Protoplasma

, Volume 235, Issue 1, pp 107–110

Chlamydomonas (Chlorophyceae) colony PCR

Authors

  • Muqing Cao
    • Department of Biological Sciences and TechnologyTsinghua University
  • Yu Fu
    • Department of Biological Sciences and TechnologyTsinghua University
  • Yan Guo
    • Department of Biological Sciences and TechnologyTsinghua University
    • Department of Biological Sciences and TechnologyTsinghua University
Short Communication

DOI: 10.1007/s00709-009-0036-9

Cite this article as:
Cao, M., Fu, Y., Guo, Y. et al. Protoplasma (2009) 235: 107. doi:10.1007/s00709-009-0036-9

Abstract

The ease and effectiveness of colony polymerase chain reaction (PCR) has allowed rapid amplification of DNA fragments and screening of large number of colonies of interest including transformants and mutants with genetic manipulations. Here, we evaluated colony PCR in Chlamydomonas. Individual colonies were treated with 10 mM ethylenediaminetetraacetic acid (EDTA) or Chelex-100 and the resulting clear cell lysate was used for PCR reaction. Either genomic DNA or plasmid DNA incorporated into the genome was equally amplified. We found that the Chelex method is superior to EDTA method in certain cases. This colony PCR technique will bypass the tedious process of isolating genomic DNA for PCR reaction and will make it possible for rapid amplification of genomic DNA fragments as well as rapid large-scale screening of transformants.

Keywords

ChlamydomonasColony PCRAlgaeChelex

Introduction

Colony polymerase chain reaction (PCR) is a method of amplifying DNA fragments by PCR using single colony of organisms without isolating pure DNA. Extraction of genomic DNA requires large amount of material and is a time-consuming process involving various reagents and procedures. Thus, colony PCR is time-saving and cost-effective. First, it does not require extra cultures for obtaining large quantity of materials for extracting genomic DNA. Second, by bypassing extraction of pure genomic DNA, it allows rapid and simple amplification of desired DNA fragments for probes used in Northern or Southern blotting or for cloning purpose. Third, it makes possible for rapid screening of a large number of transformants with desired plasmid incorporation or genomic deletions and/or reorganizations.

Colony PCR has been widely used for DNA amplification with bacterial or yeast colonies (Hofmann and Brian 1991; Ward 1992). Chlamydomonas is a unicellular green alga and can grow as individual colonies on agar plates. It has been used as a model organism to study fundamental processes such as photosynthesis, cell motility, assembly and disassembly of cilia, cell cycle, fertilization, and stress responses (Harris 2001; Pan 2008). It is amenable to various molecular techniques including transformations. Thus, using PCR to clone DNA fragments and/or screening of transformants with incorporated plasmid of interest becomes routine in researches involving Chlamydomonas. Colony PCR in Chlamydomonas has been reported; however, the direct boiling of colonies in water prior to PCR reaction only applied to a few primers (personal communication, Wallace Marshall, University of California at San Francisco) and had its limitations (see below; Zamora et al. 2004). We have adapted previous published method of DNA extraction for colony PCR and found that colony PCR using crude DNA extraction from either ethylenediaminetetraacetic acid (EDTA) or Chelex method worked well with Chelex method the better. Though using Chelex to extract DNA for PCR is a well-established method in other micro-organisms, its adaption in Chlamydomonas will benefit the whole Chlamydomonas community. This method is expected to be applicable to other unicellular algae.

Results and discussion

Rapid DNA extraction from liquid cultures for PCR

On the website of Chlamydomonas database (http://www.chlamy.org/chlamydb.html), a method using EDTA combined with heating to extract DNA for PCR from cell pellet of 5 to 10 μl in size was reported. We have slightly modified this method (Fig. 1a) and evaluated this method with different amounts of cells for DNA extraction. As shown in Fig. 1b, PCR products were obtained using DNA extracted from 1 × 106 cells to 5 × 106 cells, comparable to that using pure genomic DNA as template. However, when more cells were used, no PCR products were amplified, indicating that components released from the cells may have negative effect on PCR reaction.
https://static-content.springer.com/image/art%3A10.1007%2Fs00709-009-0036-9/MediaObjects/709_2009_36_Fig1_HTML.gif
Fig. 1

Rapid and simple extraction of DNA from liquid culture and PCR. a An experimental procedure for DNA isolation with either EDTA or Chelex-100 method. Various amounts of cells (as indicated) were collected and genomic DNA was isolated for PCR template. PCR products using template DNA isolated from EDTA method (b) or from Chelex method (c) were analyzed by gel electrophoresis. N: negative control without DNA in the PCR reaction. P: positive control with purified genomic DNA as template. Primer pairs that amplify fragment of CALK gene were used. prCALK3: GTCGCGGTGAGGCTGTATCA (5’ to 3’); JPK1A12: AGCAGGTTCTCGGGCTTG (5’ to 3’). M: DNA marker

Chelex-100 has been widely used for extraction of DNA for downstream PCR application (Walsh et al. 1991). We substituted EDTA with Chelex-100 to extract Chlamydomonas DNA for PCR. Different amounts of cell materials were used for DNA extraction followed by PCR. As shown in Fig. 1c, as low as 1 × 105 cells were capable of PCR amplification; cell amounts from 3 to 10 × 106 cells gave no difference on PCR amplification. Thus, Chelex-100 can be equally applied to DNA extraction for PCR reactions.

Chlamydomonas colony PCR

As described above, colony PCR has many advantages. We determined to examine whether colony PCR worked in Chlamydomonas by adapting these two methods for DNA extraction. Single colonies with size of around 1 mm in diameter were resuspended in EDTA buffer or Chelex-100 and DNA was extracted following the procedure in Fig. 1a. We also isolated pure genomic DNA by traditional method to be used as positive control (Pan and Snell 2000). PCR reaction was carried out with primers amplifying genomic DNA fragments. For DNA isolated from each method, duplicate PCR reactions were performed. As shown in Fig. 2a, PCR reaction without DNA template (as negative control) did not yield any PCR product, whereas PCR reaction with genomic DNA as template (as positive control) yielded expected PCR product. Like positive control, colony PCR using template DNA isolated from either EDTA or chelex-100 method produced expected PCR products. Thus, colony PCR did work for amplification of genomic DNA fragments.
https://static-content.springer.com/image/art%3A10.1007%2Fs00709-009-0036-9/MediaObjects/709_2009_36_Fig2_HTML.gif
Fig. 2

Chlamydomonas colony PCR. Chlamydomonas colonies replacing liquid cell cultures were used for DNA extraction as shown in Fig. 1a. a PCR amplification of genomic DNA from single colony with EDTA or Chelex method. D1 and D2 were two duplicates of PCR reaction. PCR primers, N and P are the same as described in Fig. 1. b PCR screening of transformants transformed with paromomycin-resistant gene. P1 and P2 are positive controls where transformants with previously confirmed presence of paromomycin-resistant gene were used. N was negative control where recipient strain for transformation was used. Primer pairs that amplify DNA fragment of paromomycin-resistant gene were used. pSI103_F1: GATTCCCGTACCTCGTGTTG (5’ to 3’) and pSI103_R1: TCGTCCAGATCCTCCAAGTC (5’ to 3’). c Colony PCR of a transformant expressing an HA-tagged gene. Colony PCR was carried out with transformant (T) and recipient strain (N). Either EDTA or Chelex method was used for DNA extraction. Transforming plasmid was used as positive control (P). Primers used were: G13A5: CCCACCCTCTAAATTAGCC; JPKHA1: CCCACCCTCTAAATTAGCC; G13A10: AGTGAACCATTCATCCCG; HA-anti: ACTGCTAGCGGCGTAGTC (all 5’ to 3’). M: DNA marker. d Comparison of Chelex and direct boiling methods for colony PCR. Colonies from wild-type strain were used. Primers used were: sPrimer sense: CATGCAGGGCTTAACCCACG; sPrimer anti-sense: AGCAACGCCTGAACCGCAAA; IFT88primer sense: ATCGGATCCTTGCGTACCATACTTATC; IFT88primer anti-sense: TTCGAATTCAGCACTCCTCTTTGTATGC (all 5’ to 3’). N, negative control; G, purified genomic DNA; C, Chelex method; B, direct boiling method. M, DNA size marker

Next, we examined colony PCR method for screening of transformants with specific plasmid incorporation. pSI103 plasmid harbors the paromomycin-resistant gene, which was commonly used in insertional mutagenesis as well as in co-transformation as dominant selective marker (Sizova et al. 2001). pSI103 plasmid was transformed into Chlamydomonas with glass beads method (Kindle 1990) and transformants were initially screened on agar plates containing 10 μg/ml paromomycin. Colonies that grew on the plate were expected to have the paromomycin-resistant gene incorporated into the genome. Colony PCR with primers specific to the gene was performed. A total of ten randomly picked transformants, two previously confirmed positive transformants, and the wild-type strain were used for PCR. As expected, PCR products were obtained from the positive controls but not from the wild-type strain (Fig. 2b). All of the ten transformants also yielded expected PCR products.

We also examined transformants which expressed tagged genes. A transformant expressing HA-tagged CALK gene (Pan et al. 2004 and data not published) was used. The gene construct for the tagged gene was used as positive control and the wild-type strain as negative control. Three pairs of primers were employed to do colony PCR. Each pair contains one primer matching the HA tag sequence and another matching surrounding gene sequence. In each case, PCR products were obtained from positive control (construct) but not from the negative control with all three pairs of primers (Fig. 2c). For the transformant, expected PCR products were obtained with all three pairs of primers when template DNA isolated from Chelex method was used. However, PCR reactions with only one pair of primers produced expected PCR product when template DNA from EDTA method was used. In other experiments where we have performed colony PCR with both the EDTA and the Chelex methods, we found that the Chelex method is superior to the EDTA method. Successful PCR amplifications were obtained with the Chelex method from all seven pairs of primers that we have tested whereas with the EDTA method inconsistent PCR amplifications were from two pairs of primers and no PCR amplifications were from the rest of the five pairs of primers (data not shown). The failure or inconsistency of PCR amplification with the EDTA method is expected to be the result of a combination of various factors including EDTA interference, specific primer sequence, the GC content, and/or structure of the DNA fragments to be amplified. The major advantage of the Chelex method is that the chelating resin is removed after DNA extraction and no longer interferes with the subsequent PCR amplification. Furthermore, the cost by using Chelex method is minimal (less than one US cent per PCR reaction per our protocol). We noticed that a colony PCR method was reported earlier (Zamora et al. 2004), where Chlamydomonas colonies were boiled in water in a PCR tube followed by adding other PCR reaction components and cycling. We compared this method with our Chelex method using colonies from wild-type strain to amplify genomic DNA fragments. As shown in Fig. 2d, the Chelex method yielded expected PCR products for two pairs of primers tested, whereas the direct boiling method did not.

In summary, we have evaluated the colony PCR technique in Chlamydomonas and established a procedure for routine colony PCR. It could amplify genomic DNA fragments as well as DNA fragments from incorporated plasmid. This method makes it possible for rapid and simple screening of large number of transformants as well as rapid amplification of specific DNA fragments for gene cloning. The next breakthrough in colony PCR applications will be developing protocols for colony-based reverse-transcription PCR, which would allow rapid detection of transcripts from tiny amount of cells in large-scale screens.

Acknowledgements

We thank all other members of our laboratory for helpful discussion. This work is supported by the National Natural Science Foundation of China (#30671090, #30771084), National Basic Research Program of China (also called 973 program; no. 2007CB914401).

Copyright information

© Springer-Verlag 2009