in eggd-1 relative to wild-type against the fold-change of transcripts in male (fem-3) compared to female (fog-2) (Supplementary Fig. 5a). This analysis revealed a strong positive correlation (Pearson correlation, r = 0.68, p value < 0.05). Transcripts highly enriched in male (fem-3) displayed significant upregulation in eggd-1 compared to wild-type, while transcripts with modest enrichment in male (fem-3) showed modest or no change (Supplementary Fig. 5a). These global analyses revealed a general upregulation of spermatogenic genes in eggd-1 mutants, which we further validated by examining individual genes. For instance, alg-3, which encodes a male-specific AGO, and gsp-3, which encodes a sperm-specific PP1 phosphatase are exclusively expressed in male (fem-3) (Fig. 5d, e and Supplementary Fig. 5a). Both genes showed strong upregulation in eggd-1 mutants (Fig. 5d, e and Supplementary Fig. 5a)55,56,77. In contrast, spe-44, a gene encoding a transcription factor78, is highly expressed in male (fem-3) but also modestly expressed in female (fog-2). We found that the expression of spe-44 was unaffected upon loss of eggd-1 (Supplementary Fig. 5a, b).
In light of the upregulation of spermatogenic genes, we conducted experiments to determine whether eggd-1 mutants exhibited the MOG phenotype (masculinization of the germ line). We cultured synchronized wild-type and eggd-1 L1 larvae and subsequently examined the germ line of L4/adult worms using brightfield microscopy as well as fluorescence microscopy with DAPI staining to aid in the visualization of sperm. As a positive control, we employed RNAi against mog-4, a gene encoding a DEAH-Box protein79. We used the following criteria to determine the MOG phenotype: 1. Completion of vulval development. 2. Absence of oocytes, and 3. Presence of excess sperm in the germ line. While the majority of mog-4 dsRNA treated animals displayed the MOG phenotype, none of the wild-type animals exhibited it (Fig. 5f, g). Out of the 570 eggd-1 worms that were imaged, we only identified one hermaphrodite exhibiting the MOG phenotype and one male (Fig. 5f, g). These findings suggest that the upregulation of spermatogenic genes in eggd-1 mutants is unlikely to be a result of the masculinization of the germ line.
Cuticle genes are upregulated in eggd-1 hermaphrodites
Our tissue enrichment analysis showed that genes expressed in the epithelial system were upregulated in eggd-1 mutants (Fig. 5b). This finding was corroborated by Gene Ontology (GO) enrichment analysis80. In our examination of the upregulated genes in eggd-1 mutants (n = 1024), we found that the most enriched GO term in the domain of Biological Process was “structural constituent of cuticle” (Fig. 6a). We constructed the interaction network of eggd-1 upregulated genes using publicly available protein-protein interaction data81. The resulting network contained 987 nodes and 69,888 non-redundant edges (Supplementary Fig. 5c). The number of edges was significantly higher than expected edges by chance (p value < 1.0−16), suggesting that these genes are biologically connected as functional groups. Indeed, we identified two main clusters: one enriched for genes involved in spermatogenesis and the other enriched for cuticle-related genes (Supplementary Fig. 5c). Taken together our analyses reveal that germ granule integrity represses the expression of spermatogenic genes and cuticle-related genes.
HLH-30 is involved in germline-to-soma communication
The observation of overexpressed cuticle-related genes upon eggd-1 mutation is intriguing, given that EGGD-1 is primarily expressed in the gonad and germ lineage of embryos24,26. The question arose as to whether the aberrant overexpression of cuticle-related genes was occurring in the germ line or in somatic tissues. To answer this question, we monitored the expression of collagens—major components of C. elegans cuticles. We used an established col-12p::DsRed transcriptional reporter in which DsRed is expressed under the col-12 promoter82. Wild-type young adults displayed weak DsRed signals, whereas eggd-1 mutants exhibited significantly higher signals in both the hypodermis and intestine (Fig. 6b). Consistent with this finding, the transcript level of col-12 was significantly increased in eggd-1 mutants relative to wild-type.
To determine the molecular mechanism for col-12 upregulation, we sought to identify transcription factor(s) associated with the col-12 promoter and potentially drive its transcription. To this end, we examined chromatin immunoprecipitation-sequencing (CHIP-seq) datasets of a wide variety of transcription factors from the modENCODE project83. This unbiased search revealed that transcription factors DAF-16 and HLH-30 occupy the col-12 promoter under the physiological condition (Supplementary Fig. 6a). By analyzing published HLH-30 CHIP-seq data83, we defined 5158 potential targets of HLH-30. The promoters of 29 genes that are associated with cuticle development exhibited binding of HLH-30 (Supplementary Fig. 6b). Additionally, in our analysis of transcription factor binding site enrichment80, we noted a significant overrepresentation of the HLH-30 binding motif in the dataset of genes upregulated in eggd-1 mutants (n = 1024) (Supplementary Fig. 6c). Among the upregulated gene set, the promoters of 94 genes displayed HLH-30 occupancy (Supplementary Fig. 6b). These findings prompted us to assess the expression and activity of HLH-30 and DAF-16. Transcription factors HLH-30 and DAF-16 are widely expressed in many tissues and diffused within the cell. In response to external stresses or germline ablation, both transcription factors enter the nuclei of somatic cells including intestinal cells and neurons28,29. By promoting the transcription of their target genes, HLH-30 and DAF-16 play essential role in stress responses and lifespan extension28,29,84. We obtained CRISPR/Cas9-engineered strains expressing DAF-16::mKate2 or HLH-30::GFP85,86, and examined their expression in the intestine—an easy-to-score and functionally relevant tissue84. Consistent with previous reports28,29, both DAF-16::mKate2 and HLH-30::GFP were present at a low level in intestinal nuclei of wild-type young adults (Fig. 6c and Supplementary Fig. 6d). DAF-16::mKate2 translocated to the nucleus under heat stress, but did not accumulate upon depletion of eggd-1 (Supplementary Fig. 6d). In contrast, deletion or depletion of eggd-1 led to elevated levels of HLH-30::GFP in intestinal nuclei, but not in germ nuclei (Fig. 6c). We next wished to determine if the accumulation of nuclear HLH-30 is responsible for activation of col-12 in eggd-1 mutants. We used RNAi to deplete hlh-30 in the presence of the col-12p::DsRed reporter and found that knockdown of hlh-30 lowered DsRed levels in eggd-1 mutant animals (Fig. 6b).
Next, we asked whether defective P granules in general activates HLH-30 and/or elicit upregulation of collagen. Previous work showed that depletion of csr-1 or ego-1 led to the accumulation of large and irregular P granules39,87,88. Furthermore, P granule can be efficiently depleted by simultaneously targeting four main P granule components glh-1, glh-4, pgl-1, and pgl-3, a strategy referred to as P granule RNAi89. Upon exposure to csr-1 RNAi, ego-1 RNAi, or P granule RNAi, the col-12p::DsRed reporter displayed an increase in DsRed fluorescent signals when compared to control RNAi. Furthermore, All three RNAi treatments led to accumulation of nuclear HLH-30::GFP in the intestine, but not in the germ line (Fig. 6d). Collectively, our findings suggest that proper formation of germ granules acts to suppress the accumulation of nuclear HLH-30 and repress the expression of collagen genes such as col-12 in the soma.
We next sought to determine the underlying cause of HLH-30 activation and somatic col-12 overexpression in eggd-1 mutants. Previous and current studies have demonstrated the crucial role of EGGD-1 in germline maintenance, oocyte development, and suppression of spermatogenic genes in hermaphrodites (Fig. 5)24,26. This led us to speculate whether defects in oogenesis and/or activation of spermatogenic genes could be responsible for the abnormal col-12 expression. To explore this idea, we generated the sun-1p::rde-1; col-12p::DsRed; rde-1 strain in which the endogenous rde-1 gene is mutated and a single-copy rde-1 transgene is expressed under the germline-specific sun-1 promoter90. This strain, which is somatic RNAi deficient but germline RNAi competent, allowed us to examine the effects of germline-specific knockdown90. Consistent with a previous report91, depletion of LIN-41, a TRIM-NHL protein, resulted in a decrease in the size of germ line and complete loss of oocytes (Fig. 7a). However, P granule formation, indicated by PGL-1::RFP expression, appeared unaffected by lin-41 depletion (Fig. 7a). Depletion of lin-41 in sun-1p::rde-1; col-12p::DsRed; rde-1 strain did not alter col-12p::DsRed expression (Fig. 7b), indicating defective oogenesis is not responsible for the col-12 activation. We next induced the expression of male genes in hermaphrodites by depleting key regulatory proteins in the sex determination pathway, including DEAH-box proteins MOG-4 and MOG-579. A previous study has shown that loss of mog-4, or mog-5 leads to the germline masculinization79. Indeed, we observed disorganized and masculinized germ line upon the depletion of mog-4 or mog-5 (Fig. 7a). Furthermore, mog-4 knockdown significantly reduced PGL-1::RFP levels, while mog-5 knockdown modestly reduced PGL-1::RFP expression (Fig. 7a). Upon exposure to mog-4 or mog-5 dsRNAs, the sun-1p::rde-1; col-12p::DsRed; rde-1 reporter displayed increased DsRed fluorescent signals (Fig. 7b). Taken together, our findings suggest that aberrant expression of spermatogenic genes in hermaphrodites may contribute to the elevated somatic expression of col-12.
Discussion
Germ granules across species are characterized as perinuclear structures1,2,3,4,5,6. High-resolution microscopy revealed that germ granules in C. elegans are separated into distinct sub-compartments15,16,17. The unique perinuclear organization of germ granules raises several questions. Why and how are germ granules associated with nuclear membrane? How are sub-compartments formed and maintained? LOTUS domain containing proteins have emerged as pivotal regulators in germ granule organization. Oskar, containing both LOTUS and OSK domains, organize germ plasms in Drosophila92. TDRD5 and TDRD7 possess LOTUS and Tudor domains and are indispensable for germ granule formation in mice93,94,95. Recent studies conducted on C. elegans established an essential role of LOTUS domain proteins in facilitating perinuclear localization of germ granules24,26,96. Here, using a series of microscopy and genetic experiments, we demonstrated that the LOTUS domain protein EGGD-1 is required for the proper formation of germ granule sub-compartments including P granules, Mutator foci and Z granules (Fig. 7c). Upon loss of eggd-1, large PGL-1 aggregates are accumulated at the rachis of gonad, possibly resulting from the coalescence of small cytoplasmic granules. Although these large PGL-1 aggregates are in close contact with one or multiple ZNFX-1 foci, PGL-1, and ZNFX-1 granules remain largely separated (Fig. 1). Our findings suggest that the association of germ granules with the nuclear membrane, possibly through nuclear pores, prevents their coalescence. Moreover, demixing of germ granules into sub-compartments is independent of their association with the nuclear membrane.
Our study, which combines small RNA profiling and genetic experiments, suggests that the perinuclear localization of germ granules promotes small RNA biogenesis and transcriptome surveillance. A specific set of AGO proteins and key RNA processing enzymes are enriched at C. elegans germ granules3,4. It has been proposed that these AGO proteins and their small RNA co-factors, including piRNAs and 22G-RNAs, surveil transcripts as they exit the nucleus. Such surveillance recognizes and silences non-self sequences and permits the expression of germline expressing genes7,8,41,42,43. Consistent with this idea, our findings indicate that PRG-1/piRNA mediated surveillance was compromised in eggd-1 mutants, presumably because PRG-1/piRNA failed to robustly localize to perinuclear germ granules (Fig. 7c). On the contrary, exogenous RNAi appears to be intact, or even enhanced over generations in eggd-1 mutant animals (Fig. 4c). Three silencing pathways engaging nuclear WAGO protein HRDE-1, perinuclear WAGO-1 and WAGO-4, and cytoplasmic WAGO proteins including RDE-1 and PPW-1, are thought to promote robust exogenous RNAi responses9,22,34,38,97. Thanks to these partially redundant silencing pathways, it is possible that the integrity of perinuclear granules is dispensable for RNAi. Furthermore, we envision that depletion of endogenous 22G-RNAs upon eggd-1 deletion can free up WAGOs and postulate that surplus WAGOs can be loaded with exogenous 22G-RNAs to elicit enhanced RNAi responses.
C. elegans hermaphrodites produce both sperm and oocytes. The germ line initiates spermatogenesis at the L4 larval stage, and then switches to oogenesis during the adult stage. Previous studies reported that EGGD-1 is essential for germline development and fertility24,26. Here our transcriptome and small RNA profiling data revealed that male specific small RNAs and a set of spermatogenic genes are upregulated in eggd-1 mutant adults. While it is plausible that loss of eggd-1 leads to incomplete shutdown of spermatogenesis during the sperm-to-oocyte switch, we cannot rule out the possibility of reactivation of the spermatogenesis program during oogenesis. Recent studies suggest that the expression of spermatogenic mRNAs during sperm-to-oocyte switch is repressed by Piwi protein PRG-1, AGO protein CSR-1, WAGO-pathway factor RDE-3, Mutator foci factor MUT-16 and additional P granule components44,60,98,99. These findings, combined with our work, provide a unifying model that germ granules and endogenous siRNA pathways play a crucial role in promoting the sperm-to-oocyte transition. Failure to suppress spermatogenesis during oogenesis perhaps leads to defective germ cells, which contributes to infertility.
Our study uncovered communication between the germ line and soma that results from germ granule stress (Fig. 7c). It has been proposed that C. elegans germ granules play a crucial role in repressing the expression of somatic genes in the germ line and prevent germ cells from undergoing somatic development89,100. This model describes germ granules as the safeguard for germline transcriptome. To our surprise, we found that depletion of key germ granule components such as eggd-1, csr-1 or ego-1 causes the accumulation of HLH-30 in the nucleus of somatic cells, but not in the germ nuclei (Fig. 6). Using a transcriptional reporter monitoring collagen expression82, we showed that the nuclear accumulation of HLH-30 promotes the expression of at least one collagen gene in soma. HLH-30 and its mammalian homolog TFEB translocate to the nucleus in response to various stresses including nutrient deprivation, heat stress and germline ablation28,29. By regulating autophagy-related and aging-related genes, HLH-30 is essential for lifespan extension and stress responses28,29. The lack or disorganization of germ granules in the germ line may constitute some form of stress, which triggers the accumulation of HLH-30 in somatic nuclei. Nuclear HLH-30 activates its targets such as some collagen genes, which may translate distress signals into developmental decisions. In future work, it will be exciting to explore the physiological roles of germ granules in stress responses, stress resistance, and longevity.
Methods
Strains
Worms were grown under standard conditions at 20 oC unless otherwise indicated101. The Bristol N2 strain serves as wild type. The list of strains used in this study is supplied in the Supplementary Data File 1.
CRISPR genome editing
Deletion of eggd-1 CDS in gfp::wago-9 to make WHY612 was achieved using CRISPR-Cas9 genome editing24. Two CRISPR guide RNAs (IDT) targeting the open reading frame of eggd-1 (upstream: GACATTCACTTGGCAAATGA; downstream: TCGGATAAGGATAGTTGGTG) were injected with a single-stranded DNA donor: ATGTTCTCTCAGAAGTGACATTCACTTGGCAAATGCTCGAGTGATCGAAATTTTACGTGCTTTAAAATATCCTGTT. The vector pRF4 containing a dominant allele of rol-6 was used as a co-injection marker102. Roller F1 were picked and the eggd-1 deletion was screened for by PCR.
RNAi by dsRNA feeding
The HT115 RNAi feeding strains were picked from the C. elegans Ahringer RNAi Collection (Source Biosciences). NGM plates containing 50 µg/ml ampicillin and 5 mM IPTG were seeded with HT115 bacteria expressing dsRNAs against the target gene. Worms synchronized by bleaching were plated on the RNAi plates and imaged after 2–3 days. To assay germline RNAi competence, ~100 synchronized L1 larvae per strain were plated to pos-1 RNAi or L4440 RNAi plates until adulthood. After ~80 h, 15 adults were transferred to a single NGM plate in three replicates for 3 h and then removed. Laid eggs were counted, and the subsequent day hatched F1 were counted to score embryonic viability. RNAi inheritance was assayed by plating 3 replicates of 200 synchronized L1 reporters to NGM plates seeded with HT115 expressing GFP dsRNA at 20 °C. Approximately 60 h after plating, 50 young adult worms of each genotype were imaged to score silencing of a GFP::H2B transgene in the germ line. The remaining animals were used to obtain a synchronized population by hypochlorite lysis. Subsequent generations were propagated on NGM plates seed with OP50. Each generation, 50 worms per replicate were scored as GFP-off (silenced) or GFP-on (de-silenced) by fluorescence microscopy. Some eggd-1 and eggd-2 animals were excluded from analysis due to a complete lack of germ cell nuclei.
Microscopy
Live animals were immobilized in M9 medium containing 2 mM levamisole and 0.1 μm polystyrene beads (Polysciences) and mounted on glass slides with 5% agar pads. Widefield fluorescent images were acquired using a Nikon Ti2 inverted microscope equipped with a Hamamatsu ORCA-Fusion C14440 detector using a Plan Apo 40×/0.95NA objective in NIS-Elements AR 5.41.02. Spinning disc confocal images were taken in MetaMorph version 7.10.4.452 on a Nikon TiE inverted microscope equipped with an Andor Revolution WD spinning disc system and a pco.Edge bi 4.2 sCMOS detector using a CFI Plan Apo VC 60×/1.2NA water immersion objective or a CFI Plan Apo VC 100×/1.4NA oil immersion objective at room temperature (21–23 °C). For co-localization and granule volume quantification experiments, special care was taken to avoid imaging-associated stress and temperature fluctuations that can affect granule assembly103,104: worms were kept in incubators at standard growth conditions until immediately before mounting on slides. Slides were then imaged at an ambient temperature of 19–21 °C for no longer than 10 min.
Quantification of Argonaute protein expression
GFP::PRG-1, GFP::WAGO-1, GFP::WAGO-9/HRDE-1, and GFP::CSR-1 samples were prepared following the procedures described in the Microscopy section. Z stacks were acquired using the 60x water objective with 1 μm step size. Different exposure times and laser intensities were applied to capture individual GFP::AGOs, while identical parameters were applied between the wild-type and paired eggd-1 strains. In ImageJ105, the background signal was determined by selecting an area outside of animals, and subsequently subtracted from the images. To quantify Argonaute protein levels, germ nuclei on the surface of the gonad were selected and the mean intensity of GFP signals were measured. This process was repeated for 25 nuclei per animal. To access the ratio of rachis signals over to total signals, cross sections were extracted from Z stacks. The entire pachytene and rachis regions were selected, and integrated densities were measured to quantify the relative abundance of rachis signals in comparison to the overall signal intensity.
Imaging and processing of col-12p::DsRed, hlh-30::gfp, and piRNA sensor
The reporters in wild-type and mutant backgrounds, as well as those subjected to with RNAi treatments, were prepared following the procedures outlined in the Microscopy section. Z stacks were acquired using a 60x water objective with a 1 μm step size. Using ImageJ105, the background signal was determined by measuring the average intensity of an area outside of the worm, and this background signal was subtracted from all z planes. An average intensity projection was used to capture col-12p::DsRed signals. A single plane from the z stack was used to create images of HLH-30::GFP. A maximum intensity projection was created to capture signals of piRNA sensors.
Quantification of germ granule volumes
Confocal z stacks with a 0.2 µm step size were acquired using a 100× objective with the microscope described in the Microscopy section of the methods. For perinuclear granule volume quantification, 15 nuclei from 3 separate animals were selected for PGL-1::GFP, PGL-1::RFP, GFP::ZNFX-1, and GFP::MUT-16 wild-type and eggd-1 mutants. In ImageJ105, background signal was subtracted by measuring the average intensity of a region of interest outside the worm and subtracting the ROI (Region Of Interest) mean value from the image. Segmentation thresholds were determined using background-subtracted wild-type nuclei by generating a maximum intensity projection of the z stack of the nucleus and using the auto threshold function with the Li threshold algorithm. The 3D simple segmentation plugin was then used to apply the median threshold value of the wild type nuclei to each nuclear z-stack. The resulting segmented images were added to the 3D ROI Manager plugin and the Measure 3D function was used to determine the volume of each granule. To determine the volume of granules localizing to the rachis, a region of interest was drawn to encompass the rachis in four separate germ lines which were segmented and measured as described above. Granule volumes were exported as.csv files and plotted in R using the ggplot2 package.
Analysis of masculinization of the germ line (MOG) phenotype
N2 and eggd-1 animal were synchronized by hypochlorite lysis and plated to NGM seeded with OP50 or HT115 expressing mog-4 dsRNAs (N2 only). N2 and eggd-1 worms were harvested after 72 h of growth at 20 °C. Due to slow growth, mog-4 RNAi-treated worms were harvested at 96 h after plating. Harvested worms were suspended with M9 buffer, washed twice with M9 buffer, then twice with ddH2O and transferred to −20 °C methanol for 20 min. The worms were then transferred to 100% acetone for 20 min at −20 °C, ddH2O for 20 min at 4 °C, and PBS for 20 min at 4 °C. PBS was removed and Worms were suspended in Vectashield mounting medium with DAPI (Vector Laboratories) and transferred to slides for imaging. Transmitted light and DAPI fluorescence images were acquired using a Nikon Ti2 inverted microscope at 20× magnification. To evaluate for a MOG phenotype, each worm imaged was inspected for 1. Completion of vulval development. 2. Absence of oocytes, and 3. Presence of excess sperm in the germ line. Worms that fulfilled all criteria were scored as MOG.
Total RNA extraction
Approximately 50,000 synchronized adult worms were collected with M9 using a glass Pasteur pipette. The worms were washed once with M9, rocked in fresh M9 for 5 min, washed once in ddH2O, and resuspended suspended in 1 ml of TRI Reagent (Sigma). Worms were lysed using the Bead Mill 24 homogenizer (Thermo Fisher Scientific) and the lysate was transferred to a clean tube 1.5 ml centrifuge tube. 0.1 volumes of bromochloropropane were added to the mix and shaken by hand for 30 s. The mixture was then centrifuged at 15,000 × g and the aqueous phase was transferred to a fresh 1.5 ml microcentrifuge tube, followed by the addition of 1 volume of isopropanol. The tube was incubated at −20 °C for 1 h to precipitate RNA and centrifuged for 15 min at 15,000 × g at 4 °C. The supernatant removed by pipetting and the pellet was washed twice by adding 1 mL 75% ethanol. The pellet of RNA was allowed to dry for 3 min to remove remaining ethanol, dissolved in ddH2O and stored at −80 °C.
Small RNA cloning
Small RNAs were enriched using MirVana miRNA Isolation Kit (Thermo Fisher Scientific), according to the manufacturer’s instructions. β–elimination was performed as described54. Small RNA-sequencing libraries were constructed following an previously established protocol106. Briefly, Small RNA samples were treated with the polyphosphatase PIR-1 to remove γ and β phosphates from 5′-triphosphorylated RNAs107. The monophosphorylated RNAs were ligated to a 3′ adapter (5′rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3’, IDT) using T4 RNA ligase 2 (NEB) at 15 °C overnight. T4 RNA ligase 1 (NEB) was used to ligate the 5′ adapter (rArCrArCrUrCrUrUrUrCrCrCrUrArCrArCrGrArCrGrCrUrCrUrUrCrCrGrArUrCrU, IDT). The ligated products were converted to cDNA using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific). The cDNAs were further amplified by PCR, and small RNA libraries with unique barcodes were pooled and sequenced using the Novaseq platform (SP 2 × 50 bp, Illumina).
mRNA library preparation
Ribosomal RNAs were depleted using the RNase H method108. 3 μg total RNA were incubated with antisense DNA oligonucleotides targeting C. elegans and E. coli ribosomal RNAs, then treated with Hybridase Thermostable RNase H (Biosearch Technologies) at 45 °C for 30 min. The rRNA-depleted samples were treated with Turbo DNase (Thermo Fisher Scientific) at 37 °C for 30 min. RNAs longer than 200 nts were enriched using RNA Clean & Concentrator-5 (Zymo Research). mRNA sequencing libraries were constructed using Ultra II Directional RNA Library Prep Kit (NEB), according to the manufacturer’s instructions. The library samples with unique barcodes were pooled and sequenced at the Illumina HiSeq 4000 platform (PE 150 bp).
Bioinformatic analysis of small RNA sequencing data
Raw small RNA sequencing reads were trimmed of adapters and low-quality sequences using TrimGalore109 and then collapsed with a custom shell script. Collapsed reads were aligned to a reference containing structural RNA annotations including snRNA, snoRNA, tRNA, and ncRNA using the default Bowtie parameters. Reads that failed to align to structural RNAs were aligned to the C. elegans reference genome (WormBase Release WS279) using Bowtie with the parameters −v 0 −m 1000 −a—best –strata110. Aligned reads were then normalized to the number of locations mapped, and assigned to genomic features using BEDTools intersect and custom python scripts111. Sequences mapping to piRNA loci were required to map uniquely and perfectly (0 mismatch) in the sense orientation, contain a 5′ T, be 15-40 nucleotides in length, have a 5′ end mapping to the 0th, 1st, or 2nd, position of the piRNA annotation. 22G-RNAs were defined as sequences mapping to protein coding gene exons, pseudogene exons, lincRNAs, rRNAs, or transposable elements in the antisense orientation, with a 5′ G or A and 21–23 nucleotides long. 22G-RNA sequences were also required to map perfectly but were allowed to multi-map to 1000 locations. Reads mapped to rRNAs were given preference over other genomic features in the event that the rRNA locus overlaps with another gene. After counting, reads were normalized to the number of features mapped to normalize for overlapping genes. The read count for each gene was aggregated for each genetic background and normalized based on the depth of sequencing (number of reads mapping to the genome) and scaled to 1,000,000 reads. Differential gene expression between genetic backgrounds was preformed using custom Python scripts, all plots were drawn in R or Python. Bed files of assigned reads were converted to BigWig files using BEDOPS and visualized using IGV112,113. In addition to genomic alignments collapsed reads were aligned to RepBase transposon consensus sequences114. The pipeline used in the smRNA sequencing analysis is available at https://github.com/benpastore/nextflow_smRNA.
Bioinformatic analysis of mRNA sequencing data
Raw paired-end fastq files were trimmed of adapters and poorly sequenced reads using TrimGalore109. Trimmed fastq files were aligned to the C. elegans reference (WormBase Release WS279) with STAR, using the parameters—alignIntronMax 10000—outFilterMismatchNoverReadLmax 0.04—outFilterIntronMotifs RemoveNoncanonical—outFilterMultimapNmax 10115. Reads were further filtered using SAMTools to remove orphan reads (reads in which one mate in a pair does not align but the other does)116. Transcript abundance was then quantified using FeatureCounts using the parameters -p -s 2 -g gene_id -M --fraction117. To visualize coverage along the genome BAM files were converted to BigWig (BW) files using bamCoverage from the package DeepTools using the parameters—normalize CPM—smoothLength 10—binSize 5—exactScaling—filterRNAstrand forward. To visualize replicates BW files were averaged across replicates using bigWigMerge and bedGraphToBigWig from the UCSC Genome Browser Utilities. To quantify transposon sequence abundance we used Salmon tool118. Unnormalized counts from Salmon and FeatureCounts were concatenated using custom python scripts. Normalization and differential gene expression analysis was conducted using DESeq274. Data were visualized using R ggplot2 package and IGV. The comprehensive mRNA sequencing pipeline used to trim, align and quantify mRNAs is available at Github: https://github.com/benpastore/nextflow_pipelines.
Definition of HLH-30 targets
Published CHIP-seq dataset (SRP028480) were used to define potential target genes of HLH-30. Raw sequencing reads were trimmed from adapters, and poorly sequenced reads were removed using TrimGalore109. Processed reads were aligned to the C. elegans genome (WormBase release WS279) using BWA119. MACS2 was then used to call CHIP-seq peaks using a q value cutoff of 0.1120. HLH-30 targets were defined by assigning CHIP peaks to genomic features by intersecting peak regions to promoters of protein coding gens, lincRNAs and pseudogenes using Bedtools111. Promoters of genes were defined as 1 kb upstream of the 5′ UTR start position. Promoters of genes that fall within operons were defined as 1 kb upstream of the 5’ UTR of the first gene in the operon. CHIP-targets were further filtered to include targets that are enriched in both HLH-30 CHIP-seq replicates. The CHIP-seq pipeline used to trim, align and quantify CHIP sequencing data is available at Github: https://github.com/benpastore/nextflow_pipelines.
Definition of gene classes
To calculate the representation of up/down regulated siRNAs in eggd-1 mutants we preformed gene enrichment analysis using six gene sets. These gene sets are as follows: 4012 CSR-1 targets39, 1419 PRG-1 targets44, 1350 WAGO-1 targets121, 4572 WAGO-4 targets22, 1969 MUT-16 targets44, and 1273 HRDE-1 targets40.
Network analysis of protein-protein interaction
The list of upregulated genes in eggd-1 mutants was submitted to the STRING web server string-db.org using default settings to construct protein-protein interaction network. The network was then exported to Cytoscape for visualization.
Statistics and reproducibility
Figure 1 microscopy experiments were performed twice with similar results. Figure 3 confocal microscopy experiments were performed once and agree with results from separate widefield microscopy experiments. The piRNA sensor experiment in Fig. 4a, b was performed once. Results from RNAi experiments in Fig. 4c, d are composites of three experiments. Figure 5f, g is composite of two experiments with similar results. RNAi and microscopy experiments in Fig. 6 were repeated twice with similar results. RNAi and microscopy experiments in Fig. 7a were performed once, and Fig. 7b were performed twice with similar results. mRNA sequencing and small RNA sequencing experiments were performed using two biological replicates which correlate well and cluster together in a principle component analysis. No statistical method was used to predetermine sample size. No data were excluded from the analyses. The experiments were not randomized. The Investigators were not blinded to allocation during experiments and outcome assessment. Tests used to assign statistical significance are indicated in figure legends. All attempts at reproducing experimental results were successful.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
Data availability
Small RNA sequencing and mRNA sequencing data generated in this study have been deposited to NCBI GEO under accession code GSE228857 and GSE228858, respectively. All other supporting data are present in the ‘Source Data’ file or available upon request. A table with strains used in this study can be found in Supplementary Data File 1. Source data are provided with this paper.
Code availability
All Scripts used in data analysis are available at Github: https://github.com/benpastore/eggd_RNA_2023. Alternatively, code used for small RNA sequencing is available at https://doi.org/10.5281/zenodo.8302724; code used in mRNA sequencing analysis is available at https://doi.org/10.5281/zenodo.8302720; code use for all other analyses is available at https://doi.org/10.5281/zenodo.8302718.
References
Trcek, T. & Lehmann, R. Germ granules in Drosophila. Traffic 20, 650–660 (2019).
Lehtiniemi, T. & Kotaja, N. Germ granule-mediated RNA regulation in male germ cells. Reproduction 155, R77–R91 (2018).
Phillips, C. M. & Updike, D. L. Germ granules and gene regulation in the Caenorhabditis elegans germline. Genetics 220 https://doi.org/10.1093/genetics/iyab195 (2022).
Seydoux, G. The P granules of C. elegans: a genetic model for the study of RNA-protein condensates. J. Mol. Biol. 430, 4702–4710 (2018).
Dodson, A. E. & Kennedy, S. Germ granules coordinate RNA-based epigenetic inheritance pathways. Dev. Cell 50, 704–715 e704 (2019).
Updike, D. & Strome, S. P granule assembly and function in Caenorhabditis elegans germ cells. J. Androl. 31, 53–60 (2010).
Shirayama, M. et al. piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline. Cell 150, 65–77 (2012).
Ashe, A. et al. piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans. Cell 150, 88–99 (2012).
Ouyang, J. P. T., Zhang, W. L. & Seydoux, G. The conserved helicase ZNFX-1 memorializes silenced RNAs in perinuclear condensates. Nat. Cell Biol. 24, 1129–1140 (2022).
Shukla, A. et al. poly(UG)-tailed RNAs in genome protection and epigenetic inheritance. Nature 582, 283–288 (2020).
Strome, S. & Wood, W. B. Immunofluorescence visualization of germ-line-specific cytoplasmic granules in embryos, larvae, and adults of Caenorhabditis elegans. Proc. Natl Acad. Sci. USA 79, 1558–1562 (1982).
Pitt, J. N., Schisa, J. A. & Priess, J. R. P granules in the germ cells of Caenorhabditis elegans adults are associated with clusters of nuclear pores and contain RNA. Dev. Biol. 219, 315–333 (2000).
Knaut, H., Pelegri, F., Bohmann, K., Schwarz, H. & Nusslein-Volhard, C. Zebrafish vasa RNA but not its protein is a component of the germ plasm and segregates asymmetrically before germline specification. J. Cell Biol. 149, 875–888 (2000).
Chuma, S., Hosokawa, M., Tanaka, T. & Nakatsuji, N. Ultrastructural characterization of spermatogenesis and its evolutionary conservation in the germline: germinal granules in mammals. Mol. Cell Endocrinol. 306, 17–23 (2009).
Phillips, C. M., Montgomery, T. A., Breen, P. C. & Ruvkun, G. MUT-16 promotes formation of perinuclear mutator foci required for RNA silencing in the C. elegans germline. Genes Dev. 26, 1433–1444 (2012).
Wan, G. et al. Spatiotemporal regulation of liquid-like condensates in epigenetic inheritance. Nature 557, 679–683 (2018).
Manage, K. I. et al. A tudor domain protein, SIMR-1, promotes siRNA production at piRNA-targeted mRNAs in C. elegans. eLife 9 https://doi.org/10.7554/eLife.56731 (2020).
Wang, G. & Reinke, V. A C. elegans Piwi, PRG-1, Regulates 21U-RNAs during Spermatogenesis. Curr. Biol. 18, 861–867 (2008).
Batista, P. J. et al. PRG-1 and 21U-RNAs interact to form the piRNA complex required for fertility in C. elegans. Mol. Cell 31, 67–78 (2008).
Kawasaki, I. et al. PGL-1, a predicted RNA-binding component of germ granules, is essential for fertility in C. elegans. Cell 94, 635–645 (1998).
Ishidate, T. et al. ZNFX-1 functions within perinuclear nuage to balance epigenetic signals. Mol. Cell 70, 639–649 e636 (2018).
Xu, F. et al. A cytoplasmic argonaute protein promotes the inheritance of RNAi. Cell Rep. 23, 2482–2494 (2018).
Ketting, R. F., Haverkamp, T. H., van Luenen, H. G. & Plasterk, R. H. Mut-7 of C. elegans, required for transposon silencing and RNA interference, is a homolog of Werner syndrome helicase and RNaseD. Cell 99, 133–141 (1999).
Price, I. F., Hertz, H. L., Pastore, B., Wagner, J. & Tang, W. Proximity labeling identifies LOTUS domain proteins that promote the formation of perinuclear germ granules in C. elegans. eLife 10 https://doi.org/10.7554/eLife.72276 (2021).
Hertz, H. L., Price, I. F. & Tang, W. Visualization and purification of caenorhabditis elegans germ granule proteins using proximity labeling. Bio Protoc. 12, e4386 (2022).
Cipriani, P. G. et al. Novel LOTUS-domain proteins are organizational hubs that recruit C. elegans Vasa to germ granules. eLife 10 https://doi.org/10.7554/eLife.60833 (2021).
Kawasaki, I. et al. The PGL family proteins associate with germ granules and function redundantly in Caenorhabditis elegans germline development. Genetics 167, 645–661 (2004).
Lin, X. X. et al. DAF-16/FOXO and HLH-30/TFEB function as combinatorial transcription factors to promote stress resistance and longevity. Nat. Commun. 9, 4400 (2018).
Lapierre, L. R. et al. The TFEB orthologue HLH-30 regulates autophagy and modulates longevity in Caenorhabditis elegans. Nat. Commun. 4, 2267 (2013).
Amini, R., Chartier, N. T. & Labbe, J. C. Syncytium biogenesis: It’s all about maintaining good connections. Worm 4, e992665 (2015).
Uebel, C. & Phillips, C. Phase-separated protein dynamics are affected by fluorescent tag choice. MicroPubl. Biol. 2019 https://doi.org/10.17912/micropub.biology.000143 (2019).
Thomas, L., Taleb Ismail, B., Askjaer, P. & Seydoux, G. Nucleoporin foci are stress-sensitive condensates dispensable for C. elegans nuclear pore assembly. EMBO J. 42, e112987 (2023).
Wolke, U., Jezuit, E. A. & Priess, J. R. Actin-dependent cytoplasmic streaming in C. elegans oogenesis. Development 134, 2227–2236 (2007).
Yigit, E. et al. Analysis of the C. elegans Argonaute family reveals that distinct Argonautes act sequentially during RNAi. Cell 127, 747–757 (2006).
Maniar, J. M. & Fire, A. Z. EGO-1, a C. elegans RdRP, modulates gene expression via production of mRNA-templated short antisense RNAs. Curr. Biol. 21, 449–459 (2011).
Sijen, T., Steiner, F. A., Thijssen, K. L. & Plasterk, R. H. Secondary siRNAs result from unprimed RNA synthesis and form a distinct class. Science 315, 244–247 (2007).
Smardon, A. et al. EGO-1 is related to RNA-directed RNA polymerase and functions in germ-line development and RNA interference in C. elegans. Curr. Biol. 10, 169–178 (2000).
Gu, W. et al. Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline. Mol. Cell 36, 231–244 (2009).
Claycomb, J. M. et al. The Argonaute CSR-1 and its 22G-RNA cofactors are required for holocentric chromosome segregation. Cell 139, 123–134 (2009).
Buckley, B. A. et al. A nuclear argonaute promotes multigenerational epigenetic inheritance and germline immortality. Nature 489, 447–451 (2012).
Lee, H. C. et al. C. elegans piRNAs mediate the genome-wide surveillance of germline transcripts. Cell 150, 78–87 (2012).
Bagijn, M. P. et al. Function, targets, and evolution of Caenorhabditis elegans piRNAs. Science 337, 574–578 (2012).
Shen, E. Z. et al. Identification of piRNA binding sites reveals the argonaute regulatory landscape of the C. elegans germline. Cell 172, 937–951 e918 (2018).
Reed, K. J. et al. Widespread roles for piRNAs and WAGO-class siRNAs in shaping the germline transcriptome of Caenorhabditis elegans. Nucleic Acids Res. 48, 1811–1827 (2020).
Gu, W. et al. CapSeq and CIP-TAP identify Pol II start sites and reveal capped small RNAs as C. elegans piRNA precursors. Cell 151, 1488–1500 (2012).
Ruby, J. G. et al. Large-scale sequencing reveals 21U-RNAs and additional microRNAs and endogenous siRNAs in C. elegans. Cell 127, 1193–1207 (2006).
Das, P. P. et al. Piwi and piRNAs act upstream of an endogenous siRNA pathway to suppress Tc3 transposon mobility in the Caenorhabditis elegans germline. Mol. Cell 31, 79–90 (2008).
Kamminga, L. M. et al. Differential impact of the HEN1 homolog HENN-1 on 21U and 26 G RNAs in the germline of Caenorhabditis elegans. PLoS Genet. 8, e1002702 (2012).
Montgomery, T. A. et al. PIWI associated siRNAs and piRNAs specifically require the Caenorhabditis elegans HEN1 ortholog henn-1. PLoS Genet. 8, e1002616 (2012).
Billi, A. C. et al. The Caenorhabditis elegans HEN1 ortholog, HENN-1, methylates and stabilizes select subclasses of germline small RNAs. PLoS Genet. 8, e1002617 (2012).
Pastore, B., Hertz, H. L., Price, I. F. & Tang, W. pre-piRNA trimming and 2’-O-methylation protect piRNAs from 3’ tailing and degradation in C. elegans. Cell Rep. 36, 109640 (2021).
Billi, A. C. et al. A conserved upstream motif orchestrates autonomous, germline-enriched expression of Caenorhabditis elegans piRNAs. PLoS Genet. 9, e1003392 (2013).
Choi, C. P. et al. SNPC-1.3 is a sex-specific transcription factor that drives male piRNA expression in C. elegans. eLife 10 https://doi.org/10.7554/eLife.60681 (2021).
Tang, W., Tu, S., Lee, H. C., Weng, Z. & Mello, C. C. The RNase PARN-1 Trims piRNA 3’ ends to promote transcriptome surveillance in C. elegans. Cell 164, 974–984 (2016).
Conine, C. C. et al. Argonautes ALG-3 and ALG-4 are required for spermatogenesis-specific 26G-RNAs and thermotolerant sperm in Caenorhabditis elegans. Proc. Natl Acad. Sci. USA 107, 3588–3593 (2010).
Han, T. et al. 26 G endo-siRNAs regulate spermatogenic and zygotic gene expression in Caenorhabditis elegans. Proc. Natl Acad. Sci. USA 106, 18674–18679 (2009).
Tsai, H. Y., Cheng, H. T. & Tsai, Y. T. Biogenesis of C. elegans spermatogenesis small RNAs is initiated by a zc3h12a-like ribonuclease. Sci. Adv. 8, eabm0699 (2022).
Ghanta, K. S. & Mello, C. C. Melting dsDNA donor molecules greatly improves precision genome editing in Caenorhabditis elegans. Genetics 216, 643–650 (2020).
Tang, W. et al. A Sex Chromosome piRNA promotes robust dosage compensation and sex determination in C. elegans. Dev. Cell 44, 762–770 e763 (2018).
Kim, H. et al. HDAC1 SUMOylation promotes Argonaute-directed transcriptional silencing in C. elegans. eLife 10 https://doi.org/10.7554/eLife.63299 (2021).
Seth, M. et al. The coding regions of germline mRNAs confer sensitivity to argonaute regulation in C. elegans. Cell Rep. 22, 2254–2264 (2018).
Kasper, D. M., Wang, G., Gardner, K. E., Johnstone, T. G. & Reinke, V. The C. elegans SNAPc component SNPC-4 coats piRNA domains and is globally required for piRNA abundance. Dev. cell 31, 145–158 (2014).
Goh, W. S. et al. A genome-wide RNAi screen identifies factors required for distinct stages of C. elegans piRNA biogenesis. Genes Dev. 28, 797–807 (2014).
Weng, C. et al. The USTC co-opts an ancient machinery to drive piRNA transcription in C. elegans. Genes Dev. 33, 90–102 (2019).
Fire, A. et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391, 806–811 (1998).
Timmons, L., Court, D. L. & Fire, A. Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans. Gene 263, 103–112 (2001).
Tabara, H., Hill, R. J., Mello, C. C., Priess, J. R. & Kohara, Y. pos-1 encodes a cytoplasmic zinc-finger protein essential for germline specification in C. elegans. Development 126, 1–11 (1999).
Tabara, H. et al. The rde-1 gene, RNA interference, and transposon silencing in C. elegans. Cell 99, 123–132 (1999).
Grishok, A., Tabara, H. & Mello, C. C. Genetic requirements for inheritance of RNAi in C. elegans. Science 287, 2494–2497 (2000).
Vastenhouw, N. L. et al. Gene expression: long-term gene silencing by RNAi. Nature 442, 882 (2006).
Lev, I. et al. Germ granules govern small RNA Inheritance. Curr. Biol. 29, 2880–2891 e2884 (2019).
Spracklin, G. et al. The RNAi inheritance machinery of Caenorhabditis elegans. Genetics 206, 1403–1416 (2017).
Shukla, A., Perales, R. & Kennedy, S. piRNAs coordinate poly(UG) tailing to prevent aberrant and perpetual gene silencing. Curr. Biol. 31, 4473–4485 e4473 (2021).
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).
Angeles-Albores, D., RY, N. L., Chan, J. & Sternberg, P. W. Tissue enrichment analysis for C. elegans genomics. BMC Bioinform. 17, 366 (2016).
Ortiz, M. A., Noble, D., Sorokin, E. P. & Kimble, J. A new dataset of spermatogenic vs. oogenic transcriptomes in the nematode Caenorhabditis elegans. G3 4, 1765–1772 (2014).
Wu, J. C. et al. Sperm development and motility are regulated by PP1 phosphatases in Caenorhabditis elegans. Genetics 190, 143–157 (2012).
Kulkarni, M., Shakes, D. C., Guevel, K. & Smith, H. E. SPE-44 implements sperm cell fate. PLoS Genet. 8, e1002678 (2012).
Puoti, A. & Kimble, J. The hermaphrodite sperm/oocyte switch requires the Caenorhabditis elegans homologs of PRP2 and PRP22. Proc. Natl Acad. Sci. USA 97, 3276–3281 (2000).
Raudvere, U. et al. g:Profiler: a web server for functional enrichment analysis and conversions of gene lists (2019 update). Nucleic Acids Res. 47, W191–W198 (2019).
Jensen, L. J. et al. STRING 8–a global view on proteins and their functional interactions in 630 organisms. Nucleic Acids Res. 37, D412–D416 (2009).
Urso, S. J., Comly, M., Hanover, J. A. & Lamitina, T. The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress. PLoS Genet. 16, e1008821 (2020).
Gerstein, M. B. et al. Integrative analysis of the Caenorhabditis elegans genome by the modENCODE project. Science 330, 1775–1787 (2010).
Libina, N., Berman, J. R. & Kenyon, C. Tissue-specific activities of C. elegans DAF-16 in the regulation of lifespan. Cell 115, 489–502 (2003).
Aghayeva, U., Bhattacharya, A. & Hobert, O. A panel of fluorophore-tagged daf-16 alleles. MicroPubl. Biol. https://doi.org/10.17912/micropub.biology.000210 (2020).
Martina, J. A. et al. A conserved cysteine-based redox mechanism sustains TFEB/HLH-30 activity under persistent stress. EMBO J. 40, e105793 (2021).
Updike, D. L. & Strome, S. A genomewide RNAi screen for genes that affect the stability, distribution and function of P granules in Caenorhabditis elegans. Genetics 183, 1397–1419 (2009).
Vought, V. E., Ohmachi, M., Lee, M. H. & Maine, E. M. EGO-1, a putative RNA-directed RNA polymerase, promotes germline proliferation in parallel with GLP-1/notch signaling and regulates the spatial organization of nuclear pore complexes and germline P granules in Caenorhabditis elegans. Genetics 170, 1121–1132 (2005).
Updike, D. L., Knutson, A. K., Egelhofer, T. A., Campbell, A. C. & Strome, S. Germ-granule components prevent somatic development in the C. elegans germline. Curr. Biol. 24, 970–975 (2014).
Zou, L. et al. Construction of a germline-specific RNAi tool in C. elegans. Sci. Rep. 9, 2354 (2019).
Spike, C. A. et al. The TRIM-NHL protein LIN-41 and the OMA RNA-binding proteins antagonistically control the prophase-to-metaphase transition and growth of Caenorhabditis elegans oocytes. Genetics 198, 1535–1558 (2014).
Lehmann, R. Germ plasm biogenesis–an Oskar-centric perspective. Curr. Top. Dev. Biol. 116, 679–707 (2016).
Yabuta, Y. et al. TDRD5 is required for retrotransposon silencing, chromatoid body assembly, and spermiogenesis in mice. J. Cell Biol. 192, 781–795 (2011).
Tanaka, T. et al. Tudor domain containing 7 (Tdrd7) is essential for dynamic ribonucleoprotein (RNP) remodeling of chromatoid bodies during spermatogenesis. Proc. Natl Acad. Sci. USA 108, 10579–10584 (2011).
Lachke, S. A. et al. Mutations in the RNA granule component TDRD7 cause cataract and glaucoma. Science 331, 1571–1576 (2011).
Marnik, E. A. et al. The Caenorhabditis elegans TDRD5/7-like protein, LOTR-1, interacts with the helicase ZNFX-1 to balance epigenetic signals in the germline. PLoS Genet. 18, e1010245 (2022).
Tijsterman, M., Okihara, K. L., Thijssen, K. & Plasterk, R. H. PPW-1, a PAZ/PIWI protein required for efficient germline RNAi, is defective in a natural isolate of C. elegans. Curr. Biol. 12, 1535–1540 (2002).
Campbell, A. C. & Updike, D. L. CSR-1 and P granules suppress sperm-specific transcription in the C. elegans germline. Development 142, 1745–1755 (2015).
Cornes, E. et al. piRNAs initiate transcriptional silencing of spermatogenic genes during C. elegans germline development. Dev Cell 57, 180–196 e187 (2022).
Knutson, A. K., Egelhofer, T., Rechtsteiner, A. & Strome, S. Germ granules prevent accumulation of somatic transcripts in the adult Caenorhabditis elegans germline. Genetics 206, 163–178 (2017).
Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71–94 (1974).
Kim, H. et al. A co-CRISPR strategy for efficient genome editing in Caenorhabditis elegans. Genetics 197, 1069–1080 (2014).
Elaswad, M. T. et al. Imaging-associated stress causes divergent phase transitions of RNA-binding proteins in the Caenorhabditis elegans germ line. G3 12. https://doi.org/10.1093/g3journal/jkac172 (2022)
Fritsch, A. W. et al. Local thermodynamics govern formation and dissolution of. Proc. Natl Acad. Sci. USA 118 https://doi.org/10.1073/pnas.2102772118 (2021).
Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675 (2012).
Pastore, B., Hertz, H. L. & Tang, W. Comparative analysis of piRNA sequences, targets and functions in nematodes. RNA Biol. 19, 1276–1292 (2022).
Li, L., Dai, H., Nguyen, A. P. & Gu, W. A convenient strategy to clone small RNA and mRNA for high-throughput sequencing. Rna 26, 218–227 (2020).
Adiconis, X. et al. Comparative analysis of RNA sequencing methods for degraded or low-input samples. Nat. Methods 10, 623–629 (2013).
Kechin, A., Boyarskikh, U., Kel, A. & Filipenko, M. cutPrimers: a new tool for accurate cutting of primers from reads of targeted next generation sequencing. J. Comput. Biol. 24, 1138–1143 (2017).
Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 10, R25 (2009).
Quinlan, A. R. & Hall, I. M. BEDTools: a flexible suite of utilities for comparing genomic features. Bioinformatics 26, 841–842 (2010).
Neph, S. et al. BEDOPS: high-performance genomic feature operations. Bioinformatics 28, 1919–1920 (2012).
Robinson, J. T. et al. Integrative genomics viewer. Nat. Biotechnol. 29, 24–26 (2011).
Jurka, J. et al. Repbase update, a database of eukaryotic repetitive elements. Cytogenet. Genome Res. 110, 462–467 (2005).
Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).
Li, H. et al. The sequence alignment/Map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).
Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for assigning sequence reads to genomic features. Bioinformatics 30, 923–930 (2013).
Patro, R., Duggal, G., Love, M. I., Irizarry, R. A. & Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 14, 417–419 (2017).
Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754–1760 (2009).
Zhang, Y. et al. Model-based analysis of ChIP-Seq (MACS). Genome Biol. 9, R137 (2008).
Svendsen, J. M. et al. henn-1/HEN1 promotes germline immortality in Caenorhabditis elegans. Cell Rep. 29, 3187 (2019).
Acknowledgements
We thank D. Updike for providing bacteria expressing P granule dsRNAs; C. Mello for providing GFP::WAGO-1, GFP::HRDE-1/WAGO-9 and GFP::CSR-1 strains; G. Seydoux for sharing NPP-11::wrmScarlet strain; D. Schoenberg for providing feedback on manuscript; A. Ozturk for designing antisense oligonucleotides against ribosomal RNAs; the Neuroscience Imaging Core for instruments (S10OD010383); the OSU Comprehensive Cancer Center genomics core for Illumina sequencing, Ohio Supercomputer Center for Computational resources, Caenorhabditis Genetics Center for providing some of the C. elegans strains (P40OD010440). This work was supported by The Center for RNA Biology Fellowship to I.P. and B.P., and NIH Maximizing Investigators’ Research Award (R35GM142580) to W.T.
Author information
Authors and Affiliations
Contributions
I.P., J.W., and W.T. designed and conducted experiments; B.P. analyzed small RNA sequencing and mRNA sequencing data; H.H. assayed for RNAi competency and RNAi inheritance. I.P., J.W., B.P., and H.H. generated the figures and wrote figure legend. I.P. and W.T. wrote the manuscript. W.T. supervised the project and obtained research funding. All authors discussed the results and commented on the manuscript.
Corresponding author
Ethics declarations
Competing interests
The authors declare no competing interests.
Peer review
Peer review information
Nature Communications thanks Carolyn Phillips and the other, anonymous, reviewer(s) for their contribution to the peer review of this work. A peer review file is available.
Additional information
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Source data
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.
About this article
Cite this article
Price, I.F., Wagner, J.A., Pastore, B. et al. C. elegans germ granules sculpt both germline and somatic RNAome. Nat Commun 14, 5965 (2023). https://doi.org/10.1038/s41467-023-41556-4
Received:
Accepted:
Published:
DOI: https://doi.org/10.1038/s41467-023-41556-4
- Springer Nature Limited
This article is cited by
-
Germ granule compartments coordinate specialized small RNA production
Nature Communications (2024)