Molecular Biology Reports

, Volume 41, Issue 9, pp 6247–6252

Fenugreek extract diosgenin and pure diosgenin inhibit the hTERT gene expression in A549 lung cancer cell line

Authors

    • Drug Applied Research CenterTabriz University of Medical Sciences
    • Department of Clinical Biochemistry, Faculty of MedicineTabriz University of Medical Sciences
  • Somayyeh Ghareghomi
    • Department of Biology, Faculty of SciencesGolestan University
  • Gholamreza Haddadchi
    • Department of Biology, Faculty of SciencesGolestan University
  • Morteza Milani
    • Tabriz University of Medical Sciences
  • Mohammad Aghazadeh
    • Department of Medical Microbiology, Faculty of MedicineTabriz University of Medical Sciences
  • Hasan Daroushnejad
    • Tabriz University of Medical Sciences
Article

DOI: 10.1007/s11033-014-3505-y

Cite this article as:
Rahmati-Yamchi, M., Ghareghomi, S., Haddadchi, G. et al. Mol Biol Rep (2014) 41: 6247. doi:10.1007/s11033-014-3505-y

Abstract

Trigonella foenum-graecum generally known as fenugreek, has been normally cultivated in Asia and Africa for the edible and medicinal values of its seeds. Fenugreek leaves and seeds have been used widely for therapeutic purposes. Fenugreek seed is recognized to show anti-diabetic and anti-nociceptive properties and other things such as hypocholesterolaemic, and anti-cancer. Diosgenin is a steroidal saponin from therapeutic herbs, fenugreek (T. foenum-graceum L.), has been well-known to have anticancer properties. Telomerase activity is not identified in usual healthy cells, while in carcinogenic cell telomerase expression is reactivated. Therefore telomerase illustrates a promising cancer therapeutic target. We deliberate the inhibitory effect of pure diosgenin and fenugreek extract diosgenin on human telomerase reverse transcriptase gene (hTERT) expression which is critical for telomerase activity. MTT-assay and qRT-PCR analysis were achieved to discover cytotoxicity effects and hTERT gene expression inhibition properties, separately. MTT results exhibited that IC50 for pure diosgenin were 47, 44 and 43 µM and for fenugreek extract diosgenin were 49, 48 and 47 µM for 24, 48 and 72 h after treatment. Culturing cells with pure diosgenin and fenugreek extract diosgenin treatment caused in down regulation of hTERT expression. These results indication that pure and impure diosgenin prevents telomerase activity by down regulation of the hTERT gene expression in A549 lung cancer cell line, with the difference that pure compound is more effective than another.

Keywords

Lung cancerFenugreekDiosgeninpTLCTelomeraseqRT-PCRMTT-assay

Introduction

Telomerase is a eukaryotic ribonucleoprotein (RNP) whose specialized reverse transcriptase action performs de novo synthesis of one strand of telomeric DNA [1]. It consists of two major components: human telomerase RNA (hTR), which consists of a 451-base integral RNA providing the template for the synthesis of the human telomeric repeat (TTAGGG)n, and human telomerase reverse transcriptase (hTERT) which is a 127 kDa protein providing catalytic function to replicate the ends of linear DNA [2]. Lung cancer is the most widespread type of cancer and is also one of the major causes of death in the world [3]. Lung cancer between many types of cancer such as breast cancer, ovarian cancer, colon cancer and stomach cancer is the leading cause of cancer deaths in the world. The two major forms of lung cancer are non-small-cell lung cancer (NSCLC) (about 85 % of all lung cancers) and small-cell lung cancer (about 15 %). Despite advances in early finding and standard treatment, NSCLC is frequently diagnosed at an advanced stage and has a poor prognosis. This type of lung cancer can be divided into three major histologic subtypes: squamous-cell carcinoma, adenocarcinoma, and large-cell [4]. There are many molecular targets for prevention or treatment of non-small cell lung cancer. Of these molecular targets, telomerase is the best because it is active in almost 85 % of cancers including NSCLC. Therefore, it is an appropriate molecular target. Fenugreek (Trigonella foenum-graecum Linn) is a legume, originally from southeastern Europe and western Asia, but grown now mainly in India and also in certain parts of Asia, northern Africa, Europe and the United States [5]. Fenugreek belongs to the subfamily Papilionacae of the family Leguminosae (bean family, Fabaceae). Fenugreek seeds are customarily used for the treatment of many diseases. Studies indicated that the fenugreek seeds have antioxidant properties. Many medicinal properties are attributed to fenugreek seeds and leaves [6]. Fenugreek is known to have numerous pharmacological features. Chemical composition and antioxidant activity of husk (seed coat) and endosperm of fenugreek seeds have revealed that endosperm has the highest content of saponin (4.63 %) and protein (43.80 %) [7]. One of the saponins in fenugreek is diosgenin that indicates anti-carcinogenic possessions, such as inhibiting proliferation and persuading apoptosis in a variety of tumor cells. Diosgenin is a main bioactive constituent of fenugreek (T. foenum-graecum Linn) that is structurally similar to cholesterol and other steroids [8]. Basically, diosgenin [(25R)-spirost-5-en-3b-ol] is a spirostanol saponin containing of a hydrophilic sugar moiety connected to a hydrophobic steroid aglycone (Fig. 1) [9]. The aim of the present study is to determine the cytotoxicity of pure diosgenin obtained from sigma co. and fenugreek extract diosgenin (impure diosgenin) on the lung cancer cell line and to define their effect on the hTERT gene expression regulation in the lung cancer cell line.
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-014-3505-y/MediaObjects/11033_2014_3505_Fig1_HTML.gif
Fig. 1

Structure of diosgenin

Materials and methods

Plant material and extracts preparation

The seeds of T. foenum-graecum Linn (fenugreek) has been obtained from a local market in north of Iran and recognized by Dr. Hadadchi. The extract of seeds of fenugreek was prepared using soxhlet apparatus with ethanol for 36 h at 70 °C.The extract of fenugreek seeds was analyzed using thin-layer chromatography (TLC),and detected the band that included steroidal saponins such as diosgenin by used pure diosgenin (the purity >99.9 %) was purchased from sigma company (Fig. 2).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-014-3505-y/MediaObjects/11033_2014_3505_Fig2_HTML.gif
Fig. 2

a An example of thin-layer chromatography (TLC) performed by fenugreek extract, b an example of thin-layer chromatography (TLC) performed by pure diosgenin. Asterisks diosgenin in presence reagent (Alcoholic sulfuric acid, 90:10)

PTLC

We used preparative TLC (PTLC) (Merck co, Germany) and isolated the section of extracts that included diosgenin. The TLC was performed on TLC precoated silica gel G60 F254 plate 20 × 20 cm (Merck, Germany) using a homogenous solvent system comprising n-hexan:aceton at 20:80 ratio as the mobile phase. We got one spline of fenugreek extract on TLC plate to separate various constituents. The developed plates were air dried then for identification the section of steroidal saponins such as diosgenin, we used alcoholic sulfuric acid solution with 90:10 ratio as a reagent. After heating, appearance of yellowish brown color confirmed the diosgenin presence. After Performance TLC, for separate large amounts of extract, we used PTLC. For this, small amount of fenugreek extract was loaded on TLC plates and the mentioned diosgenin separation method was performed. After identification of the saponins part on plate, this section shaved from TLC plate and was poured into a beaker. Then amount of ethanol as a solvent were added and the solutions was clear to separate the silica. At the next stage, the final solution was placed in a water bath to evaporate the ethanol. Finally, the remaining portion was stored for later use. Pure diosgenin was used as standard saponin.

Cell line and culture

The lung cancer cell line (A549) was purchased from cell bank of Pasteur Institute of Iran (code: C137). The A549 cells were incubated in RPMI-1640 medium supplemented with 10 % heat-inactivated fetal bovine serum (FBS) (Gibco, Invitrogen, Uk), penicillin G (Serva co, Germany) and streptomycin (Merck co, Germany) at 37 °C in 5 % CO2.

MTT-assay

MTT assay is one of the present techniques which are commonly used for cell proliferation measurement. This assay is created on the reduction of yellow MTT (catalogue number M2128, sigma co, Germany) to purple formazan by live cells. At the end of the incubation times (24, 48 and 72 h) with various concentrations of the pure diosgenin and impure diosgenin (0, 10, 20, 30, 40, 50 and 60 µM, three wells per concentration (the supernatants of the cells (A549) were removed. 200 µl of fresh RPMI medium and 50 µl MTT solution (2 mg/ml) were added to each well of the plates, and the cells were incubated for an additional 4 h in dark and at 37 °C. Next, the solutions were detached, and the dye was solubilized in 200 µl dimethyl sulfoxide, and the absorbance was measured in an ELISA reader (Micro plate reader STAT FAX 2100) at 570 nm wave length, with 630 nm wave lengths as a reference value. The cell viability ratio was calculated by the consequent formula: Inhibitory ratio (%) = (OD control − OD treated)/OD control × 100 %. Cytotoxicity was expressed as the concentration of pure diosgenin and impure diosgenin inhibiting cell growth by 50 % (IC50 value).

Cell treatment

After determination of IC50, 1 × 106 cells were treated with 5 µM of pure diosgenin and impure diosgenin solution. The 2 µl ethanol without diosgenin solution was added to a flask of control cells. Then, culture flasks were incubated at 37 °C containing 5 % CO2 for 24, 48 and 72 h.

RNA extraction

Total RNA was extracted using TRIZOL reagent according to the manufacturer’s manual (Cinnagene, Iran).At the end the concentration and quantity of total RNA was calculated based on OD260/280 ratio measurements and its quality was assessed by electrophoresis on 1.5 % agarose gel. An OD260/280 of 1.7–2.1 was suitable (Table 1) . RNA integrity can be measured using gel electrophoresis on a formaldehyde agarose gel in the presence of a fluorescent dye such as ethidium bromide. We observed two sharp bands for 18 and 28 subunit ribosomal RNAs (rRNA) on this gel.
Table 1

Analysis of RNA purity and integrity

Sample

A260/280

Concentration (ng/µl)

Control

1.94

1,503

Pure Dg* (24 h)

1.98

1,091

Pure Dg (48 h)

1.94

1,938.5

Pure Dg (72 h)

1.94

414

Impure Dg (24 h)

1.93

2,121

Impure Dg (48 h)

1.94

2,342

Impure Dg (72 h)

2

1,283.1

This figure shows an example of RNA purity and integrity analysis using spectrophotometry and electrophoresis system. The OD260/280 ratio measured for all samples on the Nanodrop spectrophotometer is between 1.7 and 2.1 indicating that the samples are empty of protein infection. Generally accepted ratios (A260/280) for good quality RNA are 1.7–2.1

* Dg Diosgenin

A Absorbance or optical density (OD)

cDNA synthesis

Complementary DNA (cDNA) was synthesised using reverse transcriptase (RT) in the kit First Strand cDNA Synthesis Kit (Fermentase, K1622). RNA was renewed to cDNA after treatment with DNase I. Reverse transcription of RNA was achieved in a final volume of 20 μl enclosing cDNA first strand synthesis buffer (Fermentas, USA) random hexamer primers and 2 μg of total RNA. Conferring to manufacturer protocol, the samples were consecutively incubated at 65 °C for 10 min and 42 °C for 60 min. Reverse transcriptase was disabled by heating at 70 °C for 5 min and kept cool.

Real-Time PCR (qRT-PCR)

The created cDNA was diluted 1:5, 1:10 and 1:20. The concentration of 1:20 of cDNA was used as a pattern for real-time PCR. The cDNA was augmented using definite primers for telomerase gene (Genbank accession: NM_198255) and also beta-actin (Genbank accession: NM_001101) as endogenous regulator. According to manufacture, the total volume of PCR reaction was 20 µl that contained: 5 pmol of the forward and reverse PCR primers of hTERT (Forward: 5′CCGCCTGAGCTGTACTTTGT3′ and Reverse: 5′CAGGTGAGCCACGAACTGT3′) or for beta-actin (Forward: 5′ACCGTGAAAAGATGACCCAG3′ and Reverse: 5′CCATACCCAAGAAGGAAGGC3′), 2X PCR Master Mix Syber Green I, and 1 µg of the cDNA was used. The hTERT and beta-actin gene were amplified by real-time PCR as triplicate. Beta actin and hTERT for each sample at the same run was done, 20 µl of PCR reaction mixture contained 10 µl of SYBER Ex Taq II (2×) PCR master mix, 2 µl template cDNA, 6.4 µl dH2O water per reaction. Negative controls were ready each time with 2 µl ddH2O instead of the cDNA template. Real time PCR amplification was achieved using a Corbett (Rortor Gene 6000) system with the following setting as manufacture protocol. The quality of real-time PCR reactions was measured by running standard samples as triplicated. The package for real-time PCR reaction was as follows; Primary denaturation at 95 °C for 10 min, followed by cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s and extension at 72 °C for 30 s. Finally, specificity of amplicons was measured by melting curve analysis from 70 to 95 °C.

Data analysis

Changes in hTERT gene expression levels between the control and treated A549 cells were deliberate by the 2−ΔΔct mode. The methods for the calculation were as follows:
$$\Updelta {\text{CT }} = {\text{ CT}}_{{({\text{target}})}} {-}{\text{ CT}}_{{({\text{reference}})}}$$
$$\Updelta \Updelta {\text{CT }} = {\text{ CT}}_{{({\text{test\;\,sample}})}} {-}{\text{ CT}}_{{({\text{control\;\,sample}})}}$$
The fold for goal, relative to a calibrator sample, is calculated by: 2−ΔΔct.

Result

Results of MTT for different concentrations of pure diosgenin and impure diosgenin obtained by PTLC, at different times for the treatment of A549 cell line exhibited that IC50 for pure diosgenin were 47, 44 and 43 µM (Fig. 3) and for impure diosgenin were 49, 48 and 47 µM after 24, 48, and 72 h of treatment, respectively (Fig. 4). RNA extracts quantity and quality by nanodrop and agarose gel electrophoresis. The MTT results showed that diosgenin effect on A549 cells has time-dependent manner, and its best effect was in 72 h after treatment. Analysis of real-time PCR for calculation of hTERT gene expression inhibition with 2−ΔΔCt values displayed that pure diosgenin and impure diosgenin inhibited hTERT gene expression and decrease hTERT mRNA level in contrast with control group. Fold of decreasing were 0.352, 0.200, 0.092 for pure diosgenin and 0.806, 0.289, 0.216 for impure diosgenin after 24, 48 and 72 h, respectively (Fig. 5).
https://static-content.springer.com/image/art%3A10.1007%2Fs11033-014-3505-y/MediaObjects/11033_2014_3505_Fig3_HTML.gif
Fig. 3

Result of MTT-assay for A549 cell line treated with pure diosgenin at different times (24, 48, 72 h), for 24 h (IC50 = 47 µM), for 48 h (IC50 = 44 µM) and for 72 h (IC50 = 43 µM). It was done as triplicate manner

https://static-content.springer.com/image/art%3A10.1007%2Fs11033-014-3505-y/MediaObjects/11033_2014_3505_Fig4_HTML.gif
Fig. 4

Result of MTT-assay for A549 cell line with impure diosgenin at different times (24, 48, 72 h), for 24 h (IC50 = 49 µM), for 48 h (IC50 = 48 µM) and for 72 h (IC50 = 47 µM). It was done as triplicate manner

https://static-content.springer.com/image/art%3A10.1007%2Fs11033-014-3505-y/MediaObjects/11033_2014_3505_Fig5_HTML.gif
Fig. 5

Level of hTERT mRNA expression (2−ΔΔct) at different times (24, 48 and 72 h) for pure and impure diosgenin

Discussion

Since lung cancer is one of the most common cancers worldwide and Telomerase is active in more than 85 % of cancers including lung cancer but not normal cells, targeting the telomerase in this cancer could be promising step in its treatment. Different agents have been suggested for telomerase inhibition. These, however have undesirable effects and it is necessary to study alternative telomerase-inhibiting agents, preferably natural compounds. Fenugreek seeds are traditionally used for the treatment of many diseases. Studies show that the seeds have antioxidant properties. Fenugreek seeds and leaves have many medicinal properties [6]. Pharmacological features of fenugreek is known such as hypoglycaemic, hypercholesterolaemic, gastroprotective, chemopreventive, antioxidant [6, 1013]. The plant is known to have alkaloids, flavonoids and nicotinic acid and salicylate. Chemical composition and antioxidant activity of husk (seed coat) and endosperm of fenugreek seeds have revealed that endosperm has the highest content of saponin (4.63 %) and protein (43.80 %) [7]. These seeds and leaves have been used extensively in various medicinal preparations. One such active agent is the diosgenin, which prevents azoxymethane-induced aberrant crypt foci formation in F344 rats and induce apoptosis in HT-29 human colon cancer cells [14]. Diosgenin prevents osteoclastogenesis, attack and proliferation through the down-regulation of Akt, I kappa B kinase stimulation and NF kappa B controlled gene expression in tumor cells [15]. Induction of antiproliferative effect by diosgenin through activation of p53, releasing of apoptosis-inducing factor (AIF) and modulation of caspase-3activity in different human cancer cells were studied in 2004 [16]. Study effect of diosgenin on human hepatocellular carcinoma cells has showed that diosgenin can induce the expression of Src homology 2 phosphatase 2 (SH-PTP2) that correlated with down-regulation of constitutive STAT3 activation. Diosgenin also down-regulated the expression of several STAT3-regulated gene products, reversed proliferation and potentiated the apoptotic effects of paclitaxel and doxorubicin [17]. Diosgenin, a steroidal saponin, inhibits movement and invasion of human prostate cancer PC-3 cells by reducing matrix metalloproteinases expression [18]. Diosgenin specially inhibited proliferation and induced apoptosis in HER2-overexpressing cancer cells. Also, diosgenin repressed the phosphorylation of Akt and mTOR, and improved phosphorylation of JNK. Diosgenin inhibits pAkt expression and Akt kinase activity without affecting PI3 kinase levels, causing in the inhibition of its downstream aims, NF-κB, Bcl-2, survivin and XIAP. The Raf/MEK/ERK path, another useful downstream aim of Akt, was inhibited by diosgenin estrogen receptor positive (ER+) but not in estrogen receptor negative (ER) BCa cells [19]. Also, another study by Shishodia and Aggarwal (2006) showed that diosgenin could inhibits cmyc gene expression that cmyc acts as an upregulator for hTERT gene expression. Also according to the previous study, diosenin could inhibits hTERT gene expression in lung cancer cell line (A549), Therefore it can be used as an anti-cancer agent [20]. So, centered on these studies were displayed this fact that diosgenin have anticancer activity and apply this property by several mechanisms probably with downregulation of cmyc gene expression. Since the association between cancer and high expression of hTERT gene, our results are mainly interested in demonstrating that diosgenin downregulates hTERT gene expression in A549 cell line. In this study, we deliberate the comparative effects of pure diosgenin and impure diosgenin obtained from fenugreek on hTERT gene expression. Result of Real-time PCR designated that this constituents cause decreased hTERT gene expression and inhibits growth of A549 cell line, but pure diosgenin is more effective than impure diosgenin obtained from fenugreek.Therefore, diosgenin could be a good anticancer applicant for cancer therapy in the future like other herbal extracts including genistein, curcumin, and retinoic acid [2123].

Conclusion

According to the results, pure and impure diosgenin by antioxidant activity affect the growth of A549 lung cancer cell line and these cytotoxic effects were time-dependent style, and these constituents could prevent hTERT gene expression as time-dependent manner. The results exhibited that pure and impure diosgenin could be an applicant topic for lung cancer therapy because natural products like genistein, curcumin, and retinoic acid are demonstrated as chemopreventive agents. On the other hand, as was revealed from the results, pure diosgenin rather than impure diosgenin was more effective. Impurities in the pTLC extract of fenugreek may interfere with the beneficial effects and reduce the effectiveness of the desired compound. The purpose of this study was not only evaluation of the effect of diosgenin on the expression of hTERT gene, but also, the comparison between pure and impure diosgenin effects is performed. Therefore according to results obtained, using pure compounds showed stronger effects and can be more effective.

Acknowledgments

This study was supported by a grant from Drug Applied Research Center, Tabriz University of Medical Sciences, Tabriz, Iran and the authors would like to thanks them for technical supports.

Conflict of interest

The authors inform you that there is no conflict of interest.

Copyright information

© Springer Science+Business Media Dordrecht 2014