Neurogenetics

, Volume 9, Issue 4, pp 263–269

Analysis of PARK genes in a Korean cohort of early-onset Parkinson disease

Authors

  • Jung Mi Choi
    • Department of Neurology, Hallym University Sacred Heart Hospital, ILSONG Institute of Life ScienceHallym University
  • Myoung Soo Woo
    • Department of Neurology, Hallym University Sacred Heart Hospital, ILSONG Institute of Life ScienceHallym University
  • Hyeo-Il Ma
    • Department of Neurology, College of MedicineHallym University
  • Suk Yun Kang
    • Department of Neurology, College of MedicineHallym University
  • Young-Hee Sung
    • Department of Neurology, College of MedicineGachon University
  • Seok Woo Yong
    • Department of Neurology, School of MedicineAjou University
  • Sun Ju Chung
    • Department of NeurologyAsan Medical Center, University of Ulsan College of Medicine
  • Joong-Seok Kim
    • Department of Neurology, College of MedicineThe Catholic University of Korea
  • Hae-won Shin
    • Department of Neurology, College of MedicineYonsei University
  • Chul Hyoung Lyoo
    • Department of Neurology, College of MedicineYonsei University
  • Phil Hyu Lee
    • Department of Neurology, College of MedicineYonsei University
  • Jong Sam Baik
    • Department of Neurology, College of MedicineInje University
  • Sang-Jin Kim
    • Department of Neurology, College of MedicineInje University
  • Mee Young Park
    • Department of Neurology, College of MedicineYeungnam University
  • Young Ho Sohn
    • Department of Neurology, College of MedicineYonsei University
  • Jin-Ho Kim
    • Department of Neurology, College of MedicineChosun University
  • Jae Woo Kim
    • Department of Neurology, College of MedicineDong-A University
  • Myung Sik Lee
    • Department of Neurology, College of MedicineYonsei University
  • Myoung Chong Lee
    • Department of NeurologyAsan Medical Center, University of Ulsan College of Medicine
  • Dong-Hyun Kim
    • Department of Social and Preventive Medicine, College of MedicineHallym University
    • Department of Neurology, Hallym University Sacred Heart Hospital, ILSONG Institute of Life ScienceHallym University
    • Department of Neurology, College of MedicineHallym University
Original Article

DOI: 10.1007/s10048-008-0138-0

Cite this article as:
Choi, J.M., Woo, M.S., Ma, H. et al. Neurogenetics (2008) 9: 263. doi:10.1007/s10048-008-0138-0

Abstract

Mutations in five PARK genes (SNCA, PARKIN, DJ-1, PINK1, and LRRK2) are well-established genetic causes of Parkinson disease (PD). Recently, G2385R substitution in LRRK2 has been determined as a susceptibility allele in Asian PD. The objective of this study is to determine the frequency of mutations in these PARK genes in a Korean early-onset Parkinson disease (EOPD) cohort. The authors sequenced 35 exons in SNCA, PARKIN, DJ-1, PINK1, and LRRK2 in 72 unrelated EOPD (age-at-onset ≤50) recruited from ten movement disorders clinics in South Korea. Gene dosage change of the aforementioned genes was studied using multiple ligation-dependent probe amplification. We found four patients with PARKIN mutations, which were homozygous deletion of exon 4, compound heterozygous deletion of exon 2 and exon 4, heterozygous deletion of exon 4, and heterozygous nonsense mutation (Q40X). Four patients had PINK1 mutations; a compound heterozygous mutation (N367S and K520RfsX522) and three heterozygous mutations (G32R, R279H, and F385L). A missense mutation of SNCA (A53T) was found in a familial PD with autosomal dominant inheritance. Nine patients (12.5%) had heterozygous G2385R polymorphism of LRRK2, whereas none had G2019S mutation. However, no mutations were detected in DJ-1 and UCHL1 in our series. We identified genetic variants in PARKIN, PINK1, LRRK2, and SNCA as a cause or genetic risk factors for PD in 25% of Korean EOPD, and mutation of PARKIN was the most common genetic cause.

Keywords

Parkinson diseaseGenetics of Parkinson diseaseMutation of Mendelian genesSusceptibility genes of Parkinson diseaseEarly-onset Parkinson disease

Introduction

During the last decade, there has been breakthrough progress in genetics of Parkinson disease (PD). Genetic background of PD is heterogeneous. Thirteen loci or genes labeled PARK1 to PARK13 have been identified to be related with PD [1]. Among these genes, mutations in SNCA, PARKIN, PINK1, DJ-1, and LRRK2 have been consistently identified in familial or sporadic PD of different ethnic origin. Mutations in other genes were also reported to cause PD, although most of them were not replicated by other groups [1]. Moreover, levodopa-responsive parkinsonism was reported in families with trinucleotide repeat expansions in ATXN2 (SCA2), ATXN3 (SCA3), SCA8, or TBP (SCA17) [2, 3]. Besides PD-causing genes inherited in Mendelian fashion, G2385R polymorphism in LRRK2 was found significantly more common among PD patients than controls in some Asian populations, suggesting that this genetic variant acts as a risk factor for sporadic PD.

Recently, predictive genetic testing in PD has become available on a commercial basis and helps in the definite diagnosis for monogenic PDs. However, there are many unanswered questions regarding predictive genetic test such as which gene to study, how many genes, what kind of genetic analysis, how to prioritize patients and genes to be studied, probability of a positive genetic test in a given population, feasibility of routine genetic testing in clinical practice, and genetic counseling [4]. To address these questions, more data of genetic analysis are needed especially in Asian PD population, although there have been many genetics studies reported until now. Frequencies of PD patients carrying mutations of the aforementioned genes vary considerably depending on patterns of inheritance, age-at-onset, ethnic groups, cultural background, or referral bias [1, 4]. Moreover, there were only a few studies investigating mutations in multiple genes in a given population [57]. To know the frequency of patients carrying mutations related with PD, we screened mutations in multiple causative or susceptibility genes for PD in early-onset Parkinson disease (EOPD).

Materials and methods

Patients

Seventy-two unrelated EOPD who were diagnosed as PD based on published diagnostic criteria by movement disorders specialists at ten movement disorders clinics in South Korea were studied [8]. Briefly, PD was diagnosed when they have at least two of the three cardinal signs: bradykinesia/akinesia, rigidity or rest tremor, and a good response to levodopa treatment. Those who had signs of atypical parkinsonism such as supranuclear palsy, cerebellar dysfunction, Barbinski signs, dementia, or severe autonomic dysfunction were excluded. All PD patients whose age-at-onset is less than or equal to 50 years old were asked to participate in a genetic study, and those who signed informed consent were enrolled in this study. All participants were Korean. Family history was regarded positive if parkinsonism was reported in a first- or second-degree relative. Age- and sex-matched normal controls who did not have any neurological symptoms and signs on neurological examination were recruited from the National Health Examinee in Hallym University Sacred Heart Hospital. The project was approved by the Institutional Review Board at Hallym University.

Genetic studies

Peripheral blood was collected from each patient and DNA was extracted from leukocytes according to a standard protocol. All patients were previously tested for mutations in SCA2, SCA3, and SCA17 [9]. Mutation analysis was done by PCR and sequencing in the following genes (exons): SNCA (exons 3 and 4), PARKIN (12 exons), UCHL1 (exon 4), PINK1 (8 exons), DJ-1 (7 exons), and LRRK2 (exon 24, 31, 35, 41, and 48). Exons of the aforementioned genes were amplified by polymerase chain reaction (PCR) using intronic primers. Primer sequences and PCR protocols are reported in Table 1. Direct sequencing of both strands was performed using Big Dye Terminator Chemistry version 3.1 (Applied Biosystems). Fragments were loaded on an ABI3100 automated sequencer and electropherograms were analyzed with DNA Sequencing Analysis version 3.7 and SeqScape software version 2.1 (Applied Biosystems). The consequences of the mutation at the protein level in each gene were predicted according to following mRNA sequences (accession number: NM_000345 for SNCA, NM_004562 for PARKIN, NM_004181 for UCHL1, NM_032409 for PINK1, NM_007262 for DJ-1, and NM_198578 for LRRK2). Genotyping was triplicated when a variant was identified.
Table 1

PCR primers and conditions

Gene

Exons

Forward primer 5′→3′

Reverse primer 3′→5′

Conditions

SNCA

3

GTCTCACACTTTGGAGGGTT

CACCTACCTACACATACCTCTGAC

94°C 3 min 35 cycles (92°C 20 s/55°C 30 s/72 °C 45 s) 72°C 10 min

4

CCCTTTAATCTGTTGTTGCTCT

CAGGCCTCACATGAAAAT

PARKIN

1

GCGCGGCTGGCGCCGCTGCGCG

GCGGCGCAGAGAGGCTGT

Initial denaturation, 94°C 10 min 40 cycles—denaturation, 94°C 30 s; annealing, 55°C 30 s; extension, 72°C 45 s; final extension, 72°C 10 min

2

ATGTTGCTATCACCATTTAAG

AGATTGGCAGCGCAGGCGGCA

3

ACATGTCACTTTTGCTTCC

AGGCCATGCTCCATGCAGACT

4

ACAAGCTTTTAAAGAGTTTCTT

AGGCAATGTGTTAGTACA

5

ACATGTCTTAAGGAGTACAT

TCTCTAATTTCCTGGCAAACAG

6

AGAGATTGTTTACTGTGGAAA

GAGTGATGCTATTTTTAGATC

7

TGCCTTTCCACACTGACAGGTA

TCTGTTCTTCATTAGCATTAGA

8

TGATAGTCATAACTGTGTGTA

ACTGTCTCATTAGCGTCTATC

9

GGGTGAAATTTGCAGTCA

AATATAATCCCAGCCCATGTG

10

ATTGCCAAATGCAACCTAATG

TTGGAGGAATGAGTAGGGCA

11

ACAGGGAACATAAACTCTGAT

CAACACACCAGGCACCTTCA

12

GTTTGGGAATGCGTGT

AGAATTAGAAAATGAAGGTAGA

PINK1

1

TCACTGCTAGAGGCGC

CGGCCCTCGATCTGC

94°C 10 min 40 cycles—denaturation, 94°C 30 s; annealing, 55°C 30 s; extension, 72°C 45 s; final extension, 72°C 10 min

2

ATTGATCTGGTCGACGT

CCTTTCCTGTGCATAATC

3

CTCGAAGGTCAGAGCCA

CTGTCATATCAGACACTG

4

GAATGTCAGTGCCAGTG

AGATATGTTCCCTTTGCA

5

CGTATTGGGAGTCGTCG

GACCTGAAGAGTCAGTCC

6

GTCAGCTATGTCTTGCT

ATCACAAGGCATCGAGT

7

TGGATCAGGTGATGTGC

AGGATCTGTCACTGTGG

8

GAGAAGGGAAGACCCTC

CAGACTGAACTCTCACTC

LRRK2

24

CCAGAGGTGTGTAAGGCAGA

AACATCAGCATATTTAGGCAACC

94°C 30 s 30 cycles (denaturation, 94°C 30 s; annealing, 60°C 45 s; extension, 72°C 1 min) final extension, 72°C 7 min

25

GTCAGTGTGAGAATGGAAATC

GTGAAAATCATTCATACAT

31

AGC AAA CAC AAG AGG GTT TTG

TTTCTCTACCAGCCTACCATGT

35

GCT CAA CAA GGT TGG GTG TT

TGC CAT CTC CCT AAT TTC TCT

41

TTTTGATGCTTGACATAGTGG AC

CACATCTGAGGTCAGTGGTTATC

48

CACGTAGAAATTTTAAGAAGAAAAC

TGGGAATAAAATTAAAAACCACAG

DJ-1

1

GAGGTAGACTCGGCCGG

TTCTGGACGCTTCAGCGT

94°C 5 min 35 cycles—denaturation, 94°C 30 s; annealing, 56–60°C 30 s; extension, 72°C 90 s; final extension, 72°C 5 min

2

TAGGAAGTACTTACTCTGCT

TATTTATTCTTATGTCATCTC

3

CAGCTGTGTAAACGTTAC

ATTCTGTATCAAGCAATTG

4

CTATCTCCTGTACTTCCC

ACAGAACATAAGCAGATGC

5

TGAGAAATGCCTTGCTTG

GCTATTTGGAATCAAACCAT

6

TTTGCCAGATGTGCTCAGCAAAT

ACTGCACTCCAGCCTGGGCGAT

7

CACATAGCCCATTAGGATG

AGCTGCAAATGAAGGTGAT

Gene dosage change of the aforementioned genes due to large exonal rearrangements were analyzed by multiplex ligation-dependent probe amplification (MLPA) assay using commercially available probes (SALSA P051 Parkinson MLPA kits, MRC Holland, Amsterdam, The Netherlands) [10, 11]. Sequence-specific probes enclosed in this kit are against all exons of SNCA, PARKIN, and PINK1 and exons 1, 3, 5, 6, and 7 of DJ-1. Experimental procedures were conducted for all 72 samples in two independent reactions according to the manufacturer’s protocol. Briefly, 50–200 ng genomic DNA in 5 μl Tris–EDTA was denatured at 98°C for 5 min and subsequently hybridized to the MLPA probe set according to the manufacturer’s protocol (SALSA P051 Parkinson MLPA kits, MRC Holland, Amsterdam, The Netherlands). Ligation was performed with the Ligase-65 enzyme at 54°C for 15 min. PCR was carried out for 33 cycles (95°C for 30 s; 60°C for 30 s, 72°C for 1 min) and a final 20-min step at 72°C. The fragments were analyzed on an ABI model 3100 capillary sequencer (Applied Biosystems, Foster City, CA, USA) with the GeneMapper software using GeneScan™–500 ROX™ size standard (Applied Biosystems, Foster City, CA, USA). Individual peaks corresponding to each exon were identified based on the difference in migration relative to the size standards. Results of peak areas were exported from GeneMapper® to Coffalyser® (MRC Holland). For each sample, the relative peak area (RPA) was calculated and compared with age- and sex-matched controls using the Coffalyser® software. This program identifies a peak as normal when showing a 0.7–1.3 ratio with normal controls, heterozygous deletion when showing a ratio <0.7, and duplication when showing a ratio >1.3.

Results

The mean age of onset was 38.8 ± 7.0 years (range 13–50 years), and male to female ratio was 34:38. Twelve patients (16.7%) had a positive family history, compatible with autosomal dominant inheritance in eight patients and autosomal recessive inheritance in four patients.

Two patients had PARKIN mutations; homozygous deletion of exon 4 and compound heterozygous deletion of exons 2 and 4 (Fig. 1a). Both cases had no family history of PD, and age-at-onset was 13 and 24 years old, respectively. Heterozygous mutations of PARKIN gene were found in two patients; a 37-year-old woman with heterozygous c.219C>T in exon 2 [p.Q40X] and a familial PD with heterozygous deletion of exon 4 whose age-at-onset was 27-year-old (Fig. 1b). One familial PD patient had compound heterozygous mutations of PINK1; heterozygous c.1195C>G in exon 5 [p.N367S] and heterozygous c.1651delG in exon 8 [p.K520RfsX522] (Fig. 2a). Another three sporadic EOPD patients had heterozygous mutations of PINK1; c.188G>A in exon 1 [p.G32R], c.930G>A in exon 4 [p.R279H], and c.1247T>C in exon 6 [p.F385L] (Fig. 2b). These variants of single nucleotide substitution in PINK1 were not found in 100 normal controls. One patient had heterozygous c.203G>A [p.A53T] mutation in SNCA who turned out to be a family member of a previously reported case [12]. Mutations of the above genes are summarized in Table 2. No mutations were found in analyzed exons of UCHL1, DJ-1, and LRRK2. Recently, G2385R polymorphism of LRRK2 was found to increase the risk of PD in Asian population [1315]. In our cohort, 12.5% of Korean EOPD had G2385R polymorphism of LRRK2, whereas 5% of the age- and sex-matched controls had the same variant (p = 0.09, OR = 2.71, 95%CI = 0.87–8.48). Excluding the G2385R polymorphism of LRRK2, no EOPD in our cohort had more than one mutation of PARK genes.
https://static-content.springer.com/image/art%3A10.1007%2Fs10048-008-0138-0/MediaObjects/10048_2008_138_Fig1_HTML.gif
Fig. 1

MLPA analysis results of two patients with gene dosage alteration; compound heterozygous deletion of exons 2 and 4 (a) and heterozygous deletion of exon 4 (b)

https://static-content.springer.com/image/art%3A10.1007%2Fs10048-008-0138-0/MediaObjects/10048_2008_138_Fig2_HTML.gif
Fig. 2

Chromatogram illustrating mutations in PINK1 gene in four patients; a patient with compound heterozygous mutation (a) and three patients with heterozygous point mutations (b). Missense mutations are indicated as arrows. Arrowhead indicates the deletion of a nucleotide (c.1651delG). Open arrow indicates a single nucleotide polymorphism (rs1043424)

Table 2

Summary of mutations found in this study

Gene

Zygosity

Nucleotide change

Protein effect

Family history

PARKIN (n = 4)

Homozygous

Deletion of exon 4

Deletion of exon 4

Compound heterozygous

Heterozygous deletion of exon 2 and exon 4

Haploinsufficiency

Heterozygous

Deletion of exon 4

Haploinsufficiency

+

Heterozygous

c.219C>T

Q40X

PINK1 (n = 4)

Compound heterozygous

c.1195C>G and c.1651delG

N367S and K520RfsX522

+

Heterozygous

c.188G>A

G32R

Heterozygous

c.930G>A

R279H

Heterozygous

c.1247T>C

F385L

SNCA (n = 1)

Heterozygous

c.203G>A

A53T

+

Discussion

While genetic testing has become commercially available in PD in some countries, there are no formal guidelines for diagnostic genetic test for PD [1, 4]. Although our study has a small sample size, we think that the results of our comprehensive analysis of PARK genes in a given EOPD population provide estimated frequencies of mutations in Korean EOPD. Our study disclosed that 25% of EOPD carry mutations of PARK genes regardless of zygosity; 5.6% of EOPD had mutations in PD-causing genes. Susceptibility genes for PD were found in 19.4% of EOPD in our cohort where 6.9% carry heterozygous mutations in autosomal recessive genes and 12.5% carry G2385R polymorphism of LRRK2. Excluding the G2385R polymorphism of LRRK2, mutated alleles of PARK genes were found in 12 out of 144 chromosomes (8.3%). Mutations in PARKIN or PINK1 were not uncommon. Since our analysis did not test all exons of aforementioned PARK genes, actual frequencies of patients carrying mutations in these genes might be higher. However, we think that the difference may not be large since our analysis covered all mutations reported. Moreover, our results that mutations were found only in 25% of familial PD in our cohort suggests that other genes not yet discovered may cause or be related with EOPD.

Only a few studies analyzed multiple genes (more than two genes) in a given population of EOPD or familial PD [57]. Consistent with other studies, the mutation of PARKIN was most common among autosomal recessive genes causing PD in our study. The frequency of PARKIN mutation was low in our cohort compared with those in previous studies where they found that 4% to 66% of patients carried PARKIN mutations [1619]. This variation is due to patterns of inheritance, referral bias, age-at-onset, and ethnic difference [7, 19]. That familial PD is only in 16.7% and mean age-at-onset is higher in our cohort might have affected the low frequency of PARKIN mutation. PINK1 mutations were reported in 0% to 8% of EOPD or familial patients from different ethnic origins including Asians [6, 7, 2023]. As reported not uncommon in previous studies [20, 23], 6.9% of EOPD in our cohort carried heterozygous mutations of autosomal recessive genes; heterozygous mutations of PINK1 in three apparently sporadic EOPD patients and two heterozygous mutations of PARKIN in a sporadic EOPD and a familial EOPD. Although the role of heterozygous mutations in recessively inherited PD genes in the development of PD remains a matter of ongoing debate, there is growing evidence that it might act as susceptibility factor for PD [2426].

There are many unanswered issues in diagnostic genetic test in PD [4]. We think that our results can be used in establishing guidelines for diagnostic genetic test in EOPD in Asian population. Considering the frequencies of genes with mutation, a genetic test of PARKIN and PINK1 should be prioritized to the other genes for diagnostic genetic test in PD. Our results also highlight the importance of gene dosage analysis especially in detecting mutation in PARKIN [27]. Without gene dosage analysis using MLPA assay, three out of five patients with heterozygous deletion of PARKIN might have been missed in our study. Given that most mutations of PARKIN in Asians are due to exonal rearrangement rather than point mutation, gene dosage study must be included in diagnostic genetic test for PARKIN mutation especially in Asians [18].

Although not all exons of LRRK2 were analyzed, we included exons where mutations were reported in the Asian population. Our data support previous studies that mutations of LRRK2 including G2019S mutation is not a common genetic cause in Asian PD [2830]. On the other hand, the G2385R polymorphism of LRRK2 was reported to increase the risk for PD in some Asian PD populations [1315]. Carrier frequencies of G2385R polymorphism of LRRK2 in our data is close to previous reports in Chinese or Japanese which were 5.7–11.6% in PD and 0–4.8% in controls. Although association between this polymorphism and PD was not significant in our data, we think that the reason for the nonsignificance is in the small sample size. Whether the G2385R polymorphism of LRRK2 is also a risk factor for PD in Koreans should be confirmed in a further study with a larger sample size.

In summary, we identified genetic variants in PARKIN, PINK1, LRRK2, and SNCA as a cause or genetic risk factor for PD in 25% of Korean EOPD, and mutation of PARKIN was the most common genetic cause.

Acknowledgement

This work was supported by the Korea Research Foundation Grant funded by the Korean Government (MOEHRD) (KRF-2005-042-E00123).

Copyright information

© Springer-Verlag 2008