Erratum to: J Mol Neurosci
The original version of this article unfortunately contained a mistake. First, the correct primer pair listed in the Methods and Sample Collection section is: (5’caaaatcaaaggatacattcagga 3’forward) and (5’ agctccttttccaaataaaagttatc 3’reverse). Secondly, Figure 1, the image associated with subject I-1 from family a, is an MRI image and not a CT image.
Author information
Authors and Affiliations
Corresponding author
Additional information
The online version of the original article can be found at http://dx.doi.org/10.1007/s12031-010-9445-7.
Rights and permissions
About this article
Cite this article
Lemos, R.R., Oliveira, D.F., Zatz, M. et al. Erratum to: Population and Computational Analysis of the MGEA6 P521A Variation as a Risk Factor for Familial Idiopathic Basal Ganglia Calcification (Fahr’s Disease). J Mol Neurosci 43, 549 (2011). https://doi.org/10.1007/s12031-011-9495-5
Published:
Issue Date:
DOI: https://doi.org/10.1007/s12031-011-9495-5