Introduction

The genus Scopulariopsis, erected by Bainier (1907), contains both hyaline and dematiaceous moulds, which propagate asexually by conidia. Most of their teleomorphs are included in the genus Microascus [1–5]. The anamorph–teleomorph connections have already been established for many species. However, the sexual states of some Scopulariopsis species are still unknown [6].

Scopulariopsis spp. are saprobes with a worldwide distribution. They are commonly isolated from soil, air, plant debris, paper, dung and moist indoor environments [7, 8]. Traditionally, Scopulariopsis and Microascus species have not been considered common human pathogens. However, the number of cases with these organisms as main perpetrators has recently been on the rise. Some species are known to be opportunistic pathogens, primarily causing superficial tissue infections, and being one of the principal causes of non-dermatophytic onychomycoses [9, 10]. The prevalence of onychomycosis caused by S. brevicaulis is estimated to make up 3–10 % of the total number of mould onychomycosis cases globally. Clinically, the condition is generally recognised as distal and lateral subungual onychomycosis (DLSO) [11, 12]. Cases of cutaneous and subcutaneous infections have also been described as due to S. brevicaulis [13, 14]. Less commonly Scopulariopsis and Microascus species have been reported as causes of other infections including endocarditis [15–18], keratitis [19, 20], endophthalmitis [21], sinusitis [22, 23], pulmonary fungus ball [24, 25], otomycosis [26, 27], pneumonia [28–30], peritonitis [31], cerebral phaeohyphomycosis and brain abscess [32–34], disseminated infection with skin lesions including a patient with acquired immune deficiency syndrome (AIDS) [13], disseminated infection after bone marrow transplantation [35, 36], invasive infection after lung [37, 38] or heart and lung transplantation [39].

Among Scopulariopsis and Microascus species most frequently isolated from all types of lesions, S. brevicaulis ranks first, followed by S. acremonium, S. brumptii, S. flava, M. niger, M. cinereus, M. cirrosus, M. manginii, and M. trigonosporus [6, 40].

The data considering Scopulariopsis and Microascus antifungal susceptibility are scarce and often inconsistent. The very few reports available have recognised them as a multidrug-resistant fungi [41, 42]. Noteworthy, the lack of correlation between in vitro drug susceptibility (MIC determination results) and clinical outcomes has been demonstrated [39, 41].

The recovery of Scopulariopsis and Microascus species from clinical samples is relatively easy, as these fungi grow well on routine laboratory media. Yet, it is still difficult to perform species identification based on morphological criteria. Moreover, Microascus/Scopulariopsis infections, and disseminated infections in particular might be clinically and histologically indistinguishable from aspergillosis, fusariosis or zygomycosis [43, 44]. Since, in the majority of clinical reports on Scopulariopsis spp. infections, morphological identification of the aetiological agent has not been confirmed at the molecular level, the actual prevalence of Scopulariopsis species, other than S. brevicaulis, is unknown [6].

In this paper, we present PCR and real-time PCR-based assays developed for the detection of cultured isolates of Scopulariopsis and Microascus genera, as well as S. brevicaulis species.

Materials and Methods

Strains and Isolates

In the present study, we used a total of 219 fungal strains, representing 103 fungal species (Table 1). The strains were obtained from international culture collections (CBS-KNAW Fungal Biodiversity Centre; BCCM/IHEM Biomedical Fungi and Yeasts Collection—Belgian Coordinated Collections of Microorganisms; Leibniz Institute DSMZ—German Collection of Microorganisms and Cell Cultures) and Molecular Biotechnology and Microbiology Department (MBMD) collection of fungi (Gdańsk University of Technology, Gdańsk, Poland). Identification of all MBMD isolates was performed by observation of macro- and micromorphology and then confirmed by sequencing of the ITS region, as described by White et al. [45]. Moreover, in case of Alternaria spp., Aspergillus spp. and Scopulariopsis spp. MBMD isolates β-tubulin gene sequencing was performed, as described by Glass and Donaldson [46].

Table 1 Organisms used in the study
Full size table

DNA Extraction

Isolates were cultured on Sabouraud glucose agar (Biomerieux, Marcy l’Etoile, France) and incubated for up to 14 days at room temperature. DNA from fungal samples (pieces of mycelium of 3–5 mm diameter) was extracted by a 10-min incubation of the sample in 100 µl of extraction buffer (60 mM sodium bicarbonate [NaHCO3], 250 mM potassium chloride [KCl] and 50 mM Tris, pH 9.5) in 95 °C and subsequent addition of 100 µl anti-inhibition buffer (2 % bovine serum albumin). After vortex mixing, this DNA-containing solution was used for PCR [47]. All reagents for DNA extraction were purchased from Sigma-Aldrich (Seelze, Germany).

PCR and Real-Time PCR Assays

On the basis of alignment (VectorNTI; InforMax, Inc.) of β-tubulin gene (TUBB) sequences deposited in the NCBI nucleotide database, Microascus/Scopulariopsis-specific primers ScopFor (5′ CATCTCGGGCGAGCACGGTC 3′) and ScopRev (5′ CCAGGACAGCACGGGGAACAT 3′) were designed. Primers were then synthesised by Genomed (Warsaw, Poland). PCR mixtures, of 20 µl each, consisted of 10 µl of 2× PCR Master Mix Plus High GC (A&A Biotechnology, Gdynia, Poland), 0.1 µl of each primer (ScopFor, ScopRev) at 100 µM, and 2 µl of DNA. PCR was performed in a 5345 Mastercycler ep gradient S (Eppendorf, Hamburg, Germany). The time–temperature profile included initial denaturation for 3 min at 94 °C followed by 35 cycles of 30 s at 94 °C, 30 s at 68 °C, and 30 s at 72 °C. The presence of specific 285-bp amplicons was examined electrophoretically on a 2 % agarose gel, stained with ethidium bromide.

S. brevicaulis-specific PCR assay was performed the same way as previously described [48].

Real-time PCR mixtures, of 20 µl each, consisted of 10 µl of 2× PCR Master Mix SYBR A (A&A Biotechnology, Poland), 0.1 µl of each primer (ScopFor, ScopRev in Microascus/Scopulariopsis-specific assay; SbFor, SbRev in S. brevicaulis-specific assay) at 100 µM, and 2 µl of DNA. PCR was performed in a LightCycler® Nano Instrument (Roche, Basel, Switzerland). The cycling conditions in Microascus/Scopulariopsis-specific assay included an initial denaturation for 3 min at 95 °C followed by 40 cycles of 15 s at 94 °C, 15 s at 68 °C and 30 s at 72 °C. The time–temperature profile in S. brevicaulis-specific assay started with initial denaturation for 3 min at 94 °C followed by 40 cycles of 10 s at 94 °C, 10 s at 60 °C and 15 s at 72 °C. The presence of specific amplicons was examined upon melting temperature analysis (80 °C to 95 °C at 0.1 °C/s ramp rate), which followed cycling.

Results

Microascus/Scopulariopsis-Specific PCR and Real-Time PCR Assay Results

A 285-bp PCR product corresponding to Scopulariopsis/Microascus was observed for all 48 Scopulariopsis and Microascus spp. DNA samples. No PCR products were detected for 76 other mould isolates, 65 dermatophyte isolates, 30 yeast-like isolates or human DNA (100 % sensitivity and 100 % specificity) (Fig. 1).

Fig. 1
figure 1

Example of Scopulariopsis/Microascus-specific PCR product analysis. M molecular size marker (fragment sizes 700, 500, 400, 300, 200 and 100 bp); results of Scopulariopsis/Microascus-specific PCR performed for S. asperula CBS 298.67 (lane 1); S. brevicaulis CBS 112377 (lane 2); S. flava CBS 207.61 (lane 3); S. fusca IHEM 14552 (lane 4); M. cinereus CBS 195.61 (lane 5)

Full size image

Similar results were obtained when real-time PCR was applied, as amplicon of T m range of 87.03–89.02 °C (C t = 25.12 ± 4.28), corresponding to Scopulariopsis/Microascus spp., was observed only for 48 Scopulariopsis and Microascus spp. DNA samples and not for any other fungal or human DNA samples (Fig. 2).

Fig. 2
figure 2

Example of Scopulariopsis/Microascus-specific real-time PCR product melting temperature analysis performed for S. asperula CBS 298.67 (1); S. brumptii CBS 121662 (2); S. brevicaulis CBS 119550 (3); S. flava CBS 207.61 (4); S. fusca CBS 117787 (5); M. manginii CBS 195.61 (6); negative control (7)

Full size image

S. brevicaulis-Specific PCR and Real-Time PCR Assay Results

A 223-bp PCR product corresponding to S. brevicaulis was observed for 8/8 S. brevicaulis and 1/1 S. koningii (syn. S. brevicaulis) DNA samples. No PCR products were detected for 20 other Scopulariopsis spp. strains, 19 Microascus spp. strains, 76 other mould isolates, 65 dermatophyte isolates, 30 yeast-like isolates or one human DNA (100 % sensitivity and 100 % specificity for PCR) (Fig. 3).

Fig. 3
figure 3

Example of S. brevicaulis-specific PCR product analysis. M molecular size marker (fragment sizes 700, 500, 400, 300, 200 and 100 bp); results of S. brevicaulis-specific PCR performed for S. asperula CBS 298.67 (lane 1); S. fusca IHEM 14552 (lane 2); S. flava CBS 207.61 (lane 3); S. brevicaulis CBS 112377 (lane 4); S. brevicaulis human-derived isolate MBMD-W1 (lane 5); S. brevicaulis rabbit-derived isolate MBMD-F9 (lane 6)

Full size image

Accordingly, as a result of real-time PCR, amplicon of T m = 87.76 ± 0.20 °C (C t = 24.11 ± 4.38) corresponding to S. brevicaulis was observed only for 8/8 S. brevicaulis and 1/1 S. koningii (syn. S. brevicaulis) DNA samples and not for any other fungal or human DNA samples (Fig. 4).

Fig. 4
figure 4

Example of S. brevicaulis-specific real-time PCR product melting temperature analysis performed for Scopulariopsis brevicaulis CBS 112377 (1); S. brevicaulis animal-derived isolate MBMD-19P (2); S. asperula CBS 298.67 (3); S. fusca IHEM 14552 (4); S. flava CBS 207.61 (5); M. longirostris CBS 415.64 (6); negative control (7)

Full size image

Discussion

At present, identification of pathogenic fungi still largely relies on the evaluation of macro- and micromorphology. Distinction between Scopulariopsis and Microascus species by using morphological criteria remains useful since the features of conidia and sexual reproductive structures are quite characteristic at the genus level. Two well-recognised disadvantages of these methods, delaying the diagnostic outcome, are the amount of time elapsing from specimen delivery to the diagnostic result acquisition and the requirement of sporulating culture. Diagnosis of disseminated infections is particularly challenging since Scopulariopsis fungi are difficult to distinguish from other moulds (e.g. Aspergillus, Fusarium) upon histopathological examination. Furthermore, the sensitivity of confirmatory blood cultures is poor [44].

Molecular tools have increasingly been adopted in clinical laboratories for the identification of fungi. The sequence analysis of the ribosomal operon has been used for the identification of clinical strains of Scopulariopsis, yet the results may not have been fully reliable because of insufficient availability of reference sequences in the public databases [6, 39, 49]. Moreover, the D1/D2 region, the target most frequently used for species identification, exhibits a low interspecific variation in Scopulariopsis and Microascus genera [6]. Recently, Ropars et al. [50] performed a combined analysis of partial sequences of the large subunit (LSU) rRNA gene, β-tubulin (TUBB), and elongation factor 1-α (EF1-α) genes for the taxonomic circumscription of Scopulariopsis species, whereas Bontems et al. [51] developed a PCR–RFLP assay, based on 28S rDNA, for identification of fungi, including Scopulariopsis spp., involved in onychomycosis. However, all these methods are laborious and generate rather complicated patterns, thus making them unlikely to be implemented in routine laboratory diagnostics.

All this underlines a need for the development of new methods that would provide simple, rapid and highly specific identification of Scopulariopsis/Microascus at both genus and species levels. In this study, we present PCR and real-time PCR-based assays that enable genus-specific detection of Scopulariopsis spp. and Microascus spp. DNA, as well as species-specific detection of S. brevicaulis in culture samples. β-Tubulin gene, formerly chosen as one of the targets in phylogenetic studies [50, 52], was confirmed to be an adequate target for genus-specific (Microascus spp. and Scopulariopsis spp.) and species-specific (S. brevicaulis) identification. Developed assays are rapid, easily performed and interpretable, and can serve as useful adjunct tools for the identification of the Scopulariopsis spp. and Microascus spp. infections. However, further studies are needed to confirm assay’s clinical applicability (sensitivity, direct amplification from various clinical specimens, etc.).

As pointed out by Balajee et al. [53], an increasing number of clinical laboratories begins to assess the usefulness of DNA-based methods for identification of isolates recovered from culture of clinical samples in order to complement morphology-based methods (especially when an isolate displays atypical colour, features, or morphology) or to supplant them when culture results are delayed due to slow or absent sporulation [54]. Moreover, analysis of DNA-based methods results is almost entirely independent from diagnostician experience, and thus, it is easy to implement them in basic laboratories. Precise and timely identification of fungal isolates to species can be extremely important when recovered from high-risk patients, as fungal infections in these patients can be serious, difficult to treat and rapidly fatal [53]. Diagnostic procedures should always be guided by clinical history of the patient and clinician’s suspicion of disease.