Journal of General Plant Pathology

, Volume 78, Issue 6, pp 389–397

Rapid and reliable detection of phytoplasma by loop-mediated isothermal amplification targeting a housekeeping gene

Authors

  • Kyoko Sugawara
    • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life SciencesThe University of Tokyo
  • Misako Himeno
    • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life SciencesThe University of Tokyo
  • Takuya Keima
    • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life SciencesThe University of Tokyo
  • Yugo Kitazawa
    • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life SciencesThe University of Tokyo
  • Kensaku Maejima
    • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life SciencesThe University of Tokyo
  • Kenro Oshima
    • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life SciencesThe University of Tokyo
    • Department of Agricultural and Environmental Biology, Graduate School of Agricultural and Life SciencesThe University of Tokyo
Bacterial and Phytoplasma Diseases

DOI: 10.1007/s10327-012-0403-9

Cite this article as:
Sugawara, K., Himeno, M., Keima, T. et al. J Gen Plant Pathol (2012) 78: 389. doi:10.1007/s10327-012-0403-9

Abstract

Phytoplasmas are plant pathogenic bacteria that infect more than 700 plant species. Because phytoplasma-resistant cultivars are not available for the vast majority of crops, the most common practice to prevent phytoplasma diseases is to remove infected plants. Therefore, developing a rapid, accurate diagnostic method to detect a phytoplasma infection is important. Here, we developed a phytoplasma detection assay based on loop-mediated isothermal amplification (LAMP) by targeting the groEL gene and 16S rDNA. We designed 19 primer sets for the LAMP assay and evaluated their amplification efficiency, sensitivity, and spectra to select the most suitable primer sets to detect Candidatus Phytoplasma asteris. As a result, DNA was efficiently amplified by one of the primer sets targeting the groEL gene, and LAMP assay sensitivity with this primer set was 10-fold higher than that of the polymerase chain reaction. Moreover, the groEL gene was successfully amplified from several strains of Ca. Phytoplasma asteris by this primer set, indicating that the groEL gene can be used as a LAMP assay target gene for a broad range of phytoplasma strains. Additionally, a simple DNA extraction method that omits the homogenizing and phenol extraction steps was combined with the LAMP assay to develop a simple, rapid, and convenient diagnostic method for detecting phytoplasma.

Keywords

PhytoplasmaLoop-mediated isothermal amplificationDiagnosisgroEL16S ribosomal DNA

Introduction

Phytoplasmas are plant pathogenic bacteria that infect more than 700 plant species and cause significant damage to agricultural crops (Hogenhout et al. 2008). Phytoplasmas reside endocellularly within the plant phloem and in feeding insects (leafhoppers) and are spread among plants by insects (Christensen et al. 2005; Oshima et al. 2011).

Despite their economic importance, phytoplasmas are still among the most poorly characterized plant pathogens, primarily because efforts at in vitro culture, gene delivery, and mutagenesis have been unsuccessful. As phytoplasma-resistant cultivars are not available for the vast majority of crops, the most common practice to prevent phytoplasma diseases is removing infected plants (Hogenhout et al. 2008). Therefore, it is extremely important to develop a rapid and accurate method to diagnose a phytoplasma infection.

Several diagnostic methods for phytoplasmas have been developed, and most are based on DNA–DNA hybridization (Davis et al. 1988), polymerase chain reaction (PCR) (Chen and Lin 1997; Nikolic et al. 2010), or enzyme linked immunosorbent assay (Loi et al. 2002). Among these, the amplification of phytoplasmal DNA by PCR is the most commonly used method for diagnosis due to its high sensitivity and specificity (Ayman et al. 2010; Back et al. 2010; Raj et al. 2010). However, the PCR-based technique requires a thermal cycler and an electrophoresis apparatus, which makes it difficult to use in the field.

Loop-mediated isothermal amplification (LAMP) is a recently developed DNA amplification technique that is more sensitive, rapid, and convenient than PCR amplification (Mori and Notomi 2009; Parida et al. 2008). In LAMP, the target DNA is amplified by DNA polymerase with strand-displacing activity at isothermal temperatures (60–65 °C) within ca. 60 min. LAMP is suitable for on-site diagnostic use for several reasons (Mori and Notomi 2009). First, the isothermal conditions can be achieved with a simple heating block or a water bath instead of a thermal cycler. Second, an insoluble, white magnesium pyrophosphate precipitate is gradually produced during the LAMP reaction, allowing for visualization of DNA amplification (Goto et al. 2009; Mori et al. 2001; Tomita et al. 2008). Third, LAMP is highly specific for the target sequence because the LAMP reaction requires six independent target regions. Because of its simple operation and cost-effectiveness, LAMP has been increasingly used to diagnose infectious diseases of humans, livestock, and plants (Fukuta et al. 2003; Iwamoto et al. 2003; Li et al. 2009; Poon et al. 2005; Rigano et al. 2010).

LAMP has also been used to detect several phytoplasmas and is expected to be a rapid and reliable field-diagnostic system for phytoplasma diseases (Bekele et al. 2011; Obura et al. 2011; Tomlinson et al. 2010). In all reported LAMP detection assays, the phytoplasmal rDNA sequence was targeted for the LAMP reaction, probably because 16S rDNA is the most often sequenced among all phytoplasmal genes. However, although several hundred housekeeping genes are encoded in the phytoplasma genome (Oshima et al. 2004), other housekeeping genes have not yet been targeted for the LAMP reaction. As a highly conserved housekeeping gene, the groEL gene, which encodes a conserved molecular chaperone, has been sequenced in several phytoplasma strains (Arashida et al. 2008; Kakizawa et al. 2009; Mitrović et al. 2011). In this study, we developed a LAMP-based detection assay for phytoplasmas by targeting the groEL gene and rDNA. We evaluated amplification efficiency, sensitivity, and detection spectra using 19 LAMP primer sets and selected the most suitable primer set for detecting AY group phytoplasma.

Materials and methods

Phytoplasma strains

All phytoplasma strains used in this study are summarized in Table 1. DNA of OY, WDWB, HBWB, RYD, JWB, and CnWB phytoplasma strains was prepared from phytoplasma-infected plants (OY: Oshima et al. 2001; WDWB: Jung et al. 2002a; HBWB: Jung et al. 2006; RYD: Jung et al. 2003b; JWB: Jung et al. 2003a; and CnWB: Jung et al. 2002b). DNA of the LY and PPWB strains was kindly provided by Dr. Nigel A. Harrison (University of Florida, Gainesville, FL, USA), and DNA of the PPT and FBP strains was kindly provided by Dr. Assunta Bertaccini (University of Bologna, Italy).
Table 1

Phytoplasma strains used in this study

Phytoplasma

Disease

Classification

Accessiona

OY

Onion yellows

Ca. P. asteris

AP006628, PAM_r001

WDWB

Water dropwort witches’ broom

Ca. P. asteris

AB078436

HBWB

Henon bamboo witches’broom

Ca. P. asteris

AB242433

PPT

Potato purple top

Ca. P. asteris

HQ530151

FBP

Faba bean phyllody

Ca. P. aurantifolia

HQ589188

PPWB

Pigeon pea witches’ broom

Not reported

U18763

RYD

Rice yellow dwarf

Ca. P. oryzae

D12581

JWB

Jujube witches’ broom

Ca.P. ziziphi

AB052876

CnWB

Chestnut witches’ broom

Ca. P. castaneae

AB054986

LY

Coconut lethal yellowing

Ca. P. palmae

U18747

aGenBank accession number for 16S rDNA sequence of each strain

DNA extraction

Total DNA was extracted from healthy garland chrysanthemum or phytoplasma-infected plants using the cetyltrimethylammonium bromide (CTAB) method described previously (Lee and Davis 1986). The following simplified procedure was used for the alkaline solution-based extraction. Healthy or phytoplasma-infected leaf midribs of garland chrysanthemum were cut into 2–3 mm squares, placed in a 1.5 mL tube containing 250 μL of 0.25 M NaOH, and then incubated at 95 °C for 5 min. After the incubation, the supernatant was transferred to a new tube and neutralized with 50 μL of 2.5 M NaOAc. DNA was collected from this suspension following isopropanol precipitation. The resulting pellets were resuspended in distilled water and served as the template for the LAMP assay.

LAMP primer design

Sixteen and three LAMP primer sets were designed with Primer explorer V4 software (http://primerexplorer.jp/), based on the 16S rDNA (AP006628, PAM_r001) and groEL (AP006628, PAM_121) gene sequences of OY phytoplasma (Oshima et al. 2004), respectively (Table 2). Each primer set consists of four primers: forward outer primer (FOP), reverse outer primer (ROP), forward inner primer (FIP) and reverse inner primer (RIP). Because each inner primer consists of two parts that match different regions of the targeted sequence, each set of LAMP primers recognizes six regions of the targeted sequence in total.
Table 2

Loop-mediated isothermal amplification (LAMP) primer sets used in this study

Primer

Type

Sequence (5′-3′)

GL1

FOP

TCCTGTTTTAGTAAAAGAAGGAA

FIP

TCTTCTTGGGCGTCTACTTTTTT-AGTTAGCTGCATTAACAGTTGC

RIP

TATTCAAAATGTGGCTGCTGTTTCA-CTTTTTGCATCGCTTGG

ROP

CAACATTAATAACTCCATCTTTTCC

GL2

FOP

GTTGCCAAAAAACTTTTAGCT

FIP

CTACCTGATGAAACAGCAGCC-AATCTAAAAAAGTAGACGCCCA

RIP

AATTGGTAAAATCATTGCCCAAGCG-GATTCATCAACATTAATAACTCCA

ROP

ACTTCTAATTCTGTTTCAAAACC

GL3

FOP

ATGTTGATGAATCCAAAGGTT

FIP

TCAGAGACAAAATAAGGAGAAGCAT-AAACAGAATTAGAAGTTGTTGAAGG

RIP

TGACAGTACAGTTAGAAAATGCGT-GGTACAATTTCTTGCACAGT

ROP

ATGCTTTTACTACTTCTTCCAA

RRN1

FOP

GCTCAGGATTAACGCTGG

FIP

ACCCGTTCGCCACTAAAGTTTAAT-GGCGTGCCTAATACATGC

RIP

AAGACGAGGATAACAGTTGGAAA-CTCTTTTAAAAACAAGAAGATGCC

ROP

AAGCTCCTCCCTAAGCAT

RN2

FOP

GGAAACGACTGCTAAGACT

FIP

CAAGCTCCTCCCTAAGCATACC-GATAGGAGACAAGAGGGCAT

RIP

GTTAGTTGGTGGGGTAAAGGCC-GTCTCAGTCCCAATGTGG

ROP

CCTCCCGTAGGAGTTTGG

RRN3

FOP

GCGTCACATTAGTTAGTTGGT

FIP

ATGTGGCCGTTCAACCTCTC-GGGGTAAAGGCCTACCAA

RIP

GACTGAGACACGGCCCAAAC-CGGTCAGAGTTTCCTCCA

ROP

TACTTCATCGTTCACGCG

RRN4

FOP

TTAGTTAGTTGGTGGGGTAA

FIP

GTCTCAGTCCCAATGTGGCC-CCTACCAAGACTATGATGTGT

RIP

GGAGGCAGCAGTAGGGAATTT-ACTTCATCGTTCACGCG

ROP

TAAAAGAACTTTACGTACCGAA

RRN5

FOP

GGAGACAAGAGGGCATCT

FIP

TACCCCACCAACTAACTAATGTG-ACTTTAAAAGACCTAGCAATAGGTATG

RIP

TACCAAGACTATGATGTGTAGCCG-CCTCCCGTAGGAGTTTGG

ROP

TGCCGAAAATTCCCTACTG

RRN6

FOP

AGACCTAGCAATAGGTATGC

FIP

GTGGCCGTTCAACCTCTCAG-GCGTCACATTAGTTAGTTGGT

RIP

Identical to RRN3 RIP

ROP

AAATACTTCATCGTTCACGC

RRN7

FOP

GACGAGGATAACAGTTGGA

FIP

AAGCATACCTATTGCTAGGTCTTTTAA-CGACTGCTAAGACTGGA

RIP

TAGTTGGTGGGGTAAAGGCCTA-GTGTCTCAGTCCCAATGT

ROP

GAAAATTCCCTACTGCTGC

RRN8

FOP

CATGCAAGTCGAACGGAA

FIP

CCTCGTCTTAGGGGCAGATTG-GCAATTAAACTTTAGTGGCGA

RIP

GCTAAGACTGGATAGGAGACAAG-AGCTCCTCCCTAAGCATAC

ROP

CAACTAACTAATGTGACGCAA

RRN9

FOP

ACGACTGCTAAGACTGGAT

FIP

ACTAATGTGACGCAAGCTCCTC-GGCATCTTCTTGTTTTTAAAAGAC

RIP

TAGTTGGTGGGGTAAAGGCC-GTCTCAGTCCCAATGTGG

ROP

Identical to RRN2 ROP

RRN10

FOP

GGGTGAGTAACGCGTAAG

FIP

AAGATGCCCTCTTGTCTCCT-AGACGAGGATAACAGTTGGA

RIP

AATAGGTATGCTTAGGGAGGAGCC-GGCTACACATCATAGTCTTG

ROP

GTGTCTCAGTCCCAATGT

RRN11

FOP

CTTAGGGAGGAGCTTGCG

FIP

GTGGCCGTTCAACCTCT-CAGGTGGGGTAAAGGCCTACCA

RIP

GGACTGAGACACGGCCCAAA-TCGGTCAGAGTTTCCTCCATT

ROP

Identical to RRN3 ROP

RRN12

FOP

Identical to RRN6 FOP

FIP

CTCAGCCCGGCTACACATCATAG-TCTTGCGTCACATTAGTTAGTTGG

RIP

GCCACATTGGGACTGAGACACGG-GTCAGAGTTTCCTCCATT

ROP

Identical to RRN6 ROP

RRN13

FOP

Identical to RRN4 FOP

FIP

CAGTCCCAATGTGGCC-GTTCGGCCTACCAAGACTATGATGT

RIP

CTCCTACGGGAGGCAGCAGT-TACTTCATCGTTCACGCG

ROP

CTAATAAAAGAACTTTACGTACCG

RRN14

FOP

ACGGTACCTAATGAATAAGCC

FIP

CGCCCAATAATTCCGGATAACGCT-CGGCTAACTATGTGCCAG

RIP

GCGTAGGCGGTTAAATAAGTTTATG-CTATCTTACTCTAGCTAAACAGTT

ROP

CATTTTACCACTACACATGGAA

RRN15

FOP

Identical to RRN11 FOP

FIP

CCTCTCAGCCCGGCTACACA-ATTAGTTAGTTGGTGGGGTAA

RIP

GCCACATTGGGACTGAGACAAGAG-TTTCCTCCATTGCC

ROP

Identical to RRN3 ROP

RRN16

FOP

GCATCTTCTTGTTTTTAAAAGACCT

FIP

ACATCATAGTCTTGGTAGGCCTTTAC-TTAGGGAGGAGCTTGCG

RIP

GCCACATTGGGACTGAGACAG-TTTCCTCCATTGCCGAA

ROP

Identical to RRN3 ROP

F forward, R reverse, OP outer primer, IP inner primer. For each FIP or RIP, the boundary between two parts that match two different regions of target gene, is indicated by a hyphen

LAMP assay

Template DNA and primer sets (10 ng each) were mixed with the LAMP reaction mix (total 25 μL) containing 20 mM Tris–Cl (pH 8.8), 10 mM KCl, 8 mM MgSO4, 10 mM (NH4)2SO4, 0.1 % Tween 20, 0.8 M betaine, 1.4 mM of each dNTP, 8 U Bst DNA polymerase (New England Biolabs, Ipswich, MA, USA), and 1 μL of Fluorescent Detection Reagent (FD, Eiken Kagaku, Tokyo, Japan). The mixture was incubated at 63 °C, for 60 min to amplify groEL, or for 90 min to amplify 16S rDNA, respectively. The mixture was then incubated at 80 °C for 5 min to inactivate DNA polymerase. DNA amplification was detected using the colorimetric change in the reaction mixture or the fluorescence intensity under ultraviolet light. Total DNA extracted from OY-infected plants was diluted with distilled water in a 10-fold series (10−1–10−4) and used as templates for the LAMP assay to evaluate the detection limit. DNA extracted from a healthy plant was used as a negative control.

PCR assay

A conventional PCR assay for phytoplasma detection was performed with primer SN910601 (5′-GTT TGA TCC TGG CTC AGG ATT-3′) and SN910502 (5′-AAC CCC GAG AAC GTA TTC ACC-3′), which amplify 1,367 bp of phytoplasmal 16S rDNA (Namba et al. 1993). PCR reactions were carried out using TaKaRa Taq (Takara Bio, Otsu, Japan) under the following conditions: 30 cycles of 94 °C for 1 min, 60 °C for 30 s, and 72 °C for 1 min; followed by a final extension step at 72 °C for 2 min. PCR products were electrophoresed on a 0.7 % agarose gel and visualized by ethidium bromide staining.

Real-time LAMP assay

The real-time LAMP assay was performed with the Isothermal Master Mix (OptiGene, Horsham, West Sussex, UK) according to the manufacturer’s instructions. DNA amplification is greatly accelerated in this assay by using a fast DNA polymerase and thermostable pyrophosphatase. The pyrophosphatase digests pyrophosphate, which reduces the efficiency of the LAMP reaction. DNA amplifications were monitored with the Genie I instrument (OptiGene), which can detect fluorescence of the DNA intercalator in a time-dependent manner. The results were analyzed with Genie software (OptiGene). Distilled water and DNA extracted from a healthy plant were used as negative controls in each experiment.

Phylogenetic analyses and construction of a phylogenetic tree

The 16S rDNA sequences of the phytoplasma strains and that of Acholeplasma laidlawii were aligned with Clustal W (Thompson et al. 1994). The phylogenetic tree was constructed with the program MEGA version 4 (Tamura et al. 2007) using the neighbor-joining method. Nucleotide sequences and their accession numbers used for the multiple sequence alignment were as follows: 16S rDNA sequences of OY (AP006628, PAM_r001), WDWB (AB078436), HBWB (AB242433), PPT (HQ530151), FBP (HQ589188), PPWB (U18763), RYD (D12581), JWB (AB052876), CnWB (AB054986), LY (U18747), and A. laidlawii (CP000896, ACL_0067).

Results

Selection of suitable primer sets to detect phytoplasma

To detect phylogenetically distant phytoplasmas in a single LAMP assay, we focused on two highly conserved genes, 16S rDNA and the groEL gene, as targets for LAMP. We first designed three primer sets for each gene, hereafter referred to as RRN1 to RRN3 (RRN1–3) for 16SrDNA and GL1 to GL3 (GL1–3) for groEL, from the OY phytoplasma sequences. We next performed LAMP on the total DNA of an OY phytoplasma-infected plant with these primer sets. As a result, the RRN1–3 primer sets failed to amplify phytoplasma DNA (Fig. 1a, lanes 1–3), whereas LAMP with GL2 among the GL1–3 primer sets was successful after a 60-min incubation (Fig. 1b, lane D). Negative control experiments using distilled water or healthy plant DNA were also performed, but no DNA was amplified with GL2 (Fig. 1b, lanes C and H).
https://static-content.springer.com/image/art%3A10.1007%2Fs10327-012-0403-9/MediaObjects/10327_2012_403_Fig1_HTML.gif
Fig. 1

Screening of the 19 designed loop-mediated isothermal amplification (LAMP) primer sets. a Reaction tubes 90 min after the LAMP reaction using the RRN1–16 primer sets (1–16). Phytoplasma (OY)-infected plant DNA was used as a template. The results were examined under UV light. b Reaction tubes 60 min after the LAMP reaction using GL1–3 primer sets (1–3). Reaction was performed using distilled water (lane C), healthy plant DNA (lane H), or an OY-infected plant DNA (lane D) as a template

We further designed 13 primer sets targeting the 16S rDNA (RRN4 to RRN16) to select a primer set that can amplify 16S rDNA. We finally obtained positive amplification with the RRN4 and RRN8 primer sets (Fig. 1a, lanes 4 and 8) after a 90-min incubation. These amplifications were also specific for phytoplasma infection because LAMP of healthy plant DNA did not result in amplification (Fig. 2b, lane H; 2c lane H). Finally, three primer sets among the 19 LAMP primer sets were considered potentially suitable for phytoplasma detection.
https://static-content.springer.com/image/art%3A10.1007%2Fs10327-012-0403-9/MediaObjects/10327_2012_403_Fig2_HTML.gif
Fig. 2

Comparison of sensitivities of conventional polymerase chain reaction (PCR) and loop-mediated isothermal amplification (LAMP) assays with the RRN4, RRN8, and GL2 primer sets. Representative results of at least three experiments are shown. The detection limits of the PCR (a), and LAMP assays with the RRN4 (b), RRN8 (c), and GL2 (d) primer sets were compared. Healthy plant DNA (lane H) or 10-fold serial dilution of phytoplasma-infected plant DNA (10−0, 10−1, 10−2, 10−3 or 10−4 dilution in lane 0, 1, 2, 3 or 4, respectively) were used as templates. Reaction tubes were observed under UV light (upper panel) and visible light (lower panel). A colorimetric change (from light orange to yellowish-green) in visible light indicates a positive result. LAMP reactions were performed with RRN4 and RRN8 for 90 min or with GL2 for 60 min

Comparison of the LAMP and PCR assay detection limits

Detection limits of the LAMP and PCR assays were estimated with a 10-fold dilution series of total DNA from an OY phytoplasma-infected plant (Fig. 2). As shown in Fig. 2a, the detection limit of the PCR assay was 10−2, and LAMP with RRN4 was 10-fold less sensitive than PCR (Fig. 2b). In contrast, LAMP with RRN8 had the highest sensitivity (<10−4) among the LAMP primer sets, which was 100-fold higher than that of PCR (Fig. 2c). LAMP with the GL2 primer set could amplify phytoplasma DNA to a 10−3 dilution, which was 10-fold more sensitive than that of PCR (Fig. 2d). These results were replicated more than three times. In particular, LAMP reactions with GL2 gave the strongest colorimetric change and fluorescence; thus, we selected RRN8 and GL2 primer sets for further analyses.

Applicability of LAMP detection to a wide range of phytoplasma strains

We performed the real-time LAMP assay with GL2 and RRN8 using 10 phylogenetically diverse phytoplasma strains to investigate whether these two primer sets were suitable to detect other phytoplasma strains. DNA from four phytoplasma strains (OY, WDWB, HBWB, and PPT) was successfully amplified with both primer sets (Fig. 3a, b), suggesting that the specificity for detecting phytoplasmas was almost the same for the two primer sets. All detected strains were relatively close to the OY strain and belonged to the AY group (Fig. 3c). Additionally, while the final fluorescent intensities were similar between the GL2 and RRN8 primer set reactions, DNA amplifications proceeded more rapidly with the GL2 primer set than with RRN8 (Table 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs10327-012-0403-9/MediaObjects/10327_2012_403_Fig3_HTML.gif
Fig. 3

Specificity of the RRN8 and GL2 primer sets. Detection specificity was examined by real-time loop-mediated isothermal amplification (LAMP) using 10 phylogenetically diverse phytoplasma strains as templates. Similar results were obtained in two independent experiments. a LAMP amplification curve with RRN8 primer set. Time interval between each symbol is 45 s. b LAMP amplification curve with GL2. Interval between each symbol is 45 s. c Detection range of LAMP assay. The results of the real-time LAMP assay for each phytoplasma strain are displayed with a phylogenetic tree based on the 16S rDNA sequence using Acholeplasma laidlawii as the outgroup. Numbers on branches are bootstrap values obtained for 100 replicates (only values >80 % are shown). Presence or absence of the amplification are indicated by + or −

Table 3

Results of real-time loop-mediated isothermal amplification (LAMP) detection of phytoplasmas

Primer set

Phytoplasma strain

Threshold timea

Tmb (°C)

RRN8

OY

12′ 58″

84.56

RRN8

WDWB

10′ 13″

84.05

RRN8

HBWB

12′ 28″

84.72

RRN8

PPT

12′ 43″

84.40

GL2

OY

6′ 17″

81.34

GL2

WDWB

4′ 00″

81.49

GL2

HBWB

7′ 02″

81.55

GL2

PPT

10′ 17″

81.15

aThreshold time was defined as the time when the second derivative of each amplification curve was at its maximum

bMelting temperature (Tm) of the amplicons was calculated using dissociation curves

Development of a simple DNA extraction method for LAMP assay

Although DNA extraction using the CTAB-based method (Lee and Davis 1986) is efficient and has been a standard method for PCR-based analysis, it is also labor-intensive and time-consuming, particularly for multiple samples. Thus, we used a simple method based on an alkaline solution to extract DNA without grinding the plant tissue or using phenol–chloroform. As shown in Fig. 4, DNA was successfully amplified for the LAMP assay using primer set GL2 either with the alkaline solution method or the conventional CTAB method.
https://static-content.springer.com/image/art%3A10.1007%2Fs10327-012-0403-9/MediaObjects/10327_2012_403_Fig4_HTML.gif
Fig. 4

Loop-mediated isothermal amplification (LAMP) using GL2 primer with DNA samples extracted with either the CTAB-based method (lanes 1, 2) or the simplified alkaline-based method (lanes 38). DNA from healthy (lanes 1, 35) or phytoplasma (OY)-infected garland chrysanthemum (lanes 2, 68) were used

Discussion

LAMP assay targeting a non-ribosomal gene

We developed a LAMP assay that amplifies the groEL gene from several phytoplasma strains. This is the first report of a LAMP assay targeting a phytoplasma housekeeping gene. Several LAMP assays to detect phytoplasma have been developed recently, and all target the genomic region of ribosomal RNA genes (Bekele et al. 2011; Obura et al. 2011; Tomlinson et al. 2010). However, previous studies have suggested that the efficiency of DNA amplification in a LAMP assay differs among targeted genes (Harper et al. 2010; Nakao et al. 2010). As it has been reported that the nucleotide sequences of the groEL gene are highly conserved among 29 strains of Ca. Phytoplasma asteris (Kakizawa et al. 2009; Mitrović et al. 2011), and as the GC content was relatively high, we chose the groEL gene as a novel target gene for the LAMP assay.

Although we also designed 16 RRN primer sets to amplify phytoplasma 16S rDNA, the 16S rDNA was not amplified by the 14 RRN primer sets (Fig. 1a). It has been recommended to avoid sequences that tend to form secondary structures when designing LAMP primers (Parida et al. 2008). Because the rDNA gene encodes ribosomal structural RNA, the RRN primer sets may fail to amplify DNA due to the secondary structure. In contrast, the groEL gene was successfully amplified by one of the three GL primer sets (Fig. 1b). This result suggests that a housekeeping gene such as groEL is more suitable as a target gene for the LAMP assay to detect phytoplasma.

In general, sensitivity of the LAMP assay is almost equal to (Kuboki et al. 2003; Poon et al. 2005) or 1,000-fold higher (En et al. 2008; Njiru et al. 2008) than that of the PCR method. In this study, the sensitivity of the LAMP assay was dependent on the primer set, even when the target gene was the same (Fig. 2b, c). For example, the sensitivity of the RRN4 primer set was 10-fold lower than that of PCR, whereas the sensitivity of the RRN8 primer set was 100-fold higher than that of PCR. Our results indicate that it is important to examine and compare the amplification efficiency of various LAMP primer sets to develop the most sensitive LAMP assay.

Development of a simple, rapid, and broad spectrum LAMP assay

Among AY group phytoplasmas, pairwise similarities in the groEL gene range from 93.8 to 100 % at the nucleotide level (average 98.1 %), suggesting that the groEL gene is less conserved among phytoplasma strains than is 16S rDNA, for which the similarities average 99.5 % (Mitrović et al. 2011). Therefore, we first speculated that the GL2 primer sets targeting the groEL gene would be more specific than the RRN8 targeting 16S rDNA. However, groEL was successfully amplified from several phytoplasma strains using the GL2 primer set (Fig. 3c), indicating that groEL can be used as a LAMP assay target gene, similar to 16S rDNA, for a broad range of phytoplasma strains.

Amplification of DNA for the LAMP assay can be easily judged by a colorimetric change using a reagent such as calcein (Tomita et al. 2008) or hydroxy naphthol blue (Goto et al. 2009), an advantage of the LAMP assay because expensive detection equipment is not needed. In this study, although only weak fluorescence was detected by the LAMP assay with the RRN4 or RRN8 primer sets, clear calcein florescence was observed with the GL2 primer set targeting the groEL gene (Fig. 2d), suggesting that the GL2 primer set is suitable for a colorimetric assessment.

DNA was clearly amplified from the undiluted crude extract of the phytoplasma-infected plant by the LAMP reaction, but not by the PCR assay (Fig. 2). This difference was probably due to the high tolerance of the LAMP assay against inhibitors because the LAMP assay is more tolerant than PCR to biological contaminants (Kaneko et al. 2007). This property enabled us to combine simple DNA extraction with the LAMP assay (Fig. 4). Because of the colorimetric assessment, tolerance against inhibitors, and simple DNA extraction, the LAMP assay developed in this study will particularly contribute to field research for detecting phytoplasmas belonging to the AY group.

Acknowledgements

This work was supported by Grants-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (category "A" of Scientific Research Grant 21248004), by the Funding Program for Next Generation World-Leading Researchers (project: GS005), and by the Program for Promotion of Basic Research Activities for Innovative Bioscience (PROBRAIN).

Copyright information

© The Phytopathological Society of Japan and Springer 2012