Biological Trace Element Research

, 131:229

Selenoprotein W Modulates Control of Cell Cycle Entry

Authors

    • USDA Agricultural Research Service, Western Human Nutrition Research CenterUniversity of California at Davis
  • Thomas T. Y. Wang
    • USDA Agricultural Research ServiceBeltsville Human Nutrition Research Center
  • Zeynep Alkan
    • USDA Agricultural Research Service, Western Human Nutrition Research CenterUniversity of California at Davis
  • B. Diane Richter
    • USDA Agricultural Research Service, Western Human Nutrition Research CenterUniversity of California at Davis
  • Kevin Dawson
    • NCMHD Center for Excellence in Nutritional GenomicsUniversity of California at Davis
Article

DOI: 10.1007/s12011-009-8367-0

Cite this article as:
Hawkes, W.C., Wang, T.T.Y., Alkan, Z. et al. Biol Trace Elem Res (2009) 131: 229. doi:10.1007/s12011-009-8367-0

Abstract

The present study was conducted to identify targets of selenium (Se) provided to cultured human cells in physiologically relevant doses and forms. Breast and prostate epithelial cells were supplemented with Se provided as 100 nM sodium selenite or high-Se serum and gene expression was profiled with DNA microarrays. Pure sodium selenite affected expression of 560 genes in MCF-10A breast cells, including 60 associated with the cell cycle (p = 2.8 × 10−16). Selenoprotein W (SEPW1) was the only selenoprotein messenger RNA (mRNA) increased by both sodium selenite (specific) and high-Se serum (physiologic). SEPW1 small interfering RNA inhibited G1-phase progression and increased G1-phase gene transcripts, while decreasing S-phase and G2/M-phase gene transcripts, indicating the cell cycle was interrupted at the G1/S transition. SEPW1 mRNA levels were maximal during G1-phase, dropped after the G1/S transition and increased again after G2/M-phase. SEPW1-underexpressing prostate cells had increased mRNA for BCL2, which can induce a G1 arrest, and decreased mRNA for RBBP8 and KPNA2, which modulate the Rb/p53 checkpoint pathway. These results suggest that SEPW1 and the G1/S transition are physiological targets of Se in breast and prostate epithelial cells.

Keywords

SeleniumCancerG1/S transitionCell cycle entryNutritionChemoprevention

Abbreviations

Se

selenium

SEPW1

selenoprotein W

GPX

glutathione peroxidase

FBS

fetal bovine serum

SAM

significance analysis of microarrays

GO

gene ontology

RT-PCR

reverse transcriptase-polymerase chain reaction

PBS

phosphate-buffered saline

RBBP8

retinoblastoma binding protein 8

KPNA2

karyopherin alpha 2 (RAG cohort 1, importin alpha 1)

BCL2

B cell CLL/lymphoma 2

TPR

translocated promoter region [to activated MET oncogene]

MET

met proto-oncogene [hepatocyte growth factor receptor]

Introduction

Se intake was observed to be inversely associated with breast cancer mortality rates four decades ago [1, 2]. Subsequently, a large body of evidence has accumulated suggesting dietary Se may prevent cancer (see Combs [3] and Gromadzinska et al. [4] for recent reviews). Se supplementation has been shown to prevent tumors in many animal models of cancer (reviewed in Ip et al. [5]) and inhibition of cell division has been proposed as one of the mechanisms [6]. The main biological function of Se is in selenocysteine, an essential component of the 25 known human selenoproteins [7]. However, increasing Se intake beyond the dietary requirement does not increase the expression of circulating selenoproteins in blood [8, 9]. This has led to the prevalent hypothesis that nonprotein Se compounds mediate the cancer-protective effects of dietary Se rather than selenoproteins [10].

When provided in physiologically achievable nanomolar concentrations, Se is nontoxic to mammalian cells and is used primarily for synthesis of selenoproteins. Recently, evidence has begun to accumulate that selenoproteins may in fact play an important role in Se chemoprevention. Transgenic mice with reduced levels of selenoproteins are more prone to develop precancerous prostate lesions [11] and precancerous colon polyps [12]. Moreover, genetic variations in the glutathione peroxidase (GPX) 1 gene and in the GPX4 gene are independently associated with breast cancer risk [1318]. Thus, selenoproteins appear to be viable candidates to mediate the cancer-protective properties of Se.

We measured genome-wide gene expression profiles in breast and prostate epithelial cells exposed to physiologic concentrations of Se. We found that physiological forms and concentrations of Se specifically targeted cell cycle genes while increasing expression of only one selenoprotein—SEPW1. This suggests that SEPW1 is a target of Se in epithelial cells and mediates at least some of Se's effects on the cell cycle. SEPW1 facilitated G1-phase progression and was subsequently downregulated in early S-phase, consistent with a role in the G1/S transition. This is the first report of an endogenous selenoprotein modulating control of cell cycle entry.

Materials and Methods

Cell Culture

Cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA). For microarray studies, MCF-10A mammary epithelial cells were grown in Dulbecco’s modified Eagle’s medium/F12 medium containing 50 μg/ml cholera toxin, 10 μg/ml epidermal growth factor, 20 nM hydrocortisone, 2 nM insulin, 2 mM l-glutamine, 100 U/ml penicillin, and 100 μg/ml streptomycin, in the presence of 5% CO2 in air at 37 °C. Cells were cultured with 10% fetal bovine serum (FBS; HyClone, Logan, UT, USA) containing different levels of Se: low-Se FBS from New Zealand (11 nM Se final concentration in medium); high-Se FBS from the US (26 nM Se final concentration in medium); or low-Se FBS plus 100 nM added sodium selenite (111 nM Se final concentration in medium). The medium was changed every 24 h. After 72 h, RNA was extracted. The entire experiment was repeated three times on separate occasions, establishing freshly seeded cultures of cells each time. For small interfering RNA (siRNA) transfection experiments, MCF-10A cells were grown with serum-free MEGM® (Lonza Bioscience, Basel, Switzerland; 26 nM Se).

pRNS1-1 prostate epithelial cells were maintained in Roswell Park Memorial Institute 1640 medium supplemented with 2 mM l-glutamine, 1.5 g/l sodium bicarbonate, 4.5 g/l glucose, 10 mM HEPES, 1 mM sodium pyruvate, and 10% low-Se FBS from New Zealand (11 nM Se). To obtain high-Se medium, 100 nM sodium selenite was added to basal medium. RWPE-1 and RWPE-2 prostate epithelial cells were grown in keratinocyte serum-free medium with supplements and antibiotics provided by the manufacturer (Invitrogen, Carlsbad, CA, USA).

Selenium Analysis

Se was measured by high-performance liquid chromatography of the fluorescent derivative formed from reaction with diaminonaphthalene after digestion in a 5:2 (v/v) nitric–perchloric acid mixture [19]. Calibration standards were prepared with the National Institute of Standards and Technology (NIST) standard reference material (SRM) 3149-Selenium Standard Solution and the performance of each analytical run was validated by analysis of NIST SRM 1577a-Bovine Liver (certified value 0.71 ± 0.07 μg/g; mean ± SD 0.705 ± 0.075 μg/g) and duplicate samples of frozen pooled human plasma (within-run relative standard deviation (RSD): 4.0%, between-run RSD: 8.1%). Samples were analyzed in duplicate. If duplicate samples differed by more than 10%, a second set of duplicates was analyzed and the average of all four measurements was used.

SEPW1-Underexpressing Cell Lines

HuSH29 short-hairpin RNA (shRNA) vectors targeting SEPW1 and nontargeting negative control constructs (Origene, Rockville, MD, USA) were amplified in and purified from Escherichia coli using QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA, USA). RWPE-2 cells were reverse-transfected with 1 μg construct per well using 0.2% siPORT NeoFX (Ambion, Austin, TX, USA) reagent in six-well plates. The cells were maintained under 1 μg/ml puromycin selection starting 72 h after the transfection. Lines established from surviving cells were assessed for the degree of SEPW1 knockdown with reverse transcriptase-polymerase chain reaction (RT-PCR). Three underexpressing lines transfected with constructs TI372740 and TI372743 (70%, 80%, and 90% reductions in SEPW1 messenger RNA (mRNA)) were used in experiments with two negative control lines: one transfected with a vector containing a nontargeting shRNA construct and another line transfected with an empty vector.

siRNA Transfections

MCF10A cells were reverse-transfected using 0.2% siPORT Amine reagent (Ambion/ABI) with 30-nM Silencer SEPW1 siRNA #42029, which reduced SEPW1 transcript levels by 60% compared to 30 nM nontargeting control siRNA #AM4635 (Ambion/ABI). For microarray analysis, RWPE-1 cells were reverse-transfected with 0.2% siPORT Amine reagent (Ambion/ABI) and 30 nM of one of three Silencer SEPW1 siRNAs (#42029, 41942, 41846), which reduced SEPW1 transcript levels by 91%, 87%, and 77%, respectively, compared to 30 nM nontargeting control siRNA #AM4635 (Ambion/ABI). For cell cycle experiments, RWPE-1 cells were reverse-transfected by one of two methods: initial experiments were performed with 0.2% siPORT NeoFX reagent and 30 nM of SEPW1 siRNA (Ambion/ABI #42029), which reduced SEPW1 transcript levels by 70–80% compared to 30 nM nontargeting control siRNA #AM4635 (Ambion/ABI). Subsequent experiments used 0.2% Lipofectamine RNAiMax reagent (Invitrogen) with 5 nM Silencer Select Validated siRNA targeting SEPW1 (#s361), which reduced SEPW1 transcript levels by 95–98% compared to 5 nM negative control siRNA #4390843 (Ambion/ABI). Medium containing the transfection complexes was replaced with fresh medium 24 h after transfection and RNA was isolated 48 h after transfection with RNeasy Plus Mini Kits (Qiagen, Hilden, Germany). RT-PCR was performed as described below.

Quantitative Real-Time RT-PCR

RNA quality and quantity were assessed by UV spectroscopy using a NanoDrop spectrometer (NanoDrop Technologies, Wilmington, DE, USA). Reverse transcription was performed on 1 μg of total RNA, using Omniscript Reverse Transcription Kit (Qiagen) and anchored oligo dT primers (Operon, Huntsville, AL, USA). Three microliters of complementary DNA (cDNA) were used for real-time PCR analysis in a LightCycler instrument (Roche Applied Science, Indianapolis, IN, USA) using the Fast Start DNA Master SYBR Green I kit (Roche) and intron-spanning primers of our own design: selenoprotein W-forward: GAGGCTACAAGTCCAAGTATCTTCA, reverse: CATCAGGGAAAGACCAGGTG; topoisomerase II alpha-forward: CGGAGAGCAGCAACAAAAAC, reverse: CATCAGCTTCAAGGTCTGACAC; translocated promoter region (MET oncogene)-forward: GATCCTCCTTCTAGCTCATCTGTAG, reverse: ATTGCATGGCTCACACCTCT; GPX1-forward: ACCCTCTCTTCGCCTTCCT, reverse: TCGATGTCAATGGTCTGGAA. Purified PCR products were sequenced at the UC Davis Molecular Structure Facility to validate each assay. Every reaction was subjected to a postrun melting curve analysis to verify the presence of a single product. The crossing points were calculated with the second derivative maximum method. Samples were run in duplicate and concentrations calculated from a standard curve made from total human RNA (Clontech, Mountain View, CA) reverse-transcribed in the same manner and were quantitated as “nanogram RNA equivalents” using the LightCycler 3.3 software.

RT-PCR Array Analysis

RNA was isolated using RNeasy Plus Mini Kits (Qiagen) and 1 μg total RNA was reverse-transcribed with RT2 First Strand Kit (SABiosciences, Frederick, MD, USA). cDNA was mixed with RT2 Profiler PCR Array SYBR Green/ROX master mix (SABiosciences) and 25 μl aliquots of the reaction mixture were dispensed into 96-well microplates preloaded with PCR primers targeting 86 cell cycle genes (RT2 Profiler™ PCR Cell Cycle Arrays, SABiosciences). Thermal cycling was performed on an ABI 7900 Sequence Analyzer (ABI, Foster City, CA, USA), following the manufacturer's recommended protocol. Changes in the concentrations of the target mRNAs were expressed as ΔΔCt values calculated using PCR Array Data Analysis Software (SABiosciences).

Cell Cycle Synchronization

Cells were plated evenly at 20–30% confluence on the day prior to cell cycle arrest. For nocodazole/l-mimosine synchronization, cells were incubated for 4 h with 0.5 μg/m nocodazole, washed three times with warm phosphate-buffered saline (PBS), and then incubated in medium containing 0.8 mM l-mimosine for 18 h. Cells were released from S-phase block by washing three times with PBS and adding fresh medium. For nocodazole synchronization, cells were incubated in 0.5 μg/ml nocodazole containing medium for 14–16 h followed by release from M-phase block by washing with PBS and adding fresh medium. Cells were harvested for RNA purification and cell cycle analysis at timed intervals after release.

Cell Cycle Analysis

Flow cytometry cell cycle analysis was performed by a modification of published methods [20]. Briefly, cells suspended in PBS were fixed with ethanol at −20 °C, washed with FBS, and then with PBS. DNA was stained with propidium iodide and analyzed with a FACSCalibur flow cytometer (BD Biosciences, San Jose, CA, USA). Data analysis was conducted with ModFit LT 3.0 software (Verity Software, Topsham, ME, USA).

DNA Microarray Analysis of RNA

MCF-10A and pRNS1-1 cells were lysed directly in 175-cm2 flasks with 5 ml TRIzol (Invitrogen, Carlsbad, CA, USA). The TRIzol extract was further purified using Qiagen columns from RNeasy Midi Kits (Qiagen, Valencia, CA, USA). RWPE-1 cells were lysed in 100 mm plates by suspension in RLT buffer and purified with the RNeasy Plus Mini Kit (Qiagen). Five micrograms of total RNA from each sample were used for the preparation of biotin-labeled target complementary RNA (cRNA), using the standard Affymetrix protocol [21] and the Enzo BioArray High-Yield RNA Transcript Labeling kit (Enzo Diagnostics, Farmingdale, NY, USA). Twenty micrograms of the cRNA product was fragmented and then hybridized for 16 h to Affymetrix Human Genome U133 Plus 2.0 arrays, which were processed with the Affymetrix Fluidics Station 450 and then scanned with an Affymetrix GeneChip Scanner 3000.

DNA Microarray Data Analysis

Expression values were calculated with Affymetrix GCOS software using MAS 5.0 algorithms [22]. Differentially expressed probe sets were identified using Wilcoxon signed rank tests of the PM–MM differences between probe sets on pairs of chips. Probe sets identified as significantly different (p < 0.002) in MCF-10A cells grown in basal medium (11 nM Se) with or without addition of 100 nM sodium selenite in three independent experiments were taken as the set of sodium selenite-responsive genes. Probe sets identified as significantly different (p < 0.002) in MCF-10A cells grown in low-Se FBS (11 nM Se) versus high-Se FBS (26 nM Se) in three independent experiments were taken as the set of high-Se serum-responsive genes. The probability of a probe set being included in either of these latter two sets purely by chance was approximately 10−8.

To generate expression profiles of selenium-responsive genes for qualitative GO analyses, the p values of the Wilcoxon signed rank tests for each probe set from the three experiments in MCF-10A with and without 100 nm sodium selenite were multiplied together and those probe sets with a combined p < 1.85 × 10−5 (approximately one false discovery expected per 54,675 probe sets) were used for GO analysis with the DAVID software system [23].

RNA from RWPE-1 cells treated separately with each of the three siRNAs targeting SEPW1 (#42029, 41942, 41846) was hybridized to HG-U133 Plus 2.0 arrays and compared to RNA from cells treated with the control nontargeting siRNA #AM4635 (Ambion) using GCOS as described above. The set of genes whose expression was significantly (p < 0.002) affected by all three SEPW1-targeted siRNAs was used for GO analysis.

Results

Effect of Sodium Selenite on Gene Expression

We first examined mRNAs in MCF-10A cells affected by addition of 100 nM sodium selenite to the basal medium containing low-Se FBS (11 nM Se). Only four probe sets hybridized with mRNAs that were significantly different at p < 0.002 in three independent experiments (Table 1). RNA hybridization to the two probe sets specific for selenoprotein W (SEPW1) was more than doubled. The other two probe sets were complementary to sequences for nuclear genes: mRNA for translocated promoter region (TPR), a component of the nuclear pore complex [24, 25] and part of the MET oncogene fusion protein [26], was decreased 15% by selenite; and mRNA for topoisomerase II alpha, a major target of chemotherapeutic drugs [27], was decreased 20% by sodium selenite. The changes in SEPW1 and TPR mRNA measured by microarray were validated with real-time RT-PCR (R = 0.83 and 0.69, respectively, n = 18), but the RT-PCR analysis of TOP2A mRNA did not agree well with the microarray analysis (R = 0.36, n = 18). When the microarray expression values were calculated using the Robust Multi-chip Average algorithm [28] and analyzed with significance analysis of microarrays [29], RNA hybridizing to the two probe sets for SEPW1 was the only significant change due to sodium selenite treatment.
Table 1

Probe Sets Differentially Expressed with 100 nM Selenite in MCF-10A Cells

Probe set ID

Symbol

Gene name

Biological process

Change

1555851_s_at 201194_at

SEPW1

Selenoprotein W, 1

Cell redox homeostasis

+133%

201291_s_at

TOP2A

Topoisomerase (DNA) II alpha 170 kDa

DNA topological change/replication/repair

−20%

215220_s_at

TPR

Translocated promoter region (to activated MET oncogene)

Nuclear import/export

−15%

Probe sets identified as significantly different (p < 0.002) upon addition of 100 nM sodium selenite to basal medium containing 11 nM Se in three independent experiments. The probability of a probe set being included in this set purely by chance was approximately 10−8

A larger set of selenium-responsive genes in MCF-10A cells was constructed based on the combined p values from three experiments as described in “Materials and Methods.” Probe sets representing 561 curated genes were used for GO analysis (See Supplemental Table S1 for a complete listing of all affected probe sets). Table 2 shows the biological processes overrepresented in this group of genes. There was a highly improbable concentration of genes associated with cell division, with 15 of the top-ranked 20 biological processes involved directly in the cell division cycle.
Table 2

GO Analysis of 561 Genes Differentially Expressed with 100 nM Sodium Selenite in MCF-10A Cells

Biological process

Number

Percent

p value (unadjusted)

M-phase of mitotic cell cycle

41

7.3

5.2 × 10−22

Mitosis

40

7.1

3.2 × 10−21

Mitotic cell cycle

45

8.0

5.7 × 10−20

M-phase

41

7.3

2.3 × 10−18

Cell cycle phase

45

8.0

4.6 × 10−18

Cell division

36

6.4

1.5 × 10−16

Cell cycle

70

12.5

2.8 × 10−16

Chromosome segregation

18

3.2

2.8 × 10−13

Organelle organization and biogenesis

71

12.7

8.7 × 10−11

Regulation of mitosis

14

2.5

2.6 × 10−8

Cellular component organization and biogenesis

113

20.1

1.8 × 10−7

Cytoskeleton organization and biogenesis

36

6.4

3.7 × 10−7

Mitotic sister chromatid segregation

9

1.6

9.2 × 10−7

Sister chromatid segregation

9

1.6

1.2 × 10−6

Regulation of progression through cell cycle

34

6.1

2.9 × 10−6

Regulation of cell cycle

34

6.1

3.3 × 10−6

Chromosome organization and biogenesis

28

5.0

4.8 × 10−6

Mitotic cell cycle checkpoint

8

1.4

1.8 × 10−6

Microtubule-based process

19

3.4

1.8 × 10−5

Cell cycle checkpoint

10

1.8

3.0 × 10−5

Only processes with a p value less than 0.0001 are shown. The p values of the Wilcoxon signed rank tests for each probe set from three independent experiments wherein 100 nM sodium selenite was added to basal medium containing 11 nM were multiplied together and those probe sets with a combined p < 1.85 × 10−5 were used for GO analysis with the DAVID software system (23)

Effect of High-Se Serum on Gene Expression

Next, we examined the genes in MCF-10A cells whose expression was different in medium containing low-Se New Zealand FBS (11 nM Se) compared to medium containing high-Se US FBS (26 nM Se). RNA species representing nine genes were significantly different at p < 0.002 in three independent experiments (Table 3). SEPW1 was the only gene whose expression was affected by both high-Se FBS (Table 3) and sodium selenite (Table 1). We also performed a single microarray experiment to examine the effect of sodium selenite and high-Se FBS on gene expression in pRNS1-1 prostate epithelial cells. SEPW1 was the only selenoprotein mRNA in pRNS1-1 cells affected by both high-Se FBS (p < 0.002) and sodium selenite (p < 0.002; data not shown).
Table 3

Probe Sets Differentially Expressed with High-Se Serum in MCF-10A Cells

Probe set ID

Symbol

Gene name

Biological process

Change

1555851_s_at 201194_at

SEPW1

Selenoprotein W, 1

Cell redox homeostasis

+52%

225283_at

ARRDC4

Arrestin domain containing 4

Intracellular signaling

−31%

201127_s_at

ACLY

ATP citrate lyase

Citrate metabolism, lipid biosynthesis

+26%

234675_x_at

FLJ23566

CDNA, clone LNG10880

 

+48%

210950_s_at

FDFT1

Farnesyl-diphosphate farnesyltransferase 1

Cholesterol biosynthesis, lipid biosynthesis

+26%

201626_at

INSIG1

Insulin-induced gene 1

Metabolism, cell proliferation

+62%

213287_s_at

KRT10

Keratin 10

Epidermis development

−24%

200832_s_at

SCD

Stearoyl-CoA desaturase (delta-9-desaturase)

Fatty acid biosynthesis, lipid biosynthesis

+23%

201009_s_at

TXNIP

Thioredoxin interacting protein

Keratinocyte differentiation

−21%

Probe sets identified as significantly different (p < 0.002) between low-Se FBS from New Zealand (11 nm Se) and high-Se FBS from the US (26 nM Se) in three independent experiments. The probability of a probe set being included in this set purely by chance was approximately 10−8

Effect of SEPW1 siRNA on Cell Cycle

Because sodium selenite specifically affected expression of cell-cycle-related genes and SEPW1 was the only selenoprotein increased by sodium selenite, we hypothesized that SEPW1 was involved in cell cycle regulation. As predicted by the microarray experiments, treatment of MCF-10A cells with SEPW1 siRNA (Ambion/ABI #42029) inhibited cell cycle progression—decreasing the fraction of cells in G2/M-phase and S-phase and increasing the number of cells in G0/G1-phase by a corresponding amount (Table 4). Similarly, treatment of RWPE-1 cells with SEPW1 siRNA (Ambion/ABI #42029) decreased the fraction of cells in G2/M-phase and S-phase and increased the number of cells in G0/G1-phase, although to a smaller extent than in MCF-10A cells (Table 5, experiment #1). Cell cycle progression was also inhibited in RWPE-1 prostate cells by treatment with a chemically modified siRNA targeting a different part of the SEPW1 mRNA sequence (Ambion/ABI Silencer Select validated siRNA #s361; Table 5, experiment #2).
Table 4

Effect of SEPW1 Silencing on Cell Cycle Progression in MCF-10A Cells

Treatment

SEPW1 mRNA, ng (±SEM)

Fraction of cells in each phase, % (±SEM)

G0/G1

S-phase

G2/M

No transfection

65.2 ± 5.6a

75.4 ± 6.0a

15.4 ± 1.8a

9.2 ± 4.3a

Control siRNA (Ambion/ABI #4635)

67.9 ± 4.6a

85.1 ± 7.2b

9.1 ± 3.9b

5.8 ± 3.3b

SEPW1 siRNA (Ambion/ABI #42029)

29.1 ± 2.3b

92.0 ± 4.4c

5.7 ± 2.8b

2.3 ± 1.6c

Forty-eight hours after transient transfection with 0.2% siPORT Amine reagent (Ambion/ABI), cells were fixed and stained with propidium iodide, and their DNA contents were determined by flow cytometry. Data were analyzed with ModFit LT 3.0. The experiment was repeated three times and the data shown are the means ± SEM. Means within a column not sharing a common letter are significantly different (p < 0.05, two-way ANOVA with Tukey’s multiple-comparison test)

Table 5

Effect of SEPW1 Silencing on Cell Cycle Progression in RWPE-1 Cells

Treatment

SEPW1 mRNA, ng (±SEM)

Fraction of cells in each phase, % (±SEM)

G0/G1

S-phase

G2/M

Experiment #1

No transfection

123 ± 9.2a

52.2 ± 7.1a

26.2 ± 0.8a

21.6 ± 7.9a

Control siRNA (30 nM Ambion/ABI #AM46325)a

143 ± 9.1b

49.8 ± 4.5a

25.5 ± 1.6a

24.7 ± 6.1a

SEPW1 siRNA (30 nM Ambion/ABI #42029)a

37.5 ± 4.0c

54.6 ± 3.0b

24.3 ± 2.0a

21.1 ± 4.9b

Experiment #2

No transfection

179 ± 15a

56.4 ± 1.0a

24.8 ± 2.6a

18.8 ± 0.6a

Control siRNA (5 nM Ambion/ABI #4390843)b

157 ± 3.9a

51.8 ± 1.9a

30.5 ± 5.1a

17.6 ± 1.0a

SEPW1 siRNA (5 nM Ambion/ABI #s361)b

1.7 ± 0.2b

63.2 ± 1.2b

24.5 ± 3.4a

12.2 ± 1.1b

Forty-eight hours after transient transfection, cells were fixed and stained with propidium iodide, and their DNA contents were determined by flow cytometry. Data were analyzed with ModFit LT 3.0. The experiments were repeated five times and the data shown are the means ± SEM. Means within a column and experiment not sharing a common letter are significantly different (p < 0.05, two-way ANOVA with Tukey’s multiple-comparison test)

asiPORT NeoFX reagent (see “Materials and Methods”)

bLipofectamine RNAiMax reagent (see “Materials and Methods”)

Microarray analysis of RWPE-1 cells treated with SEPW1 siRNA revealed gene expression changes that correlated with the shifts in cell cycle distribution. There were 835 probe sets whose expression was significantly (p < 0.002) affected by all three silencer siRNAs targeting SEPW1 (Ambion/ABI #42029, #41942 and #41846; 91%, 87%, and 77% knockdown, respectively), representing 694 curated genes. GO analysis revealed that “cell cycle” was the most highly represented biological process (59 genes, 8.5%, p = 4.9 × 10−7; see Supplemental Table S2 for a complete listing of all 694 genes.) When the changes in expression of these 59 genes were mapped onto a diagram of the cell cycle pathway, the pattern revealed a discontinuity at the G1/S transition: mRNAs expressed in G1-phase were enriched in cells treated with SEPW1 siRNAs, while S-phase and G2/M-phase mRNAs were underrepresented (Fig. 1).
https://static-content.springer.com/image/art%3A10.1007%2Fs12011-009-8367-0/MediaObjects/12011_2009_8367_Fig1_HTML.gif
Fig. 1

Changes in cell cycle gene expression in prostate epithelial cells treated with SEPW1 siRNA. Transcripts with decreased abundance in SEPW1 siRNA-treated RWPE-1 cells are shown in green boxes, while red boxes indicate transcripts present in increased amounts in treated cells. The mRNAs shown are those changed by all three siRNAs, each targeting a different part of the SEPW1 sequence. Letters at the bottom indicate the phases of the cell cycle. Adapted from KEGG™ [67]

SEPW1-Underexpressing Cell Lines

Stable transfection of RWPE-2 cells with two different shRNA constructs targeting SEPW1 resulted in three stable cell lines with decreased SEPW1 mRNA levels (see “Materials and Methods”). Expression levels for 86 cell cycle genes were compared between the three SEPW1-underexpressing RWPE-2 cell lines and the two RWPE-2 control lines using an RT-PCR array. Three genes were consistently differentially expressed (p < 0.05) in all three SEPW1-underexpressing cell lines compared to control cell lines (data not shown). Messenger RNA for BCL2, an antiapoptotic protein that induces G1 arrest, was increased twofold in SEPW1-underexpressing cells. Levels of mRNAs for two early S-phase genes, RBBP8 and KPNA2, were depressed by half in the SEPW1-underexpressing cells, consistent with inhibition of the G1/S transition. There was relatively little change in cell cycle distribution in the stably transfected cell lines compared to transiently transfected cells (data not shown). Analysis of the forward scattered light in the flow cytometry analysis indicated that the cells in the G0/G1-phase peak were approximately 8% larger than the control cells with normal levels of SEPW1 mRNA, consistent with delayed G1-phase progression in stably transfected SEPW1-underexpressing cells (data not shown).

Effect of Cell Cycle on SEPW1 Expression

RWPE-1 prostate epithelial cells synchronized by arrest with nocodazole (M-phase arrest) or by sequential treatment with nocodazole and l-mimosine (S-phase arrest) were used to study the dependence of SEPW1 expression on cell cycle phase. SEPW1 mRNA was highest when cells were in G1-phase, decreased rapidly in early S-phase, and returned to maximal levels after cells completed mitosis (Fig. 2). SEPW1 mRNA levels in MCF-10A cells followed a similar time course, with maximum expression during G1-phase and a rapid decrease in early S-phase (data not shown). Because only a fraction of cells reentered the cell cycle synchronously after release, the decrease in the average SEPW1 mRNA content of the mixed population of cells underestimated the changes in the cells that were actually cycling. After correcting for this artifact[30], SEPW1 mRNA levels during G2/M-phase were estimated to be reduced 43% in RWPE-1 and 55% in MCF-10A compared to G1-phase.
https://static-content.springer.com/image/art%3A10.1007%2Fs12011-009-8367-0/MediaObjects/12011_2009_8367_Fig2_HTML.gif
Fig. 2

SEPW1 mRNA in synchronized prostate epithelial cells. RWPE-1 cells were synchronized by treatment with nocodazole alone (M-phase arrest, t0 = approximately 12 h) or sequential treatment with nocodazole and l-mimosine (S-phase arrest, t0 = 0 h) and then released by washing and replacing with fresh medium. Cells were harvested for RNA extraction and cell cycle analysis (DNA content by flow cytometry) at the indicated times after release. Horizontal bar at top represents the phases of the cell cycle in synchronously cycling cells as estimated from flow cytometry

Discussion

Our results indicate that SEPW1 is a highly specific target of supplemental Se provided to breast and prostate epithelial cells in physiologic forms and concentrations. Because sodium selenite is a pure selenium compound, its effects are specifically attributable to Se. Although sodium selenite is not a significant form of Se in foods, it is used efficiently for selenoprotein synthesis [31] and satisfies the nutritional requirement for Se in all tested species [3234].

The concentration of sodium selenite was kept as low as practical to minimize any possible artifacts. Typical cell culture medium contains 20–25 nM Se, mostly from serum and protein supplements. Sodium selenite is nontoxic and beneficial for growth of several human cell lines at concentrations up to 100 nM [3537] but can be toxic above 1,000 nM [38, 39]. The highest Se concentration in the present study was 111 nM, well below the toxic threshold, and equivalent to about 6% of the average serum Se concentration in the US (124 ng/ml) [40]. The vast majority of Se in plasma is incorporated into proteins [31, 41], and the highest concentration of nonprotein Se in blood of rats administered toxic doses of selenium was 120 nM [42], so 111 nM is near the upper limit of physiologically achievable Se concentration. Even though all 25 known human selenoproteins were represented on the HG U133 microarrays, SEPW1 was the only selenoprotein gene in MCF-10A and pRNS1-1 cells whose expression was consistently increased by physiological forms and concentrations of Se.

Because cells are not normally exposed to sodium selenite in vivo, we employed a second microarray screen to identify genes affected by Se provided as high-Se serum. High-Se FBS provides Se in the same forms as cells receive in the whole organism. However, FBS from New Zealand could be different from US FBS in other ways besides Se content, which might introduce off-target effects. Therefore, we considered only those genes whose expression was affected similarly by both Se treatments: a response to sodium selenite ensured the effect was specific for Se and a response to high-Se FBS showed the effect was not an artifact due to use of sodium selenite. SEPW1 was the only gene whose expression was increased by sodium selenite and high-Se FBS in three independent experiments with MCF-10A cells, indicating SEPW1 is a specific target of physiologic concentrations and forms of Se in breast epithelial cells. Moreover, SEPW1 was the only selenoprotein mRNA increased by both sodium selenite and high-Se FBS in pRNS1-1 cells, indicating SEPW1 is also a specific and physiologic target of Se in prostate epithelial cells.

We were not able to measure endogenous levels of SEPW1 protein in MCF-10A or RWPE-1 cells and were thus unable to demonstrate directly that siRNA knockdown decreased intracellular levels of SEPW1 protein. Western blots with two commercially available SEPW1 antibodies and rabbit antibodies we raised against a 17-amino acid fragment of SEPW1 or full-length recombinant SEPW1 failed to detect endogenous SEPW1 protein. However, the antibody raised against the recombinant SEPW1 easily detected the recombinant protein on the same gels, suggesting that SEPW1 protein levels in these cells were below the limit of detection, although other explanations are possible. The fact that two siRNAs based on different chemistries and targeting different sequences in the SEPW1 mRNA caused the same phenotype of delayed G1-phase progression in two different epithelial cell lines makes it unlikely this phenotype was due to off-target effects of the siRNAs. It is also significant that three unmodified siRNAs targeting different sequences in SEPW1 mRNA all caused changes in cell cycle gene expression consistent with inhibition of the G1/S transition. Furthermore, stable transfection of RWPE-2 cells with two shRNA constructs targeting different sequences in SEPW1 mRNA also caused changes in cell cycle gene expression consistent with inhibition of the G1/S transition. It is difficult to conceive of a single explanation for these effects other than decreased synthesis of SEPW1 protein. Moreover, SEPW1 protein levels are known to be regulated by and proportional to SEPW1 mRNA levels [43]. Therefore, changes in SEPW1 mRNA levels may be taken as a surrogate indicator of changes in SEPW1 protein expression.

Because SEPW1 and the cell cycle were highly specific targets of physiologic concentrations of Se and knockdown of SEPW1 inhibited G1-phase progression, it is reasonable to conclude that SEPW1 mediates at least some of Se’s effects on the cell cycle in breast and prostate epithelial cells. When the genes affected by SEPW1 siRNA were mapped onto the cell cycle pathway, there was an overrepresentation of G1-phase genes and an underrepresentation of S-phase and G2/M-phase genes, indicating that the cell cycle was interrupted at the G1/S transition (Fig. 1). Se was reported to be required for cell cycle progression in human leukemia cells [44], but the role of selenoproteins was not addressed in that study. Silencing of SEPW1 with siRNA induced only a partial G1 arrest, decreasing the number of mitotic cells by 60% in MCF-10A cells (Table 4) and by 15–30% in RWPE-1 cells (Table 5). There are many independent pathways that provide inputs to the G1/S transition (e.g., cellular energy status, DNA damage, extracellular matrix interactions, receptor-mediated growth factors, nuclear hormone receptors, etc.) each of which may have only a partial effect on cell cycle entry under a given set of conditions. This is due, at least in part, to the fact that there are redundant mechanisms of mitotic control in the human somatic cell cycle [45]. Thus, we can conclude only that SEPW1 modulates control of cell cycle entry under the particular cell growth conditions used in these experiments. The questions of how general this phenomenon is and how central SEPW1 function is to cell cycle regulation will require further work to answer.

It is perhaps not surprising that a selenoprotein would be a target of supplemental Se provided in physiologic forms and concentrations. Nevertheless, ours is the first study to implicate a selenoprotein as a target of supplemental Se in mammalian cells. SEPW1 is a 9.5-kDa selenocysteine-containing protein of unknown function, first described 36 years ago [46]. SEPW1 is expressed ubiquitously in mammals and in at least 22 human tissues [47]. Homologs of SEPW1 are the most widely distributed selenoproteins [48] and homozygous SEPW1-knockout mouse embryos die at the preimplantation blastocyst stage [49]. The ubiquitous expression, essentiality, and wide taxonomic distribution of SEPW1 are consistent with a role in a fundamental cellular process such as the cell cycle.

Cell cycle genes have been identified as targets of Se based on gene expression changes in breast [50] and prostate cancer cells [38, 51], but in the opposite sense—with Se inhibiting, rather than being required for, cell cycle progression. This difference is undoubtedly due to the toxic concentrations of Se used in these prior studies, which were 25- to 2,000-fold greater than in the present study. Above 1-µM cytotoxicity, growth inhibition and induction of apoptosis are Se’s primary effects on cultured cells [52]. In contrast to cell cycle arrest caused by increasing Se to toxic levels, we observed an opposite effect: cell cycle arrest caused by decreasing SEPW1 expression. Se is well known to have different effects at nutritional levels versus toxic doses. Sodium selenite affects completely different pathways when administered to cultured cells at subtoxic concentrations versus toxic concentrations [53]. Such duality of effects at different doses is characteristic of Se and has earned it the title of “the Janus element.”

The effect of SEPW1 on cell cycle progression might conceivably be related to its antioxidant activity. However, overexpression of antioxidant enzymes delays G1-phase progression. For example, ectopic expression of GPX4 in MCF-7 cells increased G1 transit time and slowed the growth rate [54], while overexpression of superoxide dismutase [55] or catalase [56] caused decreased growth in mammalian cells. In contrast, it was the underexpression of SEPW1 that inhibited cell cycle progression in the present study, not overexpression. Thus, the mechanism of G1 arrest induced by overexpression of antioxidant enzymes is distinct from the delayed G1/S transition induced by underexpression of SEPW1.

14-3-3 proteins, which have recently been identified as binding partners of SEPW1 [57], provide a plausible molecular link between SEPW1 and cell cycle regulation. 14-3-3 proteins are a family of highly conserved eukaryotic proteins, with diverse cellular functions in signal transduction, stress response, apoptosis, transcriptional regulation, coordination of cell adhesion and motility, and cell cycle regulation [58]. 14-3-3 proteins function primarily by binding other proteins based on their phosphorylation status and thereby sequestering them in the cytoplasm and excluding them from the nucleus. In this fashion, 14-3-3 proteins are responsible for regulating entry of the dual specificity phosphatases Cdc25A, Cdc25B, and Cdc25C into the nucleus to initiate specific phases of the cell cycle. The binding of Cdc25C to 14-3-3 depends on an intramolecular disulfide bond in Cdc25C. When this disulfide bond is reduced to the dithiol form, Cdc25C is released from 14-3-3 to enter the nucleus and initiate mitosis [59]. Since Cdc25A contains Cys at the same positions as in Cdc25C, it is tempting to speculate that SEPW1 might similarly reduce Cdc25A, releasing it to enter the nucleus and initiate entry into the cell cycle.

To prevent inappropriate reentry into the cell cycle, cell cycle regulatory proteins are often downregulated immediately after completion of the phase for which they are required—thus ensuring proper sequential progression through the cell cycle. The expression of SEPW1 fits the pattern expected for a cell cycle regulatory protein. SEPW1 expression regulated cell cycle progression and, reciprocally, SEPW1 expression was regulated by the cell cycle. SEPW1 was expressed at a high level during G1-phase when it facilitated cell cycle progression, was downregulated after the G1/S transition, and remained low until after completion of mitosis. The changes in gene expression due to SEPW1 siRNA treatment of RWPE-1 cells imply that SEPW1 may function during the G1/S transition in or near the Rb/p53 DNA damage checkpoint pathway (Fig. 1). Stable transfection of RWPE-2 cells with SEPW1 shRNA also led to changes in expression of genes controlling the G1/S transition. The increase in BCL2 expression and the depression of RBBP8 and KPNA2 expression in stably transfected SEPW1-underexpressing RWPE-2 cells independently implicate involvement of the Rb/p53 pathway in the mechanism by which SEPW1 modulates control of cell cycle entry.

Sustained delays in cell cycle progression, such as might be induced by low SEPW1 expression due to insufficient Se intake, can predispose cells to develop genetic instability and malignancies [60]. It is interesting to note that supplemental Se inhibits induction of tetraploidy [61], an important source of chromosome breaks and genetic instability in cancer [62]. Dietary Se is known to protect against chromosome breaks and other chromosomal aberrations in animals [6365] and Se supplements decrease chromosome breaks in BRCA1 carriers [66].

Acknowledgements

US Department of Agriculture CRIS project no. 5306-51530-009-00D and no. 1235-52530-003-00 and NCMHD grant no. 1 P60 MD00222 supported this research. The UC Davis Cancer Center Gene Expression Resource supported by NCI Cancer Center Support Grant P30 CA93373 performed the microarray labeling, hybridizations, and scanning. Mention of trade name, proprietary product, or specific equipment does not constitute a guarantee or warranty by the US Department of Agriculture nor does it imply approval to the exclusion of other products that may be suitable. The opinions expressed herein represent those of the authors and do not necessarily represent those of the US Department of Agriculture.

Conflict of interest

The authors have no financial or other conflicting interest in any product or service mentioned in this article.

Supplementary material

12011_2009_8367_MOESM1_ESM.xls (125 kb)
Supplemental Table S1. Affymetrix DNA microarray probe sets affected by 100 nM selenite in MCF-10A cells. (XLS 125 kb)
12011_2009_8367_MOESM2_ESM.xls (154 kb)
Supplemental Table S2. Affymetrix DNA microarray probe sets affected by all three species of SEPW1 siRNA in RWPE-1 cells. (XLS 154 kb)

Copyright information

© US Government 2009