Tumor Biology

, Volume 35, Issue 1, pp 567–572

Association of Kaposi’s sarcoma-associated herpesvirus (KSHV) with bladder cancer in Croatian patients

Authors

  • Martina Paradžik
    • School of MedicineUniversity of Split
  • Viljemka Bučević-Popović
    • Department of Chemistry, Faculty of ScienceUniversity of Split
  • Marijan Šitum
    • Department of UrologyClinical Hospital Split
  • Crystal J. Jaing
    • Global Security, Lawrence Livermore National Laboratory
  • Marina Degoricija
    • School of MedicineUniversity of Split
  • Kevin S. McLoughlin
    • Global Security, Lawrence Livermore National Laboratory
  • Said I. Ismail
    • Molecular Biology Research Lab, Department of Biochemistry, Faculty of MedicineUniversity of Jordan
  • Volga Punda-Polić
    • School of MedicineUniversity of Split
    • School of MedicineUniversity of Split
Research Article

DOI: 10.1007/s13277-013-1079-2

Cite this article as:
Paradžik, M., Bučević-Popović, V., Šitum, M. et al. Tumor Biol. (2014) 35: 567. doi:10.1007/s13277-013-1079-2

Abstract

As the seventh most common human malignancy, bladder cancer represents a global health problem. In addition to well-recognized risk factors such as smoking and exposure to chemicals, various infectious agents have been implicated as cofactors in the pathogenesis of urothelial malignancies. The aim of the present study was to assess the possible association of viral infection and bladder cancer in Croatian patients. Biopsy specimens were collected from a total of 55 patients diagnosed with different stages of bladder cancer. Initial screening of DNA extracts for the presence of viruses on Lawrence Livermore Microbial Detection Array revealed Kaposi’s sarcoma-associated herpesvirus (KSHV) in each of three randomly chosen biopsy specimens. The prevalence of infection with KSHV among study population was then examined by KSHV-specific polymerase chain reaction (PCR) and immunoblotting. By nested PCR, KSHV DNA was detected in 55 % of patients. KSHV, also known as human herpesvirus 8, is an infectious agent known to cause cancer. Its oncogenic potential is primarily recognized from its role in Kaposi’s sarcoma, but it has also been involved in pathogenesis of two lymphoproliferative disorders. A high prevalence of KSHV infection in our study indicates that KSHV may play a role in tumorigenesis of bladder cancer and warrants further studies.

Keywords

Bladder cancerHuman herpesvirus 8Kaposi’s sarcoma-associated herpesvirusMicroarray

Introduction

Bladder cancer is the seventh most common malignancy globally [1]. Due to a high rate of disease recurrence and the need for an intensive follow-up, the management of bladder cancer represents a significant burden to the healthcare systems. The incidence of bladder cancer is three times higher in men than in women, ranking it the fifth most frequently diagnosed tumor in Croatian male population [2]. The most important risk factor for bladder cancer is cigarette smoking, which is thought to account for approximately 60 % bladder cancer cases [3]. A high risk for bladder cancer has also been reported among individuals exposed to chemicals such as aromatic amines, aniline dyes, coal, arsenic, etc. [3, 4]. During the past decade, evidence has accumulated indicating an association between infectious agents and urogenital cancers [5]. The infestation with Schistosoma haematobium, prevalent throughout Africa and Middle East, is well-documented to predispose patients to urinary bladder cancer [68]. Several studies have reported on detection of members of human papilloma, polyoma, and herpes virus families in urological malignancies [915]. However, the role of oncogenic viruses as possible cofactors in the development and progression of vesical neoplasms remains elusive.

Kaposi’s sarcoma-associated herpesvirus (KSHV), also known as human herpesvirus 8 (HHV8) was first isolated from Kaposi’s sarcoma tissues obtained from AIDS patients [16]. The virus is linked to at least two other malignancies: primary effusion lymphoma and multicentric Castleman disease [17]. KSHV belongs to γ-herpesvirus subfamily that includes human Epstein–Barr virus, also strongly associated with neoplastic diseases [18]. Both viruses primarily target B cells, but in vitro experiments show that KSHV is capable of efficient infection of various cell types [19].

A number of KSHV proteins posses transforming and oncogenic properties as evidenced by their ability to promote cell growth and division, modulate inflammation, inhibit apoptosis, or induce angiogenesis [18, 20]. Some of the pathogenic effects of KSHV can be attributed to altered NF-κB signaling in infected cells [21]. As all herpesviruses, KSHV displays two different genetic programs: latency and lytic replication. A prominent feature of KSHV-driven tumor formation is that it requires expression of both latent and lytic genes. During latent infection, the viral DNA is present in the form of large episome. Only a small subset of genes is expressed, including latency-associated nuclear antigen (LANA-1), v-cyclin, v-FLIP, kaposins, and numerous miRNA. The lytic cycle is characterized by the expression of more than 80 transcripts and is believed to be necessary for continuous infection of new cells and persistence of KSHV within tumor tissue. Since lytic replication results in cell death, the proteins expressed at this phase are likely to contribute to tumor pathogenesis through paracrine signaling [20, 22]. Despite obvious tumorigenic potential, it seems that KSHV, on its own, rarely causes serious disease, unless the host immune system is compromised. In fact, several seroprevalence reports suggest that the KSHV infection in otherwise healthy adults may be much more common than originally anticipated [17, 23]. KSHV is particularly widespread in sub-Saharan Africa, where KSHV is found in more than 50 % adults, followed by parts of Mediterranean basin, with seroprevalence rates between 10 and 30 % [24].

In this study, we report the detection of KSHV in bladder cancer tissue specimens of Croatian patients. Upon initial screening using the Lawrence Livermore Microbial Detection Array (LLMDA), the prevalence of KSHV in bladder cancer biopsies was examined by polymerase chain reaction and western blot. The frequent detection of the virus in tumorous tissue suggests that KSHV may play a cofactor role in urothelial malignancies.

Materials and methods

Patients and tissue specimens

A total of 55 patients (44 men and 11 women) diagnosed with bladder cancer were included in the study. The patients were admitted at the Department of Urology, University Hospital Split for surgical transurethral resection in the period from May 2009 to May 2010. The patients’ age ranged from 34 to 90 years (median 74.5). Certified pathologist determined grade and tumor stage for individual tumor samples. Tissue samples were stored in liquid nitrogen until the extraction of DNA and proteins. The study was approved by the Ethics Committee of the University Hospital in Split and informed consent was obtained.

Extraction of DNA and proteins

Tissue samples were crushed to powder using a pre-chilled tissue pulverizer. The powder was suspended in Qiazol Lysis Reagent and then used for sequential extraction of total DNA and proteins. DNA was precipitated from the organic phase with the addition of 100 % ethanol, followed by washing the pellet with 0.1 M sodium citrate and 75 % ethanol. The DNA pellet was dissolved in sterile water. The supernatant obtained after DNA extraction was treated with isopropanol to precipitate proteins. After several washes in guanidine–ethanol, and a 100 % ethanol wash, the protein pellet was resuspended in 1 % sodium dodecyl sulfate (SDS) and stored at −80 °C.

Microbial detection array

For initial screening of viral sequences, 0.5 μg DNA isolated from bladder cancer biopsies was fluorescently labeled with Cy3-labeled random nonamers using Roche NimbleGen one-color labeling kit. Around 10 μg of labeled DNA was obtained after the labeling reaction out of which 2 μg was hybridized to the LLMDA for 16 h as previously described [25]. The array was scanned using the Axon 4000B scanner (Molecular Devices), and the data was analyzed using the composite likelihood maximization analysis method [25]. We used LLMDA v.2 which covers all complete bacterial and viral genome sequences available before spring 2007 with a set of oligonucleotide probes designed for each genome target [25]. This array was recently used in the detection of a number of different viruses (e.g., human herpesvirus 1, human papillomavirus, BK polyomavirus, rotavirus, etc.) from human clinical samples which indicates the broad-spectrum microbial screening potential of this technology [26].

Polymerase chain reaction and DNA sequencing

Polymerase chain reaction (PCR) was performed to examine the presence of KSHV sequences in the samples. Specific sequences within the vGPCR gene (ORF74) were amplified in a nested PCR reaction. After first-round amplification with outer primers (forward, 5′ TTCAGTGTTGTGTGCGTCAG 3′; reverse, 5′ GTTTCCCGCGTTCTCATAAC 3′ [27]), PCR products were used as templates for amplification with inner primers (forward, 5′ CGCTGCACTGTTAATTGCAT 3′; reverse, 5′ CATAACACATGGCCTGCTTG 3′). The PCR reaction mixture was composed of 1 μl of DNA extract, 0.25 mM of each dNTP, 0.2 μM of each primer, DreamTaqTM buffer, and 1.25 units of DreamTaq DNA polymerase in a total volume of 25 μl. The same reaction conditions were employed for both rounds of PCR: initial denaturation at 94 °C for 1 min, 36 cycles of 30 s at 94 °C, 30 s at 56 °C, 45 s at 72 °C, and a terminal elongation 72 °C for 2 min. PCR product was analyzed by electrophoresis on 8 % polyacrylamide gel stained with ethidium bromide and photographed on a UV light transluminator. KSHV DNA extracted from a Kaposi’s sarcoma male patient (HIV negative) was used as the positive control. To confirm the specificity of amplification, PCR product was sequenced using the inner primer pair used in the PCR reaction. The sequencing was performed at Eurofins MWG Operon (Germany).

Western blot

Protein samples were run on 6 % SDS-polyacrylamide gel and transferred onto a nitrocellulose membrane. After blocking, the blots were incubated with 1:1,000 dilution of rat monoclonal antibody to KSHV LANA-1 encoded by ORF73 (Advanced Biotechnologies Inc., USA). Blots were washed and then incubated with goat anti-rat immunoglobulin antibody conjugated to horseradish peroxidase (Cell Signaling Technology, USA) at 1:5,000 dilution. The protein was detected using Western Blotting Luminol Reagent (Santa Cruz Biotechnology Inc., USA).

Results

Initial screening for viruses in bladder cancer tissue

During initial screening, three bladder cancer specimens were randomly chosen from the collection and examined for the presence of viruses. DNA isolates were tested on LLMDA v.2, which detected KSHV (HHV8) sequences in all three samples (66 %) (Fig. 1). The log likelihood is estimated from the BLAST similarity scores of the probes to each of the possible target sequences, together with the probe sequence complexity and other covariates derived from the BLAST results. The conditional log-odds scores shows the contribution from a target that cannot be explained by another, more likely target above it, while the unconditional score illustrates that some very similar targets share a number of probes. The conditional and unconditional log-odds scores and the number of probes detected vs. expected for KSHV for the three samples are summarized in Table 1.
https://static-content.springer.com/image/art%3A10.1007%2Fs13277-013-1079-2/MediaObjects/13277_2013_1079_Fig1_HTML.gif
Fig. 1

LLMDA analysis identified KSHV (HHV8) from bladder cancer DNA samples. Results from the LLMDA microarray data were analyzed using the composite likelihood maximization method developed at Lawrence Livermore National Laboratory [25]. Targets are color coded and grouped by taxonomic family. Targets predicted as likely to be present are indicated in red text. The lighter and darker colored portions of the bars represent the unconditional and conditional log-odds scores, respectively. In all three samples, HHV8 was detected to be most likely present, while other target sequences (e.g., murid herpesvirus 2, equid herpesvirus 2) that share some sequence homology to HHV8 were also detected at a lower likelihood score. a Detection of KSHV in sample B001. b Detection of KSHV in sample B002. c Detection of KSHV in sample B003

Table 1

KSHV (HHV8) from the bladder cancer samples were detected on the LLMDA. Results from the microarray data were analyzed using the composite likelihood maximization method developed at Lawrence Livermore National Laboratory [25]. The conditional and unconditional log-odds scores and the number of probes detected vs. expected for KSHV for the three samples are shown

Sample

Unconditional log_odds

Conditional log_odds

Number of expected probes

Number of detected probes

Target sequence name

B001

23.9

5.8

23

8

Human herpesvirus 8, complete genome

B002

38.3

25.2

23

9

Human herpesvirus 8, complete genome

B003

33.9

24.2

23

9

Human herpesvirus 8 type M, complete genome

Detection of KSHV by PCR and sequencing

Guided by the results of LLMDA, we used PCR with specific primers to evaluate the presence of KSHV in collected bladder cancer samples. We preliminarily tested several KSHV-specific primer sets [27]: ORFK9-3, ORF26, ORF72, and ORF74. Highest sensitivity was obtained with nested PCR method, using ORF74 primers and an inner primer set designed for this study, which detected KSHV in 30 out of 55 patients (55 %) (Fig. 2). The sequencing of the 95-bp band confirmed that the amplified PCR product represents the KSHV-specific ORF74 sequence. No significant association was found between KSHV positivity and age, gender, or tumor stage (Table 2).
https://static-content.springer.com/image/art%3A10.1007%2Fs13277-013-1079-2/MediaObjects/13277_2013_1079_Fig2_HTML.gif
Fig. 2

Representative results of KSHV ORF74 amplification by nested PCR from DNA extracts of bladder cancer tissues. The polyacrylamide gel shows the amplification of a 95-bp band corresponding to ORF74 in KSHV-positive patients (lanes 1 and 2) and no amplification in KSHV-negative patients (lanes 3–5). The marker (M) is TriDye 100 bp DNA ladder (New England Biolabs)

Table 2

Distribution of KSHV positives among cases in the study population

 

KSHV

Positive/total

Sex

 Male

24/44

 Female

6/11

Age (years)

 <67

12/19

 67–79

9/23

 >79

9/13

Tumor stage

 Ta

16/30

 Ta-T1

1/1

 T1

5/11

 T2

6/9

 T3

1/2

 T4

1/2

Analysis of KSHV proteins in cancer tissue specimens

In order to determine the presence of viral proteins in tissue specimens, we used western blotting approach to detect KSHV LANA-1 protein. Protein samples extracted from tumorous tissues of some patients were positive when tested with anti LANA-1 antibody (Fig. 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs13277-013-1079-2/MediaObjects/13277_2013_1079_Fig3_HTML.gif
Fig. 3

Western blot analysis of bladder cancer proteins for the presence of KSHV LANA-1. Multiple protein bands of various intensity were detected with anti-LANA-1 antibody in KSHV-positive patients (lanes 1, 2, 4, and 5) compared to a KSHV negative patient (lane 3)

Discussion

Here, we report the detection of KSHV in urothelial carcinoma tissue specimens possibly linking KSHV with bladder cancer development. So far, urothelial cancer has been casually associated with parasitic infestation with S. haematobium, while the role of viral and bacterial infections is poorly understood. Several reports published in the past decade indicated the presence of different viral pathogens in bladder cancer tissue. A recent study analyzing 30 tumor samples showed the presence of cytomegalovirus in 73 %, Epstein–Barr virus in 50 %, herpes simplex 6 virus in 37 %, and KSHV in one tested tumor sample [15]. It is interesting to note that over 50 % of all tumors from the same study were infected with more than one type of the virus. Previous studies implicated human papillomavirus [9, 10] in bladder cancer pathogenesis while other groups reported finding herpes simplex virus types 2 and 6 [12, 13].

KSHV or HHV8 is proven to be implicated in pathogenesis of Kaposi’s sarcoma [16] as well as in primary effusion lymphoma and Castleman’s disease [17]. KSHV was identified in prostate tissue [14], but subsequent studies failed to confirm association with prostate malignancies. By using nested PCR approach, one recent study reported the identification of KSHV among bladder cancer specimens [15]. Here, we report a rather high rate of 55 % of KSHV-positive bladder cancer specimens. This could be explained by high seropositivity observed in the Mediterranean region, although seropositivity has not been determined for this particular population. Initially, KSHV was identified by using microbial detection array based on hybridization of viral DNA to the DNA probes on the array and was followed by PCR reaction. Highest sensitivity was obtained by nested PCR, possibly indicating a relatively low viral load in tested samples. Furthermore, by western blot, we were able to confirm the presence of viral protein in cancerous tissue.

KSHV is a member of γ-herpesviridae that possesses different viral genes that are able to subvert various cellular processes including cell proliferation, apoptosis, angiogenesis, and to deregulate different signaling pathways [18]. KSHV viral gene products vFLIP and vGPCR have the potential to elevate NF-κB activity. NF-κB signaling pathway is well known for its positive role in tumor development and progression and is associated with different malignancies [21, 28]. An increased NF-κB activity in tumor samples was indeed observed (Degoricija and Terzić, unpublished data).

In conclusion, by using several research approaches, we detected KSHV in bladder cancer specimens, which indicate the possible association between KSHV with bladder cancer. Additional studies are needed to confirm our findings, as well as animal model-based studies, to prove a possible causative role of KSHV in this cancer type. However, our study opens interesting avenues for future research of bladder cancer and is bringing viral and bacterial pathogens into the researchers focus. Studying urinary microbial system in different health and pathological states will most probably bring novel preventive and therapeutic measures into clinical practice.

Acknowledgments

The authors want to thank to Mrs. Sandra Vujević for excellent technical assistance during sample preparation and to Mr. James Thissen from Lawrence Livermore National Laboratory for his technical assistance in microarray experiments. We thank Prof. Ivan Đikić for providing us with many reagents needed for this study. This project was supported by the Croatian Ministry of Science, Education and Sports, grant number 216-000000-3348 to JT and grant number 216-0481153-1148 to VPP and by the city of Split support to JT laboratory.

Conflicts of interest

None.

Copyright information

© International Society of Oncology and BioMarkers (ISOBM) 2013