High-Yielding Laccase Strain Breeding and Optimization of Fermentation Conditions

Abstract

Objective: Laccase is a copper-containing polyphenol oxidase, which is widely used in papermaking, food, environmental treatment and bioenergy. At present, white rot fungi is one of the important laccase-producing microbes, but there is still a big gap between laccase large-scale industrial production and use. Therefore, screening efficient laccase producing strains and improving laccase production are one of the important links to promote its development and utilization. Methods: firstly, the strains with high laccase yield were screened by aniline blue medium, and then strains with decolorizing transparent circle were re-screened by enzyme activity determination, so as to screen the strains with high laccase yield. The growth state of the strain was observed, and strain identification was carried out. ARTP mutagenesis technology was used to mutagenize the strain, and the dominant mutant strain with high laccase production was screened; the fermentation conditions of the dominant mutant strain were optimized to further improve enzymatic activity. Results: A dominant strain W11 with high laccase production was obtained through the primary screening of aniline blue medium and the secondary screening of fermentation enzyme production test, and the enzyme activity was up to 17.3 IU/mL, which was identified as Mucor fragilis. Through mutation breeding, a total of 42 forward mutants were screened in this study, among which the M28 mutant had the highest enzyme activity of 41.2 IU/mL, which was 138.2% higher than that before mutagenesis, and could be inherited stably. In this study, the highest enzyme activity of Mucor fragilis was 49.5 IU/mL under the fermentation conditions of 10g xylose, 10g yeast powder, pH6.5 and 100r/min. Conclusion: A strain with high laccase production was obtained through strain breeding, and the laccase activity was further improved by optimizing the fermentation conditions, which will surely provide new ideas for the large-scale production and utilization of laccase.

Appendix

Support Material 1

The strain was identified as Mucor and presumed to be Mucor fragilis.

${\rm{IS329}}{\rm{-}}{\rm{3}}\quad {\rm{525bp}}$

$$\begin{aligned} & {\rm{GGCTTGTCCATCATTATCTATTTACTGTGAACTGTATTATTACTTGACGCTTGAG}} \\ & {\rm{GGATGTTCCAATGCTATAAGGATAGGCACTGGAAATGTTAACCGAGTCATAATCAA}} \\ & {\rm{GCTTAGGCTTGGTATCCTATTATTATTTACCAAAAGAATTCAGAATTAATATTGTAA}} \\ & {\rm{CATAGACGTAAAAAATCTATAAAACAACTTTTAACAACGGATCTCTTGGTTCTCGC}} \\ & {\rm{ATCGATGAAGAACGTAGCAAAGTGCGATAACTAGTGTGAATTGCATATTCAGTGA}} \\ & {\rm{ATCATCGAGTCTTTGAACGCAACTTGCGCTCATTGGTATTCCAATGAGCACGCCTG}} \\ & {\rm{TTTCAGTATCAAAACAAACCCTCTATCCAACTTTTGTTGAATAGGATGACTGAGAG}} \\ & {\rm{TCTCTTGATCTATTCTGATCTTGAACCTCTTGAAATGTACAAAGGCCTGATCTTGTT}} \\ &{\rm{TGAATGCCTGAACTTTTTTTTAATATAAAGAGAAGCTCTTGCGATAAAACTGTGCT}} \\ & {\rm{GGGGCCTCCCAAATAACACAT}} \\ \end{aligned}$$

Description	Max Score	Total Score	Query Cover	E value	Per. Ident	Accession
Mucor fragilis isolate MZC-1 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	970	970	100%	0.0	100.00%	MN069560.1
Mucor fragilis isolate PF-501 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	970	970	100%	0.0	100.00%	MN752145.1
Mucor fragilis isolate F8199 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	970	970	100%	0.0	100.00%	MN429249.1
Mucor fragilis isolate BC3 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	970	970	100%	0.0	100.00%	MK910073.1
Circinomucor sp. 1 ERP-2018 genomic DNA sequence contains 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2, 28S rRNA gene	970	970	100%	0.0	100.00%	LR536786.1
Circinomucor sp. 1 ERP-2018 partial 28S rRNA gene	970	970	100%	0.0	100.00%	LR536781.1
Mucor fragilis strain 16 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	970	970	100%	0.0	100.00%	MZ351294.1
Mucor fragilis isolate DCR14 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence	970	970	100%	0.0	100.00%	MZ047569.1ara>
Mucor fragilis isolate PF-063 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	970	970	100%	0.0	100.00%	MN722545.1
Mucor fragilis isolate PC-502 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence	970	970	100%	0.0	100.00%	MW063607.1