Skip to main content

Advertisement

SpringerLink
Log in

Age disparities in intestinal stem cell quantities: a possible explanation for preterm infant susceptibility to necrotizing enterocolitis

  • Original Article
  • Published:
Pediatric Surgery International Aims and scope Submit manuscript

Abstract

Purpose

Preterm infants are more susceptible to necrotizing enterocolitis (NEC) than term Queryinfants. This may be due to a relative paucity of Lgr5+ or Bmi1+-expressing intestinal stem cells (ISCs) which are responsible for promoting intestinal recovery after injury. We hypothesized that the cellular markers of Lgr5+ and Bmi1+, which represent the two distinct ISC populations, would be lower in younger mice compared to older mice. In addition, we hypothesized that experimental NEC would result in a greater loss of Lgr5+ expression compared to Bmi1+ expression.

Methods

Transgenic mice with EGFP-labeled Lgr5 underwent euthanasia at 10 different time points from E15 to P56 (n = 8–11/group). Lgr5+-expressing ISCs were quantified by GFP ELISA and Bmi1+ was assessed by qPCR. In addition, Lgr5EGFP mice underwent experimental NEC via formula feeding and hypoxic and hypothermic stress. Additional portions of the intestine underwent immunostaining with anti-GFP or anti-Bmi1+ antibodies to confirm ELISA and PCR results. For statistical analysis, p < 0.05 was significant.

Results

Lgr5+ and Bmi1+expression was lowest in embryonal and early postnatal mice and increased with age in all segments of the intestine. Experimental NEC was associated with loss of Lgr5+-expressing ISCs but no significant change in Bmi1+ expression.

Conclusion

Lgr5+ and Bmi1+ expression increase with age. Lgr5+-expressing ISCs are lower following experimental necrotizing enterocolitis while Bmi1+ expression remains relatively unchanged. Developing a targeted medical therapy to protect the low population of ISCs in preterm infants may promote tissue recovery and regeneration after injury from NEC.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Log in via an institution

Price excludes VAT (USA)
Tax calculation will be finalised during checkout.

Instant access to the full article PDF.

Institutional subscriptions

Fig. 1
Fig. 2
Fig. 3
Fig. 4
Fig. 5
Fig. 6
Fig. 7

Similar content being viewed by others

References

  1. Kovler ML, Sodhi CP, Hackam DJ (2020) Precision-based modeling approaches for necrotizing enterocolitis. Dis Model Mech 13(6):044388. https://doi.org/10.1242/dmm.044388

    Article  Google Scholar 

  2. Hackam DJ, Sodhi CP, Good M (2019) New insights into necrotizing enterocolitis: From laboratory observation to personalized prevention and treatment. J Pediatr Surg 54(3):398–404

    Article  PubMed  Google Scholar 

  3. Zani A, Pierro A (2015) Necrotizing enterocolitis controversies and challenges. F1000Res 4:F1000

    Article  PubMed  PubMed Central  Google Scholar 

  4. Jones IH, Hall NJ (2020) Contemporary outcomes for infants with necrotizing enterocolitis-a systematic review. J Pediatr 220:86-92 e3

    Article  PubMed  Google Scholar 

  5. Berseth CL (1989) Gestational evolution of small intestine motility in preterm and term infants. J Pediatr 115(4):646–651

    Article  CAS  PubMed  Google Scholar 

  6. Claud EC (2009) Neonatal necrotizing enterocolitis -inflammation and intestinal immaturity. Anti-inflamm Anti-allergy Agents Med Chem 8(3):248–259

    Article  CAS  Google Scholar 

  7. Snyder JD, Walker WA (1987) Structure and function of intestinal mucin: developmental aspects. Int Arch Allergy Appl Immunol 82(3–4):351–356

    Article  CAS  PubMed  Google Scholar 

  8. Rouwet EV et al (2002) Intestinal permeability and carrier-mediated monosaccharide absorption in preterm neonates during the early postnatal period. Pediatr Res 51(1):64–70

    Article  CAS  PubMed  Google Scholar 

  9. Lebenthal A, Lebenthal E (1999) The ontogeny of the small intestinal epithelium. JPEN J Parenter Enteral Nutr 23(5 Suppl):S3-6

    Article  CAS  PubMed  Google Scholar 

  10. Neal MD et al (2012) Toll-like receptor 4 is expressed on intestinal stem cells and regulates their proliferation and apoptosis via the p53 up-regulated modulator of apoptosis. J Biol Chem 287(44):37296–37308

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  11. Li B et al (2019) Impaired Wnt/beta-catenin pathway leads to dysfunction of intestinal regeneration during necrotizing enterocolitis. Cell Death Dis 10(10):743

    Article  PubMed  PubMed Central  Google Scholar 

  12. Bankaitis ED et al (2018) Reserve stem cells in intestinal homeostasis and injury. Gastroenterology 155(5):1348–1361

    Article  PubMed  Google Scholar 

  13. Metcalfe C et al (2014) Lgr5+ stem cells are indispensable for radiation-induced intestinal regeneration. Cell Stem Cell 14(2):149–159

    Article  CAS  PubMed  Google Scholar 

  14. Sangiorgi E, Capecchi MR (2008) Bmi1 is expressed in vivo in intestinal stem cells. Nat Genet 40(7):915–920

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  15. Barker N et al (2007) Identification of stem cells in small intestine and colon by marker gene Lgr5. Nature 449(7165):1003–1007

    Article  CAS  PubMed  Google Scholar 

  16. Bjerknes M, Cheng H (1999) Clonal analysis of mouse intestinal epithelial progenitors. Gastroenterology 116(1):7–14

    Article  CAS  PubMed  Google Scholar 

  17. Munoz J et al (2012) The Lgr5 intestinal stem cell signature: robust expression of proposed quiescent ‘+4’ cell markers. EMBO J 31(14):3079–3091

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Yan KS et al (2012) The intestinal stem cell markers Bmi1 and Lgr5 identify two functionally distinct populations. Proc Natl Acad Sci U S A 109(2):466–471

    Article  CAS  PubMed  Google Scholar 

  19. Tian H et al (2011) A reserve stem cell population in small intestine renders Lgr5-positive cells dispensable. Nature 478(7368):255–259

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Zani A et al (2008) Assessment of a neonatal rat model of necrotizing enterocolitis. Eur J Pediatr Surg 18(6):423–426

    Article  CAS  PubMed  Google Scholar 

  21. Jilling T et al (2006) The roles of bacteria and TLR4 in rat and murine models of necrotizing enterocolitis. J Immunol 177(5):3273–3282

    Article  CAS  PubMed  Google Scholar 

  22. Todaro F et al (2019) Regulation of kit expression in early mouse embryos and es cells. Stem Cells 37(3):332–344

    Article  CAS  PubMed  Google Scholar 

  23. Schneider CA, Rasband WS, Eliceiri KW (2012) NIH image to imagej: 25 years of image analysis. Nat Methods 9(7):671–675

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Venkatraman A et al (2021) Intestinal stem cell development in the neonatal gut: pathways regulating development and relevance to necrotizing enterocolitis. Cells 10(2):312

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  25. Hackam D, Caplan M (2018) Necrotizing enterocolitis: pathophysiology from a historical context. Semin Pediatr Surg 27(1):11–18

    Article  PubMed  Google Scholar 

  26. Lucas A, Cole TJ (1990) Breast milk and neonatal necrotising enterocolitis. Lancet 336(8730):1519–1523

    Article  CAS  PubMed  Google Scholar 

  27. Meinzen-Derr J et al (2009) Role of human milk in extremely low birth weight infants’ risk of necrotizing enterocolitis or death. J Perinatol 29(1):57–62

    Article  CAS  PubMed  Google Scholar 

  28. Patel AL, Kim JH (2018) Human milk and necrotizing enterocolitis. Semin Pediatr Surg 27(1):34–38

    Article  PubMed  Google Scholar 

  29. Sitarik AR et al (2017) Breast milk transforming growth factor beta is associated with neonatal gut microbial composition. J Pediatr Gastroenterol Nutr 65(3):e60–e67

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  30. Guner YS et al (2011) P-glycoprotein induction by breast milk attenuates intestinal inflammation in experimental necrotizing enterocolitis. Lab Invest 91(11):1668–1679

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Good M et al (2016) The human milk oligosaccharide 2’-fucosyllactose attenuates the severity of experimental necrotising enterocolitis by enhancing mesenteric perfusion in the neonatal intestine. Br J Nutr 116(7):1175–1187

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  32. Chen CL et al (2012) Heparin-binding EGF-like growth factor protects intestinal stem cells from injury in a rat model of necrotizing enterocolitis. Lab Invest 92(3):331–344

    Article  CAS  PubMed  Google Scholar 

  33. Chang CM et al (2022) Effects of probiotics on gut microbiomes of extremely preterm infants in the neonatal intensive care unit: a prospective cohort study. Nutrients 14(15):3239

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Liu H et al (2022) Safety and efficacy of probiotics in the prevention of necrotizing enterocolitis in premature and/or low-birthweight infants: a systematic review and meta-analysis. Transl Pediatr 11(2):249–259

    Article  PubMed  PubMed Central  Google Scholar 

  35. Deshmukh M, Patole S (2021) Prophylactic probiotic supplementation for preterm neonates-a systematic review and meta-analysis of nonrandomized studies. Adv Nutr 12(4):1411–1423

    Article  PubMed  PubMed Central  Google Scholar 

  36. Yeung CY et al (2021) Immune modulation effects of lactobacillus casei variety rhamnosus on enterocytes and intestinal stem cells in a 5-fu-induced mucositis mouse model. Gastroenterol Res Pract 2021:3068393

    Article  PubMed  PubMed Central  Google Scholar 

  37. Wu H et al (2020) Lactobacillus reuteri maintains intestinal epithelial regeneration and repairs damaged intestinal mucosa. Gut Microbes 11(4):997–1014

    Article  PubMed  PubMed Central  Google Scholar 

  38. Gong W et al (2016) Mesenchymal stem cells stimulate intestinal stem cells to repair radiation-induced intestinal injury. Cell Death Dis 7(9):e2387

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  39. Knudsen KBK et al (2017) Laser speckle contrast imaging to evaluate bowel lesions in neonates with NEC. Eur J Pediatr Surg Rep 5(1):e43–e46

    Article  Google Scholar 

  40. Maki AC et al (2012) Intestinal microcirculatory flow alterations in necrotizing enterocolitis are improved by direct peritoneal resuscitation. Am Surg 78(7):803–807

    Article  PubMed  Google Scholar 

  41. Nowicki PT, Nankervis CA (1994) The role of the circulation in the pathogenesis of necrotizing enterocolitis. Clin Perinatol 21(2):219–234

    Article  CAS  PubMed  Google Scholar 

  42. Gonzalez LM et al (2019) Preservation of reserve intestinal epithelial stem cells following severe ischemic injury. Am J Physiol Gastrointest Liver Physiol 316(4):G482–G494

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Nigmatullina L et al (2017) Id2 controls specification of Lgr5(+) intestinal stem cell progenitors during gut development. EMBO J 36(7):869–885

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  44. Drucker NA et al (2018) Stem cell therapy in necrotizing enterocolitis: current state and future directions. Semin Pediatr Surg 27(1):57–64

    Article  PubMed  Google Scholar 

  45. Drucker NA et al (2019) Inhibiting hydrogen sulfide production in umbilical stem cells reduces their protective effects during experimental necrotizing enterocolitis. J Pediatr Surg 54(1168):1173

    Google Scholar 

  46. Doster DL et al (2016) Mesenchymal stromal cell therapy for the treatment of intestinal ischemia: defining the optimal cell isolate for maximum therapeutic benefit. Cytotherapy 18(12):1457–1470

    Article  PubMed  PubMed Central  Google Scholar 

  47. Markel TA et al (2015) Human mesenchymal stromal cells decrease mortality after intestinal ischemia and reperfusion injury. J Surg Res 199(1):56–66

    Article  CAS  PubMed  Google Scholar 

  48. Markel TA et al (2020) Human mesenchymal stem cell hydrogen sulfide production critically impacts the release of other paracrine mediators after injury. J Surg Res 254:75–82

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. Markel TA et al (2008) Stem cells as a potential future treatment of pediatric intestinal disorders. J Pediatr Surg 43(11):1953–1963

    Article  PubMed  PubMed Central  Google Scholar 

  50. Drucker NA et al (2018) Hydrogen sulfide provides intestinal protection during a murine model of experimental necrotizing enterocolitis. J Pediatr Surg 53(9):1692–1698

    Article  PubMed  Google Scholar 

  51. Weil BR et al (2009) Mesenchymal stem cells enhance the viability and proliferation of human fetal intestinal epithelial cells following hypoxic injury via paracrine mechanisms. Surgery 146(2):190–197

    Article  PubMed  Google Scholar 

Download references

Funding

This study was funded by K08DK113226 from the National Institutes of Health, the George H. Clowes Memorial Research Career Development Award, the Riley Children’s Foundation, the Gerber Foundation, and the Department of Surgery at the Indiana University School of Medicine.

Author information

Author notes

  1. Brian D. Hosfield and W. Christopher Shelley contributed equally to this work.

Authors and Affiliations

  1. Department of Surgery, Section of Pediatric Surgery, Indiana University School of Medicine, Indianapolis, IN, USA

    Brian D. Hosfield, W. Christopher Shelley, Fikir M. Mesfin, John P. Brokaw, Krishna Manohar, Jianyun Liu, Hongge Li, Anthony R. Pecoraro & Troy A. Markel

  2. Indiana Center for Regenerative Medicine and Engineering, Indiana University School of Medicine, Indianapolis, IN, USA

    Kanhaiya Singh

  3. Riley Hospital for Children at Indiana University Health, 705 Riley Hospital Dr., RI 2500, Indianapolis, IN, USA

    Troy A. Markel

Authors
  1. Brian D. Hosfield
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. W. Christopher Shelley
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Fikir M. Mesfin
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. John P. Brokaw
    View author publications

    You can also search for this author in PubMed Google Scholar

  5. Krishna Manohar
    View author publications

    You can also search for this author in PubMed Google Scholar

  6. Jianyun Liu
    View author publications

    You can also search for this author in PubMed Google Scholar

  7. Hongge Li
    View author publications

    You can also search for this author in PubMed Google Scholar

  8. Anthony R. Pecoraro
    View author publications

    You can also search for this author in PubMed Google Scholar

  9. Kanhaiya Singh
    View author publications

    You can also search for this author in PubMed Google Scholar

  10. Troy A. Markel
    View author publications

    You can also search for this author in PubMed Google Scholar

Corresponding author

Correspondence to Troy A. Markel.

Ethics declarations

Conflict of interest

TAM receives consulting fees from Noveome Biotherapeutics. There is no direct conflict with the information presented in this manuscript.

Ethical approval

All animal work in this study followed an IACUC-approved protocol at the Indiana University School of Medicine.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Appendix

Appendix

Primers (5′ → 3′).

Primer

Primer sequences

GPR49-1

CGACAACCACTACCTGAGCA

GPR49-2

CGGGACCAGATGCGATA

GPR49-3

AGCTAGGCTCTGCTCTGTCA

Bmi1

TAGACTTTTCTCGAGGTTTTCATGGTGTTACCTAAGACAAAAGACATCTCACCCTCTATGATGGACTTACTTCTGAGAGTGCGTTTGAGGCACTTATGGCTTACTAAGCAGTGTGTCACCATACTTGAAAACACTTCCATTTA TTGTATCTGGGATGAGGCTTTTTACCCTTACTCAATTTGA AAATTGC TTAAGCTTAAATGATATTTCAGTCAAAATTTGTCTTTTAATAAAACAACAGAAAGATG

GAPDH

AGCTCCCCCCCACCATCCGGGTTCCTATAAATACGGACTGCAGCCCTCCCTGGTGCTCTCTGCTCCTCCCTGTTCCAGAGACGGCCGCATCTTCTTGTGCAGTGCCAGCCTCGTCCCGTAGACAAAATGGTGAAGGTCGGT GTGAACGGATTTGGCCGTATTGGGCGCCTGGTCACCAGGGCTGCCA TTTGCAGTGGCAAAGTGGAGATTGTTGCCATCAACGACCCCTTCAT TGACCTCAACTACATGGTCTACATGTTCCAGTATGACTCCACTCACGG CAAATTCAACGGCACAGTCA

Rights and permissions

Springer Nature or its licensor holds exclusive rights to this article under a publishing agreement with the author(s) or other rightsholder(s); author self-archiving of the accepted manuscript version of this article is solely governed by the terms of such publishing agreement and applicable law.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Hosfield, B.D., Shelley, W.C., Mesfin, F.M. et al. Age disparities in intestinal stem cell quantities: a possible explanation for preterm infant susceptibility to necrotizing enterocolitis. Pediatr Surg Int 38, 1971–1979 (2022). https://doi.org/10.1007/s00383-022-05257-1

Download citation

  • Accepted:

  • Published:

  • Issue Date:

  • DOI: https://doi.org/10.1007/s00383-022-05257-1

Keywords

Search

Navigation