European Journal of Plant Pathology

, Volume 136, Issue 3, pp 433–441

A sensitive real-time PCR assay for the detection of the two Melampsora medusae formae speciales on infected poplar leaves

Authors

    • ANSES, Laboratoire de la Santé des VégétauxUnité de Mycologie
  • Cécile Guinet
    • ANSES, Laboratoire de la Santé des VégétauxUnité de Mycologie
  • Agathe Vialle
    • Natural Resources Canada, Canadian Forest ServiceLaurentian Forestry Centre
  • Richard Hamelin
    • Natural Resources Canada, Canadian Forest ServiceLaurentian Forestry Centre
  • Pascal Frey
    • INRAUMR1136 INRA Université de Lorraine “Interactions Arbres/Micro-organismes”
  • Renaud Ioos
    • ANSES, Laboratoire de la Santé des VégétauxUnité de Mycologie
Article

DOI: 10.1007/s10658-013-0180-0

Cite this article as:
Boutigny, A., Guinet, C., Vialle, A. et al. Eur J Plant Pathol (2013) 136: 433. doi:10.1007/s10658-013-0180-0
  • 243 Views

Abstract

Melampsora medusae is a quarantine fungus in the European Union (EU) that causes a damaging leaf rust disease on poplars. Two formae speciales of the pathogen can be distinguished, M. medusae f. sp. deltoidae and M. medusae f. sp. tremuloidae, but the EU plant health directive 2000/29/EC currently in force does not make the distinction between them. EU countries must have the ability to detect and identify rapidly the introduction of these quarantine fungi and to conduct extensive surveys in case of outbreaks. Efficient detection tools are thus needed. In this study, a sensitive real-time PCR assay was developed to detect the presence of M. medusae in poplar leaf samples. A unique primer/hydrolysis probe combination targeting both formae speciales was designed using species-specific polymorphisms observed within the internal transcribed spacer region. An additional primer/hydrolysis probe combination was designed from a region of the 28S rDNA that is highly conserved in the genus Melampsora and used in a separate real-time PCR assay in order to check the quality of the DNA extracted from Melampsora urediniospores. The test developed demonstrated a high sensitivity since it enables the reproducible detection of two M. medusae urediniospore in a mixture of 2 mg of urediniospores (ca 800 000 urediniospores) of other Melampsora species. This new real-time PCR tool should be useful for laboratories in charge of official analyses since it has many advantages over the techniques currently used to monitor this quarantine pathogen in Europe.

Keywords

MelampsoraPoplar rustReal-time PCRQuarantine pathogen

Melampsora medusae Thümen is one of the causal agents of poplar leaf rust, which is considered among the most damaging disease of poplars worldwide. This disease causes defoliation, growth reduction and in severe cases mortality, leading to important economic losses in commercial poplar cultivation. M. medusae is classified as a quarantine pest in Europe (Anonymous 2000) and its presence is thus strictly controlled. Two formae speciales have been described within M. medusae (Mm), M. medusae f. sp. deltoidae Shain (Mmd) and M. medusae f. sp. tremuloidae Shain (Mmt) on the basis of their telial host range: Mmd is pathogenic on Populus species of the sections Aigeiros and Tacamahaca, including cultivated poplars such as P. deltoides (Bartr.) Marsh. and P. x euramericana (Dode) Guinier and P. x interamericana Brockh., whereas Mmt infects Populus species of the section Populus, including wild poplars such as P. tremuloides Michx. A recent multilocus phylogenetic study showed that these two formae speciales should be considered as distinct species (Vialle et al. 2013), but the European phytosanitary regulations in force does not make the distinction between both formae speciales and the two taxa are still so far equally considered as quarantine fungi.

The first symptoms of infection by Melampsora species are small yellow pustules (uredinia, containing urediniospores), which appear within 2–3 weeks on the underside of the leaves, or on both sides in case of heavy infections. Different species of Melampsora can infect the same poplar leaf (Pinon and Frey 1997). Melampsora species have complex life cycles that generally require two unrelated host plants, in this case poplars (telial host) and conifers (aecial host), and exhibit five different spore stages. In order to comply with the current European phytosanitary regulations, EU members have to conduct surveys in order to detect any introduction of M. medusae and prevent its spread especially through the trade of infected poplar saplings produced by nurseries. During the surveys, the sampling procedure is restricted to the poplar trees, since the aecial stage of M. medusae was never reported on any conifer in the EPPO region (EPPO 2009). Infected leaves or uredinia (scraped from the leaves) are sent to the laboratory for analysis. To date, techniques available for the detection of M. medusae are based on either: (i) morphological identification (Pinon 1973; EPPO 2009; Vialle et al. 2011), or (ii) conventional PCR (Bourassa et al. 2005; Husson et al. 2013). On the one hand, morphological identification of M. medusae based on the microscopic observation of urediniospores and paraphyses is time consuming and, it may be difficult to visually identify a few urediniospores of M. medusae mixed in a large amount of urediniospores of other indigenous Melampsora species, resulting in a lack of sensitivity that may not be compatible with the nil tolerance considering quarantine organisms. On the other hand, the currently available methods based on conventional PCR (Bourassa et al. 2005; Husson et al. 2013) are sensitive and rapid but these techniques still lack specificity or are not fully inclusive (EPPO 2009). Real-time PCR using a hydrolysis probe has already been successfully used for the detection of numerous regulated plant pathogenic fungi, due to its enhanced specificity (Van Gent-Pelzer et al. 2007; Tan et al. 2010; Ioos et al. 2012). In the present study, a new real-time PCR assay was developed to detect both formae speciales of M. medusae, with improved specificity and sensitivity that overcome existing protocols.

Partial sequences of the internal transcribed spacer (ITS) rDNA region (23 sequences) and of the 28S rDNA gene (24 sequences) for all inventoried poplar Melampsora species (17 species considered as recognized taxa) with accurate identification were retrieved from GenBank or generated during a previous phylogenetic species recognition study (Vialle et al. 2013) and screened for regions showing interspecific polymorphisms. When relevant, sequences showing intraspecific polymorphisms were included in the study. For each marker, sequences were analyzed by multiple alignments using CLUSTALW (Thompson et al. 1994) available on the online PBiL platform (http://npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_clustalwan.html). The ITS showed regions with high levels of interspecific polymorphism and a series of forward and reverse primer and probe combinations specific to M. medusae (Mm-F/-R/-P), but conserved between both formae speciales, were designed using Primer 3 online software (http://frodo.wi.mit.edu/primer3/) (Rozen and Skaletsky 2000). Primers were designed and manually adjusted to amplify short PCR fragments (~ 150 bp) and meet the thermodynamic constraints for a primers/probe combination. Melting temperatures (Tm) and potential secondary structures were first evaluated in silico using Beacon DesignerTM software (Premier Biosoft). Following in vitro tests by SYBR-green real-time PCR, primers with the lowest tendency to form secondary structures and the best sensitivity were retained for the design of a M. medusae-specific probe. In parallel, regions of the 28S that are highly conserved in the genus Melampsora were selected and a set of forward and reverse primers and probe (Mel-F/-R/-P) was designed. The Mel-F/-R/-P combination, used in a separate real-time PCR assay, was used to check the quality of the DNA extracted from Melampsora urediniospores (e.g. inhibition effect, DNA losses during extraction). Primer and probe sequences and probe reporter/quencher dyes retained for the study are listed in Table 1. All primers and probes were custom synthesized by Eurogentec.
Table 1

List of primer pairs and dual labelled probes developed in this study

Target

Name

Sequence (5′–3′)

Tm (°C)a

Positionb

Product size (bp)

M. medusae

Mm-F

GCTTAAATGCGATTCTTTGTATACTAT

57,8

45–71

112

Mm-R

CTGCTAACCTAATTAAAGGCCA

59,4

137–156

Mm-P

FAM-ACCCCCACCAACCCAGAGGT-BHQ1

67,2

74–93

Melampsora genus

Mel-F

TGATACGGTTTCTAAGAGTCGAG

57,7

196–218

120

Mel-R

CATCTTTCCCTCACGGTACTTG

60,9

294–315

Mel-P

JOE-TTGGGAATGCAGCTCAAAGTGGG-BHQ1

69,4

223–245

aMelting temperature determined with Primer 3 software

bPosition of the primers and probe on the reference sequence with the accession number AY375275 in GenBank (M. medusae f. sp. deltoidae) and AB116776 (Melampsora genus)

For each sample, approximately 2 mg of uredinia were scrapped from rusted leaves using a sterile scalpel blade or a spatula and transferred into a 2-ml microtube. Total DNA was extracted using a commercial DNeasy® Plant Mini Kit (Qiagen). Four hundred μl of AP1 buffer (supplied with the kit), 4 μl RNase A (100 mg ml−1, supplied with the kit) and 1 mm glass beads (~8 mg) were added to the harvested urediniospores and the microtubes were shaken for 2 min at a frequency of 6.5 units using the FastPrep®-24 system (MP Biomedicals). The microtubes were then incubated for 20 min at 65 °C and the samples were processed according to the protocol supplied with the DNeasy® Plant Mini Kit. The DNA concentration was quantified using the Nanodrop 2000 Spectrophotometer (Thermo Scientific).

Real-time PCR reactions were performed on a Rotor-Gene 6500 (Corbett Research) set with an autogain optimization for each channel performed before the first fluorescence acquisition. No template controls (NTC) were systematically included in triplicate to check the absence of contamination in all reactions of real-time PCR. The Ct value for each reaction was determined using the Rotor-Gene software version 1.7.75, setting manually the threshold line at 0.02 for all the experiments. Due to inacceptable loss of sensitivity observed during preliminary experiments, Mm and Mel tests could not be combined in a duplex assay and were carried out in separate reactions. The Mm real-time PCR assay was carried out in a total volume of 20 μl using the qPCR core kit no ROX (Eurogentec) consisting of ultra pure water, 1× reaction buffer, 5 mM MgCl2, 4 × 0.2 mM dNTPs, 0.2 μM of the forward primer (Mm-F), 0.2 μM of the reverse primer (Mm-R), 0.05 μM of the probe (Mm-P), 0.5 U of Hot GoldStar Taq polymerase and 2 μl of template DNA (~ 1 ng). For the Mel real-time PCR assay, the mix contained 0.3 μM of the forward primer (Mel-F), 0.3 μM of the reverse primer (Mel-R), 0.1 μM of the probe (Mel-P) and all the other reagents at the same concentration than listed above for the Mm real-time PCR assay. Real-time PCR cycling conditions for both assays included an initial denaturation step at 95 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 15 s and annealing/elongation at 64 °C (for Mm) or 62 °C (for Mel) for 45 s.

The specificity of the Mm real-time PCR assay was verified on DNA extracts from a collection of 123 Melampsora samples collected on a wide range of host plants, from various geographic locations and collected at different years (Table 2). In total, 12 Melampsora species were represented. Melampsora samples mostly consisted in urediniospores, except a few consisting in dry specimens of infected leaf tissues, either from aecial or telial hosts, retrieved from herbaria. Melampsora samples were tested in triplicate. The 123 Melampsora samples showed acceptable Ct values for the Mel real-time PCR assay (mean Ct = 20.4, SD = 2.9) (Table 2), confirming that the DNA was amplifiable. Mean Ct values obtained with DNA from herbaria samples were similar to those yielded with DNA from urediniospores, suggesting that after normalization they contained similar quantities of Melampsora DNA. Herbaria samples could therefore be included in the specificity test. For the Mm real-time PCR assay, the DNA from all of the 41 M. medusae samples, including 39 Mmd and two Mmt samples, gave positive results (Table 2), regardless of the host, geographical origin and collection date, thus supporting the inclusivity of the assay. The Mm real-time PCR assay yielded negative results with DNA from all the other Melampsora species, except with the hybrid M. medusae-populina (3 isolates) and with M. occidentalis (3 isolates).
Table 2

Melampsora samples used in this study

Species

Isolate

Host plant

Origin

Year

Detection Mela

Detection Mmb

M. abietis-canadensis

QFB25031d

Tsuga canadensis

Canada, Québec

2001

20,1 (0,1)

_c

M. abietis-canadensis

QFB25032d

Tsuga canadensis

Canada, Québec

2001

21,1 (0,1)

_

M. aecidioides

PFH09-10d

Populus alba

France, La Tremblade

2009

20,4 (0,0)

_

M. aecidioides

PFH10-08d

Populus alba

France, Cayeux-sur-Mer

2010

19,4 (0,0)

_

M. aecidioides

PFH00-1d

Populus alba

England, Alice Holt

2000

19,3 (0,1)

_

M. allii-populina

98Z1

Arum sp.

France, Ramières

1998

24,6 (0,3)

_

M. allii-populina

98Z2

Allium sp.

France, Ramières

1998

19,6 (0,2)

_

M. allii-populina

98Z3

Allium sp.

France, Martinet

1998

25,3 (0,2)

_

M. allii-populina

98Z4

Allium sp.

France, Brésis

1998

18,9 (0,0)

_

M. allii-populina

98Z5

Allium sp.

France, St Michel du Dèze

1998

21,4 (0,1)

_

M. allii-populina

98Z6

Arum sp.

France, Dions

1998

23,5 (0,0)

_

M. allii-populina

98Z10

Allium porrum

France, Manosque

1998

23,8 (0,2)

_

M. allii-populina

96B6-1

Allium vineale

France, Champenoux

1996

27,1 (1,0)

_

M. allii-populina

97L5

Allium vineale

France, Champenoux

1997

19,2 (0,0)

_

M. allii-populina

97M1

Allium sphaerocephalum

France, Champenoux

1997

21,2 (0,0)

_

M. allii-populina

97M2

Allium sphaerocephalum

France, Champenoux

1997

19,1 (0,2)

_

M. allii-populina

97N1

Arum maculatum

France, Champenoux

1997

21,6 (0,1)

_

M. allii-populina

94IP1

Populus nigra

France, Brésis

1994

20,3 (0,0)

_

M. allii-populina

94HZ6

Populus nigra

France, Brésis

1994

16,3 (0,0)

_

M. allii-populina

94HY8

Populus nigra

France, Brésis

1994

17,8 (0,2)

_

M. allii-populina

94IZ7

Populus nigra

France, Taillades

1994

17,6 (0,2)

_

M. allii-populina

94JE3

Populus nigra

France, Taillades

1994

17,5 (0,5)

_

M. allii-populina

91D1

P. x interamericana ‘Beaupré’

France, Champenoux

1991

19,0 (0,2)

_

M. allii-populina

91E4

P. x euramericana ‘Robusta’

France, Guémené-Penfao

1991

21,0 (0,0)

_

M. allii-populina

91O4

P. x euramericana ‘Ghoy’

France, Guémené-Penfao

1991

18,6 (0,0)

_

M. allii-populina

91N1

P. x euramericana ‘Isières’

France, Guémené-Penfao

1991

19,6 (0,0)

_

M. allii-populina

91N5

P. x euramericana ‘Isières’

France, Guémené-Penfao

1991

18,6 (0,3)

_

M. allii-populina

90C2B

Allium cepa

France, Champenoux

1990

18,8 (0,1)

_

M. allii-populina

91L5

P. x interamericana ‘Beaupré’

France, Guémené-Penfao

1991

21,4 (0,1)

_

M. allii-populina

91C5

P. x euramericana ‘Robusta’

France, Champenoux

1991

19,0 (0,1)

_

M. larici-populina

93ID6

P. x euramericana ‘I 45-51’

France, Champenoux

1993

16,1 (0,1)

_

M. larici-populina

95XA1

P. x interamericana ‘Beaupré’

France, Menneville

1995

26,2 (0,3)

_

M. larici-populina

97A1

P. x euramericana

Morocco

1997

22,9 (0,2)

_

M. larici-populina

97A2

P. x euramericana ‘Veronese’

New Zealand, Aokanton

1997

21,3 (0,0)

_

M. larici-populina

97A3

Populus nigra

New Zealand, Wanganui

1997

22,7 (0,0)

_

M. larici-populina

97A4

Populus nigra

New Zealand, Turakina

1997

20,6 (0,1)

_

M. larici-populina

97J10

P. x euramericana ‘I-488’

South Africa, Natal

1997

21,8 (0,1)

_

M. larici-populina

97EA1

Populus sp.

China

1997

18,9 (0,1)

_

M. larici-populina

97EA3

Populus sp.

China

1997

20,8 (0,1)

_

M. larici-populina

97C3

P. x interamericana ‘Beaupré’

Northern Ireland, Loughball

1997

21,7 (0,1)

_

M. larici-populina

97E6

P. x interamericana ‘Boelare’

Northern Ireland, Loughball

1997

20,9 (0,1)

_

M. larici-populina

98AE3

Populus sp.

Finland

1998

22,3 (0,0)

_

M. larici-populina

99D1

Populus trichocarpa

Iceland

1999

22,0 (0,0)

_

M. larici-populina

00A1

P. x euramericana ‘Luisa Avanzo’

Chile, Talca

2000

26,6 (0,4)

_

M. larici-populina

00A5

P. x euramericana ‘Luisa Avanzo’

Chile, Talca

2000

20,1 (2,8)

_

M. larici-populina

00A8

P. x euramericana ‘Luisa Avanzo’

Chile, Talca

2000

22,1 (0,6)

_

M. larici-populina

00A13

P. x euramericana ‘I-488’

Chile, Talca

2000

18,7 (0,5)

_

M. larici-populina

00A19

P. x euramericana ‘I-488’

Chile, Talca

2000

23,5 (0,2)

_

M. larici-populina

00A20

P. x euramericana ‘I-488’

Chile, Talca

2000

22,3 (0,1)

_

M. larici-populina

00A22

P. x euramericana ‘I-488’

Chile, Talca

2000

23,4 (0,0)

_

M. larici-populina

00A29

P. x euramericana ‘I-214’

Chile, Talca

2000

20,9 (0,1)

_

M. larici-populina

94ZZ4

P. x interamericana ‘Beaupré’

Belgium, Grammont

1994

18,2 (1,9)

_

M. larici-populina

95XF6

P. x interamericana ‘Boelare’

France, Jonchery

1995

20,0 (0,2)

_

M. larici-populina

96AK1

Larix decidua

France, Champenoux

1996

21,4 (0,1)

_

M. larici-populina

97CG1

P. x interamericana ‘Hoogvorst’

France, Champenoux

1997

19,8 (1,9)

_

M. larici-populina

98AR1

P. x interamericana ‘B-71085/A1’

Belgium, Grammont

1998

20,9 (0,0)

_

M. larici-tremulae

01F1

Populus tremula

France, Champenoux

2001

18,5 (0,1)

_

M. larici-tremulae

PFH04-5d

Populus tremula

France, Champenoux

2004

20,3 (0,1)

_

M. larici-tremulae

PFH99-1d

Populus tremula

France, La Clusaz

1999

23,4 (0,0)

_

M. larici-tremulae

PFH10-16d

Populus tremula

France, Charrey-sur-Saône

2010

17,5 (0,0)

_

M. magnusiana

GLM81495d

Chelidonium majus

Germany, Sachsen

2008

15,5 (0,1)

_

M. magnusiana

GLM58747d

Corydalis cava

Germany, Sachsen

1997

17,9 (0,0)

_

M. magnusiana

GLM81405d

Chelidonium majus

Germany, Sachsen

2008

16,4 (0,1)

_

M. magnusiana

GLM77297d

Corydalis cava

Germany, Sachsen

2005

17,1 (0,1)

_

M. magnusiana

GLM59000d

Chelidonium majus

Germany, Sachsen

1983

22,0 (0,0)

_

M. medusae f. sp. deltoidae

88MM2

P. x interamericana ‘Beaupré’

France, Bordeaux

1988

21,0 (0,4)

20,7 (0,1)

M. medusae f. sp. deltoidae

97CN1

P. x interamericana ‘Boelare’

France, Hontanx

1997

22,8 (0,1)

21,9 (0,0)

M. medusae f. sp. deltoidae

97CN2

P. x interamericana ‘Boelare’

France, Hontanx

1997

22,6 (0,3)

21,6 (0,2)

M. medusae f. sp. deltoidae

97CN3

P. x interamericana ‘Beaupré’

France, Hontanx

1997

22,6 (0,3)

20,6 (2,4)

M. medusae f. sp. deltoidae

97CN4

P. x interamericana ‘Beaupré’

France, Hontanx

1997

22,5 (0,1)

21,8 (0,1)

M. medusae f. sp. deltoidae

97CN5

P. x interamericana ‘Beaupré’

France, Deymes

1997

19,0 (0,0)

18,2 (0,1)

M. medusae f. sp. deltoidae

98B1

P. x interamericana ‘87002-21’

South Africa, Natal

1998

20,3 (0,0)

19,4 (0,2)

M. medusae f. sp. deltoidae

98B3

P. x interamericana ‘87002-21’

South Africa, Natal

1998

18,0 (0,0)

16,5 (0,1)

M. medusae f. sp. deltoidae

98B4

P. x interamericana ‘87002-21’

South Africa, Natal

1998

20,2 (0,1)

19,3 (0,1)

M. medusae f. sp. deltoidae

98B5

P. x interamericana ‘87002-21’

South Africa, Natal

1998

18,0 (0,2)

17,3 (0,1)

M. medusae f. sp. deltoidae

98B7

P. x interamericana ‘87002-21’

South Africa, Natal

1998

17,5 (0,1)

17,1 (0,1)

M. medusae f. sp. deltoidae

98B8

P. x interamericana ‘87002-21’

South Africa, Natal

1998

18,4 (0,2)

17,4 (0,0)

M. medusae f. sp. deltoidae

98D1

P. x euramericana ‘5006’

South Africa, Natal

1998

17,1 (0,0)

15,6 (0,2)

M. medusae f. sp. deltoidae

98D6

P. x euramericana ‘5006’

South Africa, Natal

1998

18,9 (0,0)

17,3 (0,0)

M. medusae f. sp. deltoidae

98D7

P. x euramericana ‘5006’

South Africa, Natal

1998

19,8 (0,1)

18,9 (0,1)

M. medusae f. sp. deltoidae

98D9

P. x euramericana ‘5006’

South Africa, Natal

1998

18,4 (0,0)

17,1 (0,0)

M. medusae f. sp. deltoidae

98D10

P. x euramericana ‘5006’

South Africa, Natal

1998

19,8 (0,0)

18,6 (0,0)

M. medusae f. sp. deltoidae

99A3

P. x interamericana ‘Hoogvorst’

France, Nérac

1999

25,3 (0,1)

23,8 (0,1)

M. medusae f. sp. deltoidae

99A4

P. x interamericana ‘Hoogvorst’

France, Nérac

1999

21,1 (0,0)

18,8 (0,0)

M. medusae f. sp. deltoidae

99A5

P. x interamericana ‘Hoogvorst’

France, Nérac

1999

22,4 (0,1)

20,8 (0,1)

M. medusae f. sp. deltoidae

99A6

P. x interamericana ‘Hoogvorst’

France, Nérac

1999

21,2 (0,2)

19,9 (0,1)

M. medusae f. sp. deltoidae

99A7

P. x interamericana ‘Hoogvorst’

France, Nérac

1999

20,3 (0,2)

21,1 (0,2)

M. medusae f. sp. deltoidae

99A8

P. x interamericana ‘Hoogvorst’

France, Nérac

1999

19,6 (0,2)

26,3 (0,2)

M. medusae f. sp. deltoidae

99T2

P. x interamericana ‘Hazendans’

France, Champenoux

1999

28,2 (0,0)

18,4 (0,1)

M. medusae f. sp. deltoidae

99T7

P. x interamericana ‘Hazendans’

France, Champenoux

1999

27,3 (0,1)

24,7 (0,2)

M. medusae f. sp. deltoidae

99V3

P. x interamericana ‘Hoogvorst’

France, Champenoux

1999

23,0 (0,1)

21,5 (0,0)

M. medusae f. sp. deltoidae

99W1

P. x euramericana ‘Degrosso’

France, Champenoux

1999

19,4 (0,5)

17,7 (0,1)

M. medusae f. sp. deltoidae

99W2

P. x euramericana ‘Degrosso’

France, Champenoux

1999

25,0 (0,1)

22,9 (0,0)

M. medusae f. sp. deltoidae

99W3

P. x euramericana ‘Degrosso’

France, Champenoux

1999

24,4 (0,2)

22,5 (0,1)

M. medusae f. sp. deltoidae

01Z1

Populus deltoides

Canada, Québec, Repentigny

2001

20,6 (0,3)

18,8 (0,1)

M. medusae f. sp. deltoidae

01Z2

Populus deltoides

Canada, Québec, Repentigny

2001

19,6 (0,4)

18,0 (0,0)

M. medusae f. sp. deltoidae

01Z4

Populus deltoides

Canada, Québec, Repentigny

2001

18,4 (0,0)

19,4 (0,0)

M. medusae f. sp. deltoidae

01Z5

Populus deltoides

Canada, Québec, Repentigny

2001

19,8 (0,0)

18,2 (0,1)

M. medusae f. sp. deltoidae

01Z11

P. x interamericana ‘Unal’

Canada, Québec, Ste Françoise

2001

19,0 (0,1)

17,5 (0,1)

M. medusae f. sp. deltoidae

02AZ5

Populus deltoides

Canada, Québec, Ste Foy

2002

19,5 (0,1)

18,7 (0,1)

M. medusae f. sp. deltoidae

02AZ6

Populus deltoides

Canada, Québec, Ste Foy

2002

21,9 (0,1)

19,8 (0,1)

M. medusae f. sp. deltoidae

02AZ7

Populus deltoides

Canada, Québec, Ste Foy

2002

20,0 (0,1)

18,7 (0,0)

M. medusae f. sp. deltoidae

02AZ8

Populus deltoides

Canada, Québec, Ste Foy

2002

20,8 (0,1)

18,3 (0,1)

M. medusae f. sp. deltoidae

02AZ11

P. x jackii

Canada, Québec, Ste Foy

2002

16,5 (0,1)

15,0 (0,1)

M. medusae f. sp. tremuloidae

PFH03-17d

Populus tremuloides

Canada, Québec, Pointe Platon

2003

21,7 (0,1)

21,0 (0,1)

M. medusae f. sp. tremuloidae

PFH03-18d

Populus tremuloides

Canada, Québec, Cap Tourmente

2003

21,1 (0,1)

19,9 (0,0)

M. medusae-populina

98A1

P. x euramericana ‘I-488’

South Africa, Natal

1998

13,7 (0,1)

12,8 (0,1)

M. medusae-populina

98A3

P. x euramericana ‘I-488’

South Africa, Natal

1998

12,8 (0,0)

11,6 (0,0)

M. medusae-populina

98C8

P. x euramericana ‘5006’

South Africa, Natal

1998

14,5 (0,1)

13,4 (0,0)

M. occidentalis

MO96Hd

Populus trichocarpa

United States, Idaho

2002

21,8 (0,1)

22,7 (0,0)

M. occidentalis

MOWA1d

Populus trichocarpa

United States, Washington

1996

19,0 (0,0)

19,3 (0,1)

M. occidentalis

MOWA6d

Populus trichocarpa

United States, Washington

1996

19,0 (0,1)

19,5 (0,0)

M. pinitorqua

97MP08

Pinus sylvestris

France, Charmes

1997

17,1 (0,0)

_

M. pinitorqua

97MP09

Pinus sylvestris

France, Charmes

1997

16,1 (0,0)

_

M. pinitorqua

97MP10

Pinus sylvestris

France, Charmes

1997

17,3 (0,1)

_

M. pinitorqua

00MP10

Populus tremula

France, Pierroton

2000

19,1 (0,1)

_

M. pinitorqua

00MP42

Populus tremula

France, Brinon-sur-Sauldre

2000

16,4 (0,0)

_

M. pinitorqua

PFN218d

Pinus pinaster

France, Périgueux

1965

28,3 (0,1)

_

M. pinitorqua

PFN814d

Pinus pinaster

France, Lot

1977

20,3 (0,1)

_

M. pinitorqua

PFN816d

Populus tremula

France, Lot

1977

29,6 (0,1)

_

M. rostrupii

01G20d

Mercurialis perennis

France, Gorze

2001

17,5 (0,0)

_

M. rostrupii

01G21d

Mercurialis perennis

France, Gorze

2001

19,9 (0,1)

_

M. rostrupii

01G22d

Mercurialis perennis

France, Gorze

2001

18,0 (0,1)

_

aMean Ct values and standard deviation in brackets using the Mel real-time PCR test, DNA extracts were normalized at 0.5 ng μl−1 prior to test

bMean Ct values and standard deviation in brackets using the Mm real-time PCR test, DNA extracts were normalized at 0.5 ng μl-1 prior to test

cCt values > 40 cycles

dDry specimen of infected leaf tissues retrieved from herbaria

The sensitivity of the Mm real-time PCR assay was assessed with DNA extracts prepared from samples artificially spiked with Mmd urediniospores. Urediniospores of Mmd were handled individually under a stereomicroscope using a human eyelash fixed on a needle stick. Each sample finally contained 0, 1, 2, 5, 10, 20 or 50 urediniospores of Mmd mixed into 2 mg of urediniospores (ca 800 000 spores) of M. larici-populina (Mlp), which is the most commonly encountered rust species in France. Six replicates were prepared for each spore mixture. Total DNA was extracted from each sample and analyzed using the Mel and Mm real-time PCR assays described above. The samples showed expected low Ct values (mean Ct = 9.8, SD = 0.1) for the Mel real-time PCR assay (Table 3) due to the high concentration of target DNA (extracted from 2 mg of Mlp urediniospores) in the samples. The specific Mm real-time PCR assay was very sensitive; it was able to detect down to two Mmd urediniospores in a mixture of 2 mg of Mlp urediniospores in all replicates, and as little as a single Mmd urediniospore in four out of six replicates (Table 3). The DNA from samples containing one urediniospore of Mmd yielded mean Ct values of 29.2 ± 0.2, which can be considered as the cut-off value for detection in our experimental conditions (i.e. starting quantity of urediniospores ≤2 mg). In routine analysis, mean Ct values >30 should be cautiously interpreted and would require additional investigation.
Table 3

Mel and Mm detection using the real-time PCR assays optimized in this study

Mmd urediniosporesa

Mel assayb

Mm assayb

0

9,7 (0,4)

c

1

9,7 (0,2)

29,2 (0,2)

2

9,9 (0,3)

29,0 (0,9)

5

10,0 (0,2)

27,3 (0,7)

10

9,6 (0,4)

25,2 (1,5)

20

9,8 (0,1)

24,3 (0,8)

50

9,9 (0,2)

24,2 (0,8)

aSamples contained 0, 1, 2, 5, 10, 20 or 50 urediniospores of Mmd mixed into 2 mg of urediniospores of Mlp. Six replicates were prepared per condition

bResults are presented as mean Ct values, with the standard deviations in brackets. For the sample containing 1 urediniospore, the mean Ct value and the standard deviation were calculated with four replicates for the Mm real-time PCR assay, while they were calculated with six replicates for all the other conditions

cCt values > 40 cycles

This test detected all M. medusae samples tested, regardless of the forma specialis. This test did not cross-react with M. pinitorqua and M. rostrupii DNA, one of the drawbacks of the currently used conventional PCR method (Husson et al. 2013). Nevertheless, positive results were observed with M. medusae-populina and M. occidentalis DNA. On the one hand, this is not entirely surprising since M. medusae-populina is actually a natural interspecific hybrid between Mlp and Mmd and contains both types of ITS sequences in its genome (Frey et al. 2005). To confirm the hybrid status, cloning and sequencing the ITS region could demonstrate the presence of both ITS sequences. Alternatively, morphological urediniospore observations could be easily used to distinct the hybrid M. medusae-populina from Mmd.

On the other hand, despite three and two single nucleotide polymorphisms (SNP) in the forward and the reverse primers respectively, M. occidentalis DNA yielded positive results with the Mm real-time PCR assay, even with higher hybridization/polymerisation temperature (data not shown). Such results suggest: i) a lack of specificity of the present assay resulting in a cross amplification of M. occidentalis ITS sequence, or ii) the presence of ITS copies specific to Mmd within the DNA of the M. occidentalis specimens tested. Such ITS copies heterogeneity in M. occidentalis DNA sample is possible as this species is able to hybridize with Mmd in northwestern America (Newcombe et al. 2000, 2001), giving rise to the hybrid M. x Columbiana. The presence of hybrids involving M. medusae as a parent, i.e. M. medusae-populina and M. x columbiana, could therefore lead to false positive results. Nevertheless, M. medusae-populina has only been reported in New Zealand and South Africa so far (Spiers and Hopcroft 1994; Frey et al. 2005) and M. occidentalis and its hybrid M. x columbiana in western North America (Vialle et al. 2011). As for M. medusae, these species and hybrids are presently absent in Europe. Thus, positive results with the Mm real-time PCR assay would also give a chance to monitor any new introduction of M. occidentalis, M. x columbiana or M. medusae-populina in Europe. Morphological urediniospore observation could then be used to confirm the identity of the taxa detected.

In this study, a new real-time PCR test was developed in order to detect minute amounts of the European quarantine species M. medusae in a massive mixture of indigenous Melampsora urediniospores. This test offers improved specificity and sensitivity over currently existing tests and does not require specific taxonomic skills, which makes it a valid and useful detection tool for surveys in European nurseries. Due to its ability to target indistinctively both formae speciales of M. medusae, this tool can be used with samples collected from both cultivated and wild poplars.

Acknowledgments

This research was financed by the Agence Nationale de Sécurité Sanitaire de l’Alimentation, de l’Environnement et du Travail (ANSES), the Institut Fédératif de Recherche (IFR) 110 (University of Lorraine), the Canadian Barcode of Life Research Network from Genome Canada through the Ontario Genomics Institute, the Natural Sciences and Engineering Research Council of Canada, and other sponsors listed at www.BOLNET.org, and by Natural Resources Canada’s Canadian Biotechnology Regulatory Strategic fund and Genomic Research and Development Initiative.

Copyright information

© KNPV 2013