Conservation Genetics Resources

, Volume 5, Issue 1, pp 275–277

Isolation and development of 13 new, polymorphic microsatellite loci for a threatened, understory tree, Mesogyne insignis, (Moraceae) from the Eastern Arc Mountains

Authors

  • K. C. Murdoch
    • Department of Biological, Chemical, and Physical Sciences (WB 816)Roosevelt University
    • The Field Museum
  • H. J. Ndangalasi
    • Department of BotanyUniversity of Dar es Salaam
  • M. K. LeCaptain
    • Department of Biological, Chemical, and Physical Sciences (WB 816)Roosevelt University
  • W. L. Clement
    • Department of BiologyThe College of New Jersey
  • K. A. Feldheim
    • The Field Museum
    • Department of Biological, Chemical, and Physical Sciences (WB 816)Roosevelt University
    • The Field Museum
Technical Note

DOI: 10.1007/s12686-012-9786-3

Cite this article as:
Murdoch, K.C., Ndangalasi, H.J., LeCaptain, M.K. et al. Conservation Genet Resour (2013) 5: 275. doi:10.1007/s12686-012-9786-3
  • 55 Views

Abstract

Fourteen microsatellite loci were isolated from Mesogyneinsignis, a threatened, African understory tree. Alleles ranged between two and eight per locus, with expected heterozygosity ranging from 0.063 to 0.845 and observed heterozygosity ranging from 0.000 to 0.733. One locus departed from Hardy–Weinberg equilibrium leaving 13 polymorphic loci that will be used to study the genetic variability of fragmented populations so as to enhance the species conservation efforts.

Keywords

CastilleaeEastern Arc MountainsMesogyne insignisMicrosatellite markersMoraceaeTanzania

Mesogyne insignis is a monoecious understory shrub or tree in the mulberry family, Moraceae (Berg 1977; Datwyler and Weiblen 2004). Mesogyne has a disjunct distribution and occurs in São Tomé, (Gulf of Guinea) and the Eastern Arc Mountains (Tanzania; Berg 1977; Figueiredo 1994). It is listed as vulnerable on the Red List (IUCN 2012). Mesogyne is monotypic and represents one of a few paleotropical lineages of the tribe Castilleae (Datwyler and Weiblen 2004). Its closest relative, Antiaris toxicaria, has a range that spans the paleotropics (Berg 1977). By comparison, M. insignis is much restricted in its distribution and poorly studied among African Moraceae.

Ecological studies on gene flow and population structure are essential toward the conservation of this endemic, threatened species. Habitat loss and fragmentation pose the greatest threat to the Eastern Arc Mountains biodiversity hotspot (Brooks et al. 2002), which represents the majority of M.insignis’ geographic distribution. Development of microsatellite markers will allow us to investigate the genetic diversity of this species and determine if its reproductive ecology and population structure have been impacted by forest fragmentation.

Methodology

Microsatellites were developed from M. insignis leaf tissue sampled from the East Usambara Mountains, which are part of the Eastern Arc Mountains of Tanzania. Genomic DNA (gDNA) was extracted using the QIAGEN DNeasy Plant Mini Kit, following the manufacturer’s protocol (QIAGEN Inc. Valencia, CA). Microsatellite markers were developed using an enrichment protocol (Glenn and Schable 2005). Genomic DNA from four individuals was digested with BstuI and XmnI enzymes, and SuperSNX24 linkers (FOR: 5′-GTTTAAGGCCTAGCTAGCAGAATC-3′, REV: 5′-GATTCTGCTAGCTAGGCCTTAAACAAAA-3′) were ligated onto the ends of gDNA fragments. Biotinylated dinucleotide [(AG)12, (TG)12], trinucleotide [(AAC)6;(AAG)8;(ATC)8;(AAT)12;(ACT)12] and tetranucleotide [(ACAT)8, (AGAT)8, (AACT)8, (AAAT) 8, (AAGT)8] probes were hybridized to gDNA. The biotinylated probe-gDNA complexes were added to steptavidin-coated magnetic beads (Dynabeads® M-280 Invitrogen, Carlsbad, California). These mixtures were washed twice with 2× SSC, 0.1 % SDS and four times with 1× SSC, 0.1 % SDS at 52 °C. Between washes, a magnetic particle-collecting unit was used to capture the bead-DNA complex. After the last wash, enriched fragments were removed from the biotinylated probes by denaturing at 95 °C and precipitated with 95 % ethanol and 3 M sodium acetate. A “recovery” PCR was performed in a 25 μl reaction containing 1 × PCR buffer (10 mM Tris–HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2, 10× BSA, 0.16 mM of each dNTP, 0.52 μM of the SuperSNX24 forward primer, 1U Taq DNA polymerase, and enriched gDNA fragments. Thermal cycling was as follows: 95 °C for 2 min followed by 25 cycles of 95 °C for 20 s, 60 °C for 20 s, and 72 °C for 90 s, and a final elongation step of 72 °C for 30 min. PCR products were cloned using the TOPO-TA Cloning® kit following the manufacturer’s protocol (Invitrogen, Carlsbad, CA). Bacterial colonies were used as a template for subsequent PCR in a 25 μl reaction containing 1 × PCR buffer (10 mM Tris–HCl, 50 mM KCl, pH 8.3), 1.5 mM MgCl2, 10×BSA, 0.12 mM of each dNTP, 0.25 μM of the M13 primers, and 1U Taq DNA polymerase. Thermal cycling was as follows: 95 °C for 7 min, followed by 35 cycles of 95 °C for 20 s, 50 °C for 20 s, and 72 °C for 90 s. PCR products were subsequently cleaned with exonuclease I and shrimp alkaline phosphatase, following the manufacturer’s protocol (Affymetrix, Santa Clara, California). Sequencing was performed using the BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California). Ethanol precipitated sequencing products were run on an ABI 3730 DNA Analyzer. Primers for PCR were developed using Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi). PCR reactions were done in 10 μl volumes containing 1 × PCR Buffer (10 mM Tris–HCl, 1.5 mM MgCl2, 50 mM KCl, pH 8.3), 0.16 μM of a fluorescently labeled universal M13 primer and the species-specific reverse primer, 0.04 μM of the species-specific forward primer with a 5′-M13 tail (Schuelke 2000), 0.20 mM each dNTP, 1 Unit Taq and approximately 40 ng genomic DNA. Thermal cycling was as follows: 94 °C for 4 min, 30 cycles of 94 °C for 15 s, Ta (Table 1) for 15 s, and 72 °C for 45 s, followed by 8 cycles of 94 °C for 15 s, 53 °C for 15 s, and 72 °C for 45 s, then 72 °C for 10 min. A touchdown PCR was used on loci Meso2, Meso3, and Meso27. Touchdown thermal cycling profile was as follows: 94 °C for 4 min, followed by 15 cycles of 94 °C for 15 s, 62 °C for 15 s decreasing by 0.5 °C every cycle, 72 °C for 45 s, and then 19 cycles of 94 °C for 15 s, 53 °C for 15 s, 72 °C for 45 s and 72 °C for 10 min. PCR products were run on an ABI3730 DNA Analyzer using LIZ-500 as the size standard (Applied Biosystems). GENEMAPPER v3.7 was used to genotype individuals (Applied Biosystems), CERVUS v3.0.3 to calculate observed and expected heterozygosity (Marshall et al. 1998), and GENEPOP to test for Hardy–Weinberg and linkage disequilibrium (Raymond and Rousset 1995).
Table 1

Details of 14 microsatellite loci isolated from Mesogyne insignis (Moraceae)

Locus

Primer sequence (5′–3′)

Repeat motif

Size range

Ta (°C)

n

m

Ho

He

GenBank accession no.

Meso1

F: AAGGTCGTCGGTTGCAAGT

(AG)8

233–237

60

31

3

0.345

0.402

JX885821

R: ACATGTGCACCACACACAAA

       

Meso2

F: TGTACACGTGTGGAAACTGG

(TC)14

270–278

TD

31

2

0.414

0.479

JX885822

R: CCTTATGATTGTGCCCTGCT

       

Meso3

F: TCTCTTGATCCCCGAAAATG

(AG)12

269–276

TD

31

5

0.333

0.397

JX885823

R: TTGAGTATAAGGAAAGGGTGGA

       

Meso5B

F: CCGGATGTGATCATGTAATGG

(AAC)11

262–274

57

31

2

0.161

0.151

JX885824

 

R: CTGCCTCAGCTGACTCAAAA

       

Meso8

F: TCACATAGGTGAGGTCTGGTAAA

(CT)12

188–201

47

31

4

0.200

0.419

JX885825

R: CCGGCACTTTTGTTTTCAGT

       

Meso9

F: AGCTCAGATCACTCCATCCA

(TG)8

228–230

60

31

2

0.548

0.455

JX885826

R: GTTTATGGAACGGGCAAAGG

       

Meso12

F: ATTCATGTTTGTCGCTGCAT

(TG)17

184–186

59

31

2

0.000

0.063

JX885827

R: CGTTTTAGTTGCTTCGGGAAT

       

Meso17

F: CTTTCAGTGCATGCAGTTCC

(TC)14

195–215

60

31

5

0.345

0.338

JX885828

R: TGGCAGAAACTTTGTGAAGG

       

Meso19

F: GAGGATAAAGTGGCAAACAACA

(GA)12

214–222

60

31

4

0.355

0.451

JX885829

R: TTGCAATTCTATGGGAAAGGA

       

Meso23

F: GCCTCGTTGTGTCGACTAAT

(AG)12

237–247

54

31

4

0.467

0.610

JX885830

R: TCATTATTATCCAAAGGGAGTTTGA

       

Meso24*

F: AAATTGGAGATGCCCATCAA

(AG)7

216–218

54

31

3

0.000

0.542

JX885831

R: GCTTCCTTTTCCCTCGACTC

       

Meso27

F: TTCTGAAATTGTTGTTTGGATTG

(AC)10

191–200

TD

31

4

0.346

0.514

JX885832

R: CACAAAGACAAACAAAACTAGGC

       

Meso33

F: CCTTGACGGTAAAAACCCACT

(AG)14

198–220

60

31

8

0.733

0.845

JX885833

R: GGCAGACCTGCCCATATTA

       

Meso41

F: TGGATTTCTGGGGTTTTCAG

(AG)12

233–241

57

31

2

0.103

0.100

JX885834

R: CGTCCATCAAATCCACATCA

       

Ta optimized annealing temperature, n number of individuals genotyped, k number of alleles, Ho observed heterozygosity, He expected heterozygosity.* Departure from Hardy–Weinberg equilibrium following Bonferroni correction

Fourteen primer pairs (Table 1) were developed from an initial suite of 50 tested on 31 M.insignis individuals. Loci were selected on the basis of consistently clean peaks. Observed and expected heterozygosity ranged from 0.000 to 0.733 and 0.063 to 0.845 respectively (Table 1). After applying a Bonferroni correction (Rice 1989), no significant disequilibrium linkage was detected between loci. However, Meso24 significantly departed from Hardy–Weinberg equilibrium (Table 1). The remaining 13 microsatellite markers will be used for future work investigating the genetic variability among fragmented and continuous forest populations of M. insignis. This will enhance conservation strategies for the preservation of this narrowly distributed species in Tanzania.

Acknowledgments

We developed microsatellites in the Pritzker Laboratory for Molecular Systematics and Evolution operated with support from the Pritzker Foundation. We thank Amani Nature Reserve, Tanzania Commission for Science and Technology (COSTECH), University of Dar es Salaam, Field Museum and Roosevelt University for support.

Copyright information

© Springer Science+Business Media Dordrecht 2012