Conservation Genetics Resources

, Volume 5, Issue 4, pp 1031–1033

Characterization of microsatellite loci for Cypripediumkentuckiense (Orchidaceae)

Authors

  • Madhav Pandey
    • Department of Plant and Soil ScienceTexas Tech University
    • Department of Plant and Soil ScienceTexas Tech University
Technical Note

DOI: 10.1007/s12686-013-9961-1

Cite this article as:
Pandey, M. & Sharma, J. Conservation Genet Resour (2013) 5: 1031. doi:10.1007/s12686-013-9961-1

Abstract

Cypripedium kentuckiense is one of the 15 Cypripedium species found in North America. Its populations are threatened by illegal collection and land conversion. Assessing the level of genetic variation within-and-among populations employing species-specific and variable co-dominant molecular markers such as microsatellite can assist in developing appropriate conservation strategies. For the first time, we report eight polymorphic nuclear microsatellite markers for C. kentuckiense. Number of alleles per locus ranged from two to eight and the mean number of alleles across eight loci was 4.13. Mean observed (Ho) and expected heterozygosity (He) values were 0.514 and 0.522, respectively. The eight markers reported in this study can be used to estimate genetic diversity, genetic structure, gene flow, and mating system of the species.

Keywords

Conservation geneticsCypripedium kentuckienseMicrosatelliteOrchid

Kentucky lady’s slipper orchid (Cypripedium kentuckiense C.F. Reed) is a perennial herbaceous orchid native to the United States. Mature plants have two to three large leaves and bear one to two flowers during April to June. It has the largest flowers among the 15 Cypripedium taxa occurring in North America (http://www.efloras.org/browse.aspx?flora_id=1&start_taxon_id=109046). No information about pollination biology and mating system of this species is available. Currently, there are 156 individual populations of C. kentuckiense distributed in 10 southern States, but most of the populations (68 %) are located in Arkansas and Kentucky (Weldy et al. 1996; Case et al. 1998). Together, poaching and land use changes such as conversion of wild land to agriculture and urban centers have led to the loss of its natural habitats and populations. Globally, it is ranked as G3 (vulnerable) and in the United States it is listed variably as S1 (critically imperiled) to S3 (vulnerable) in the 10 States where it occurs (NatureServe 2013). The taxon is also listed in Appendix II of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES).

An earlier study based on isozyme markers reported relatively low levels of genetic variation in C. kentuckiense (Case et al. 1998) as compared to other members of the genus (Case 1994; Wallace and Case 2000, Izawa et al. 2007; Chung et al. 2009). Highly species-specific and variable co-dominant molecular markers such as microsatellites, also known as simple sequence repeats (SSRs), will allow thorough evaluation of the genetic diversity, population genetic structure and mating system of the species. However, SSRs have not been identified for this species. The aim of the present study was to isolate and characterize polymorphic nuclear SSR markers in C. kentuckiense.

The details of the procedure we used to isolate microsatellites are presented in Pandey and Sharma (2012). In this study, we focus only on the characterization of microsatellites in C. kntuckiense. A total of 69 primer pairs were selected for the initial PCR amplification tests using eight individual DNA samples of C. kentuckiense collected from four populations from Arkansas, Georgia, Kentucky, and Tennessee. Forward primer of each pair of primers was tagged with M13 (CACGACGTTGTAAAACGAC) at the 5′ end. Separately, the M13 was labeled with wellred D4 fluorescent dye (Sigma). PCR was performed in 10 μL reaction volumes using Qiagen Taq DNA polymerase kit (Qiagen) and run in an epGradients Master Cycler (Eppendorf). We used ~30 ng of total DNA in each reaction. PCR amplification was carried out using touchdown program as follows: initial denaturation step at 94 °C for 3 min, followed by 19 cycles of denaturation at 94 °C for 45 s, 30 s of upper annealing (see Table 1) and decreasing 0.5 °C each cycle, extension at 72 °C for 45 s. This was followed by 20 cycles of denaturation at 94 °C for 45 s, lower annealing (see Table 1) for 30 s, and a final extension step at 72 °C for 7 min. Samples showing bands of expected sizes in agarose gel were separated using GenomeLab GeXP Genetic Analysis System (Beckman Coulter). Out of the 69 SSRs tested, 25 produced bands of expected sizes. Seventeen of the 25 SSRs showed either unscorable or multiple bands. The remaining eight SSRs that showed clear polymorphic alleles of expected sizes were selected to estimate population genetic parameters using 27 individuals of C. kentuckiense collected from Kentucky.
Table 1

Primer sequences and genetic diversity estimates of eight microsatellites markers isolated from Cypripedium kentuckiense

Locus

Repeat motif

Primer sequence (5′–3′)

Ta (oC)

Product size (bp)a

Na

Ho

He

GenBank accession

Ck_1949

(CTT)16

F: ACGGTAGTAGGGACAAATTG

R: ACTGCTATTGAAGGCTCATAG

64–55

123–160

6

0.778

0.783

KC990092

Ck_2160

(AG)11

F: GAGATCTGGAAGTGCTGTTG

R: CTTATCTTCACAGCCACATG

67–58

301–303

2

0.296

0.302

KC990093

Ck_2219

(GAT)16

F: AGCATTCGGGAACTACTATG

R: ATCTACTCATCGGCCTCATC

71–62

181–199

4

0.593

0.508

KC990094

Ck_383

(TGAA)11

F: GGACCATGAAGAAATGAATG

R: ATTCAATCTGCCAGACACC

67–58

151–175

5

0.333

0.378

KC990095

Ck_D140

(AG)9

F: AAGGAAGGAGGTGAGAAATC

R: AGCCAGCAACAAGAAATTAC

65–56

201–205

3

0.407

0.324

KC990096

Ck_NO9G

(CT)9

F: CCATTTGTCTCCCTTGATG

R: TTGGTCGACTAGATTTGGAC

66–57

176–180

3

0.481

0.571

KC990097

Ck_N844

(CTT)12

F: CCTTCGCTACTCTCACATTC

R: AGAAGAGAGGATTGGAGACC

64–55

320–377

8

0.704

0.800

KC990098

Ck_VAIQ

(AG)12

F: CCATGTGTAGCCCTAGTTTC

R: CACATCCTAAGGCCTCTAAG

64–55

210–226

2

0.519

0.510

KC990099

Mean

    

4.13

0.514

0.522

 

Ta range of upper and lower annealing temperatures in touchdown PCR, Na number of alleles, Ho observed heterozygosity, He expected heterozygosity

aProduct size including M13 tag

We estimated genetic diversity parameters: mean number of alleles (Na), observed (Ho), and expected heterozygosities (He) by using the program GENALEX version 6.3 (Peakall and Smouse 2006). Test of deviation from Hardy–Weinberg equilibrium and linkage disequilibrium was performed using web-based GENPOP version 4.2 (Raymond and Rousset 1995; http://genepop.curtin.edu.au/genepop_op1.html). Presence of null alleles was checked using MICRO-CHECKER version 2.2.3 (Van Oosterhout et al. 2004).

Number of alleles per locus ranged from two to eight with the mean number of alleles across the eight loci being 4.13 (Table 1). Observed (Ho) and expected heterozygosity (He) values ranged from 0.296 to 0.778 and 0.302 to 0.800, respectively. Mean Ho and He were 0.514 and 0.522, respectively. None of the loci showed any deviation from Hardy–Weinberg equilibrium. Except between the loci Ck_383 and Ck_2219, Ck_2219 and Ck_D140, Ck_1949 and Ck_2160, and Ck_NO9G and Ck_2160, none of the other combinations showed any linkage among loci. No evidence of null alleles was found in any of the eight loci. The eight polymorphic SSR loci reported in this study will be useful for assessing genetic diversity, population structure, and mating system of C. kentuckiense.

Copyright information

© Springer Science+Business Media Dordrecht 2013