Plant Reproduction

, Volume 26, Issue 3, pp 197–208

SGO1 but not SGO2 is required for maintenance of centromere cohesion in Arabidopsis thaliana meiosis

Authors

  • L. Zamariola
    • Department of Plant Production, Faculty of Bioscience EngineeringUniversity of Ghent
  • N. De Storme
    • Department of Plant Production, Faculty of Bioscience EngineeringUniversity of Ghent
  • CL. Tiang
    • Department of Plant Breeding and GeneticsCornell University
  • S. J. Armstrong
    • School of BioscienceUniversity of Birmingham
  • F. C. H. Franklin
    • School of BioscienceUniversity of Birmingham
    • Department of Plant Production, Faculty of Bioscience EngineeringUniversity of Ghent
Original Article

DOI: 10.1007/s00497-013-0231-x

Cite this article as:
Zamariola, L., De Storme, N., Tiang, C. et al. Plant Reprod (2013) 26: 197. doi:10.1007/s00497-013-0231-x

Abstract

Shugoshin is a protein conserved in eukaryotes and protects sister chromatid cohesion at centromeres in meiosis. In our study, we identified the homologs of SGO1 and SGO2 in Arabidopsis thaliana. We show that AtSGO1 is necessary for the maintenance of centromere cohesion in meiosis I since atsgo1 mutants display premature separation of sister chromatids starting from anaphase I. Furthermore, we show that the localization of the specific centromeric cohesin AtSYN1 is not affected in atsgo1, suggesting that SGO1 centromere cohesion maintenance is not mediated by protection of SYN1 from cleavage. Finally, we show that AtSGO2 is dispensable for both meiotic and mitotic cell progression in Arabidopsis.

Keywords

ArabidopsisMeiosisShugoshinCentromere cohesion

Introduction

In all eukaryotes, cell division is executed through two different processes: mitosis enables proliferation by generating cells with the same ploidy level, whereas meiosis performs a reduction in ploidy level to generate haploid daughter cells. Both mechanisms require one round of DNA replication during S-phase; however, in mitosis, the S-phase is followed by a single cell division that, from a diploid mother cell, creates two diploid daughter cells, whereas in meiosis, two successive cell divisions occur, meiosis I and meiosis II, which lead to the formation of haploid daughter cells. During the progression of mitosis and meiosis, sister chromatids must be held together to ensure timely segregation of chromatids to each daughter cell and to avoid missegregation and aneuploidy. Sister chromatids are held together by cohesins, a complex of proteins forming a ring-like structure encompassing the chromosomes. The complex comprises four subunits: Smc1 and Smc3 (structural maintenance of chromosomes), Scc3, and RAD21/Scc1, which is replaced by REC8 in meiosis (Nasmyth 2001; Watanabe 2005).

In mitosis, cohesins stabilize sister chromatids until anaphase when the subunit RAD21/Scc1 is cleaved by the cysteine-protease separase (Watanabe 2005). The mechanism differs between yeasts and vertebrates: in yeasts, cohesion is maintained both at chromosome arms and at centromeres until the onset of anaphase when it is removed by separase allowing sister chromatid separation, while in vertebrates, cohesion release follows a two-step process: it is first released at chromosome arms by phosphorylation of one of the subunits of Scc3 (SA2) by polo-kinase 1 (PLK1), a process called prophase pathway, and subsequently at centromeres by separase (Hauf et al. 2005).

In meiosis, cohesion is also released in two steps. During the first meiotic cell division, homologous chromosomes pair and recombine forming chiasmata and they are held together by cohesin complexes that are spread along the complete chromosome length. At anaphase I, cohesion is specifically released at the chromosome arms by separase activity allowing chiasmata to resolve. At this stage, however, cohesion is maintained at the centromeres by REC8-containing cohesin complexes in order to establish a physical connection between sister chromatids, required for the proper segregation of homologous chromosomes by monopolar attachment to the MI spindle microtubules. Next, after metaphase II, separase cleaves the remaining cohesins at the centromeres, leading to the separation of sister chromatids by bipolar attachment to MII spindles, eventually forming four haploid cells (Watanabe 2005; Gutiérrez-Caballero et al. 2012).

Shugoshin (Sgo) is highly conserved among eukaryotes (Kitajima et al. 2004), and it has a specific role in the protection of centromeric chromosome cohesion in both meiosis and mitosis (Clift and Marston 2011). It also covers additional functions in the regulation of kinetochore-microtubule attachment and in the sensing of kinetochore tension by interacting with members of the chromosomal passenger complex (CPC) and of the spindle assembly checkpoint (SAC) (Gutiérrez-Caballero et al. 2012). Sgo was first discovered in Drosophila melanogaster (Kerrebrock et al. 1992) and orthologs have been identified in yeasts, vertebrates, and plants. The Shugoshin family shares a basic region at the C-terminus of the protein, which has been found to be essential for centromere binding and chromosome localization, and a N-terminal common coiled-coil domain that may be regulating dimerization and interaction with other proteins (Tang et al. 1998). While Drosophila and Saccharomyces cerevisiae (budding yeast) have one copy of Shugoshin (Mei-S332 and Sgo1, respectively), other organisms such as Schizosaccharomyces pombe (fission yeast), plants, and vertebrates possess two copies (Sgo1 and Sgo2 in yeasts; SGO1 and SGO2 in plants; and SGOL1 and SGOL2 in vertebrates) that appear to exert different functions in meiosis and mitosis (Gutiérrez-Caballero et al. 2012).

In Drosophila, yeasts and plants, Sgo1 is responsible for the protection of centromere-specific sister chromatid cohesion in meiosis I, while in mammals SGOL2 performs the function of protector (Gutiérrez-Caballero et al. 2012). Sgo recruits protein phosphatase PP2A to the centromeres of chromosome pairs where it counteracts the phosphorylation of centromeric cohesins that prevent their cleavage by separase (Katis et al. 2004; Riedel et al. 2006; Katis et al. 2010). Centromere-specific localization of Shugoshin is controlled by Bub1, a component of the SAC, which phosphorylates a conserved residue of histone H2A at the centromeric chromosome region (Kawashima et al. 2010). Other mechanisms have been identified, which seem to act independently from Bub1 in Sgo centromere localization (Yamagishi et al. 2008; Perera and Taylor 2010). In developing meiocytes of fission yeast, Sgo1 is typically detected at the centromeres until anaphase I and afterward the protein is degraded by the anaphase promoting complex (APC) (Kitajima et al. 2004; Wang et al. 2011). However, in budding yeast, Drosophila, and vertebrates, Sgo still localizes at the centromeres in MII, until the onset of anaphase II even if it does not exert any function during the latter phases of meiosis (Katis et al. 2004; Kerrebrock et al. 1995). Studies in mouse and humans have suggested that tension between sister chromatids in meiosis II and mitosis is responsible for the inactivation of SGOL2, through a relocation of the protein away from cohesin. This mechanism explains the presence of Sgo in MII (Lee et al. 2008; Gómez et al. 2007).

The Sgo1 paralogue Sgo2 has been shown to possess different properties depending on the species examined. In fission yeast, Sgo2 plays a role in chromosome segregation in mitosis (Kitajima et al. 2004). Sgo2 controls the localization of the CPC, a protein complex that senses lack of tension between kinetochores and microtubules (Vanoosthuyse et al. 2007). The Sgo2 coiled-coil domain binds to the phosphorylated form of the Bir1/Survivin CPC-protein and promotes the localization of CPC to the centromeres (Kawashima et al. 2007; Tsukahara et al. 2010).

In humans, hSGOL2 is dispensable for sister chromatid cohesion in mitosis but is essential for correcting erroneous kinetochore attachments by recruiting the microtubule depolymerase MCAK to the centromeres (Huang et al. 2007), a role that is consistent with the one shown for fission yeast Sgo2 (Kawashima et al. 2007). On the contrary, the mouse Mm-SGOL2 is required for the protection of centromeric cohesin in meiosis while it is dispensable for maintaining cohesion between sister chromatids in mitosis (Lee et al. 2008). In addition, Sgo2 also plays a role in meiosis as Sgo2 deletion in fission yeast leads to a modest increase in non-disjunction of homologs at meiosis I (Kitajima et al. 2004).

Homologs of SGO1 have been recently identified in the monocotyledons. Similar to yeasts and vertebrates, functional genetics revealed that loss of ZmSGO1 and OsSGO1 causes meiotic chromosome missegregation due to a precocious separation of sister chromatids in meiosis I, supporting a role for plant SGO1s in the protection of centromere cohesion (Hamant et al. 2005; Wang et al. 2011). An additional role of Shugoshin has been demonstrated in rice where immunostaining showed that OsSGO1 localizes at the nucleolus at the beginning of meiosis and translocates to the centromeres at metaphase I, indicative of a role of OsSGO1 in the assembly and maintenance of the synaptonemal complex (SC) during early prophase I through indirect regulation of the SC transverse filament protein ZEP1 localization (Wang et al. 2011).

In maize, ZmSGO1 localizes to the centromeres in a REC8-dependent manner and protects REC8 from cleavage. Strikingly, the rice REC8 homolog OsREC8 and the Arabidopsis homolog AtSYN1/AtREC8 do not show centromere-specific localization in metaphase I and anaphase I (Cai et al. 2003; Chelysheva et al. 2005; Shao et al. 2011). It therefore remains unclear how OsREC8 and AtSYN1/AtREC8 maintain MI centromeric sister chromatid cohesion.

Here, we show the identification of the homologous proteins of SGO1 and SGO2 in the dicotyledon Arabidopsis thaliana. We demonstrate that AtSGO1 is required for the maintenance of centromeric cohesion of sister chromatids in meiosis I, but not through the control of AtSYN1/AtREC8 localization. Furthermore, we show that AtSGO2 is dispensable for meiosis.

Materials and methods

Plant materials and growth conditions

Arabidopsis thaliana seeds were initially germinated in vitro on K1 medium for 7 days at 20 °C with a photoperiod of 16 h day/8 h night and 70 % humidity. Then, seedlings were transferred to soil and cultivated in controlled climate chambers with the same conditions of temperature, photoperiod, and humidity.

The atsgo12 (SK2556) and the atsgo21 (SALK_026139) were obtained from the European Arabidopsis Stock Centre, while the atsgo1–1 (SK35523) was acquired from the Saskatoon T-DNA seed collection. Homozygous plants were genotyped by PCR using two PCR primer pairs, one specific to the wt allele and the other to the T-DNA insertion. atsgo1–1: AtSGO1 start F (5′GTTCGAGCGACGGTTCTGAAT3′) and AtSGO1 R (5′GCCAAGATACGAGTGTTAGCCTG3′); AtSGO1 start F and bar gene R (5′TGCACCATCGTCAACCACTACAT3′). atsgo12: SK2556 RP (5′CTCAAGAACCTGAGCCATCTG3′) and SK2556 LP (5′CTCATTTCCTCTGATTCGTCG3′); SK2556 LP and bar gene R. atsgo21: SALK_026139 RP (5′TCTAATCAGATGTGAACCGGG3′) and SALK_026139 LP (5′TTGTATTGAGTTCCTGGCAGG3′); SALK_026139 RP and LBb1.3 (5′ATTTTGCCGATTTCGGAAC3′). PCR conditions were 35 cycles of 30″ at 95 °C, 30″ at 55 °C, and 1′ at 72 °C for atsgo1–1, atsgo12 wt genotyping and atsgo21 wt and T-DNA genotyping, while for atsgo1–1 and atsgo12 T-DNA genotyping, the elongation was 2′30″ at 72 °C.

PCR products were sequenced to confirm the position of the T-DNA insertion.

The pWOX2::CENH3-GFP-expressing line was constructed using the Multisite-Gateway cloning system according to the manufacturer’s instructions (Invitrogen) (De Storme and Geelen 2011). The verified plasmid was transformed into Agrobacterium tumefaciens strain GV3130 and used to generate transgenic Arabidopsis Col-0 lines by floral dip. Single T-DNA-carrying transgenic progeny plants were selected based on segregation for kanamycin resistance and stable GFP expression following fluorescence analysis. Selection of single locus transformants was made by selecting 3:1 segregants in T1.

qRT-PCR

Arabidopsis total RNA was extracted from flower buds using the RNeasy Plant Mini Kit with an additional on-column DNase treatment (QIAGEN). First-strand cDNA synthesis was performed using the RevertAid H Minus cDNA Synthesis Kit (Thermo Scientific). Gene expression analysis was performed by qRT-PCR on a Stratagene MX3000 real-time PCR system using SYBR Green Master Mix. Specific primer pairs were used to monitor the expression of AtSGO1 and AtSGO2. AtSGO1: AtSGO1 start F and AtSGO1 start R, AtSGO1 middle F (5′GAAGGTACTTCAGCACGAACTTG3′) and AtSGO1 middle R (5′CTTAATTTCTTTGGCGTCAACCAC3′), AtSGO1 C-term F (5′TGCTGTGCAAGTGAACAGTCT3′) and AtSGO1 C-term R (5′CCTCGCATCTTCTCCTTAAGTGA3′). AtSGO2: AtSGO2 start F (5′GTGCTAACTGAAATGAGCCTTG3′) and AtSGO2 start R (5′AGTAAAGCATTCTTGCAGCCA3′), AtSGO2 end F (5′CTTCTCTTTGAGAAGACGGTCTG3′) and AtSGO2 end R (5′GATTCCGATCTTGATCCAGCAG3′). Actin 2/7 (At5g09810) was used as housekeeping gene: Actin 2/7 F (5′CTGCCGCTGTTGTTTCTCCT3′), Actin 2/7 R (5′CGTTGTAGAAAGTGTGATGCCA3′). qRT-PCR conditions were: 40 cycles of 30″ at 95 °C, 30″ at 55 °C, and 30″ at 72 °C. Three technical replicates of one biological repeat were performed. Statistical analysis was performed on the relative expression levels using one-way ANOVA (P < 0.05).

Phenotypic analysis

For pollen analysis, 10 mature flowers were submerged in 0.5 M EDTA (pH 8) and shaken for 5 min by vortexing. After removing the flower material, the pollen suspension was analyzed volumetrically using a cell-counter (Multisizer 3, Coulter Counter). Pollen was also analyzed two-dimensionally by squashing on a slide a mature flower in one drop of EDTA; observations were made with a bright-field microscope.

For the analysis of meiotic products, immature flower buds were squashed in a solution of 45 % lacto-propionic orcein stain and tetrads were observed with a bright-field microscope.

Meiotic chromosome preparation and FISH

Chromosome spreads were performed as described previously (Armstrong et al. 2009), and slides were stained with 10 μl of a 2 μg ml−1 solution of DAPI in Vectashield antifade mounting medium (Vector Laboratories).

FISH was carried out using the protocol described by Armstrong et al. (2009) using the pAL38 pericentromeric probe linked to FITC antibodies.

Immunofluorescence

The SYN1 antibody was synthesized by Tiang (2010). Immunofluorescence was carried out using the microwave technique described by Chelysheva et al. (2010). The SYN1 primary antibody from rabbit was diluted 1:1,000 in EM block solution (0.1 g BSA, 10 ml PBS buffer, filter through a 0.2-μm filter), and it was detected with FITC-conjugated goat anti-rabbit antibody (dilution 1:200). The chromosomes were counterstained with DAPI.

For ZYP1 immunolocalization, we used the protocol described by Armstrong et al. (2009).

Microscopy

Slides were observed using an Olympus IX81 inverted fluorescence microscope equipped with an X-Cite Series 120Q UV lamp and an Olympus XM10 camera.

Results

Identification of atsgo1 and atsgo2 mutants

In Arabidopsis, two Shugoshin-like genes have been identified by sequence comparison of conserved N-terminus and C-terminus domains (Rabitsch et al. 2004). To unravel the function of the Arabidopsis Shugoshin homologs, mutants for At3g10440, AtSGO1, and At5g04320, AtSGO2, were selected from the public T-DNA insertion line collections. atsgo1–1 (SK35523) and atsgo12 (SK2556) insertions are in the Columbia (Col-0) background and are located in the first intron and in the fifteenth exon, respectively. The atsgo21 insertion (SALK_026139) is also in the Col-0 background and it is located in the 5′ UTR region (Supplemental Fig. 1).

To identify whether these lines generate full-length SGO transcripts, qRT-PCR was performed using different primer pairs covering the entire genes sequences using cDNA from flower buds of atsgo1–1, atsgo12, and atsgo21 as template. For atsgo1–1, no AtSGO1 expression was detected in the 5′ region of the gene while in the middle wt levels of expression were detected (Supplemental Fig. 2a, b). In the 3′ region, a higher level of AtSGO1 expression than in wt was observed (Supplemental Fig. 2c). atsgo12 showed wt AtSGO1 expression level in the 5′ and in the middle region, but no expression was detected at the end of the gene (Supplemental Fig. 2a–c). The data indicate that the two alleles are not null.

qRT-PCR analysis of the atsgo21 mutant showed a decrease in AtSGO2 expression levels with both primer pairs tested in the 5′ and 3′ regions, but significant residual expression was still present at the 3′ end, indicating that the atsgo12 mutant is not necessarily null (Supplemental Fig. 3a, b).

We also checked the relative expression levels of AtSGO1 in atsgo21 mutant and of AtSGO2 in atsgo1–1 and atsgo12 mutants in order to evaluate whether mutation(s) in one gene are compensated by overexpression of the homolog gene. The results showed that AtSGO1 is expressed at wt levels in the atsgo2 mutant (Supplemental Fig. 2a–c). Also, AtSGO2 expression levels in atsgo1–1 and atsgo12 mutants were similar to wt.

atsgo1 shows meiotic defects while atsgo2 behaves like wt

To monitor putative defects in meiotic cell division, we first checked the volumetric distribution of pollen grains in atsgo1–1, atsgo12, and atsgo21 using the cell-counting device Multisizer 3 (www.beckmancoulter.com). In Col-0 wt, pollen grains have an average diameter of 20.8 ± 0.5 μm with a distribution ranging from 18 to 23 μm (Fig. 1a). atsgo21 pollen size was highly similar to wt (Fig. 1b). In contrast, for both atsgo1 mutants, we detected a different pollen size distribution profile showing a large number of smaller pollen grains having a diameter of 8–15 μm and some larger pollen grains (24–30 μm) (Fig. 1c, d). atsgo1 pollen was analyzed by two-dimensional microscopy. We detected normal pollen (Fig. 1e), large pollen grains (Fig. 1f), and aborted pollen, corresponding to the size of the small pollen grains detected with Multisizer analysis (Fig. 1g).
https://static-content.springer.com/image/art%3A10.1007%2Fs00497-013-0231-x/MediaObjects/497_2013_231_Fig1_HTML.gif
Fig. 1

Pollen distribution of a Col-0 wt, batsgo21, catsgo1–1, datsgo12 analyzed with Multisizer 3, Coulter Counter. Microscopic visualization of pollen grains in atsgo1 showing a normal haploid pollen grain (e), a larger pollen grain (f), and an aborted pollen grain (g). Scale bar 10 μm

Because some pollen grains were larger, we anticipated an increase in DNA content and therefore determined the chromosome number by introducing the centromeric marker pWOX2::CENH3-GFP into atsgo12. Wt microspores contained mostly five centromeric dots, corresponding to the haploid chromosome set in Arabidopsis (71.4 %, n = 175) (Fig. 2a, b). In addition, we occasionally observed microspores with three or four dots (2.9 and 25.1 %, respectively), most likely due to centromere overlap (Fig. 2e, f). In contrast, in the atsgo12 mutant, we detected the normal chromosome number in only about one-third of the microspores (33.3 %, n = 222), while the majority had aneuploid chromosome numbers ranging between 2 and 8 (Fig. 3c, d, g, h, i).
https://static-content.springer.com/image/art%3A10.1007%2Fs00497-013-0231-x/MediaObjects/497_2013_231_Fig2_HTML.gif
Fig. 2

Microspores expressing pWOX2::CENH3-GFP from Col-0 wt and atsgo12 plants showing 5 (b), 4 (d), 6 (f), and 8 (h) centromeric dots, respectively. In a, c, e, g, the respective pictures in bright field are shown. Scale bar 10 μm. i Graphical representation of the analysis of the number of centromeric dots counted in wt and atsgo12 plants. n = 175 for Col-0 wt and n = 222 for atsgo12

https://static-content.springer.com/image/art%3A10.1007%2Fs00497-013-0231-x/MediaObjects/497_2013_231_Fig3_HTML.gif
Fig. 3

Analysis of the meiotic products in Col-0 wt, atsgo11, atsgo12, and atsgo21. Photos showing a a tetrad, b an unbalanced tetrad, c a polyad, and d a dyad, e quantification of meiotic products in Col-0 (n = 133), atsgo21 (n = 164), atsgo1–1 (n = 465), and atsgo12 (n = 574). Scale bar 10 μm

To monitor atsgo1 and atsgo2 meiosis, we investigated the end products of male meiosis in the corresponding mutants. In wt plants, male meiosis ends with the formation of four haploid cells organized in a tetrahedral structure, called a tetrad. In line with this, in Col-0 wt, we detected 100 % normal tetrads (n = 218) and the same was observed for atsgo2 (n = 268), as expected based on normal pollen size distribution. In contrast, atsgo1–1 and atsgo12 produced only 78.7 and 57.5 %, normal tetrads, respectively (n = 465 for atsgo1–1, n = 574 for atsgo12), and significant numbers of unbalanced tetrads and polyads (13.8 % of unbalanced tetrads and 6.4 % of polyads were observed for atsgo1–1, while 24.4 and 17.2 % of unbalanced tetrads and polyads were observed for atsgo12) (Fig. 3a–e).

atsgo1–1 and atsgo12 did not show any defects in vegetative development or growth, but they showed a significant decrease in silique length suggesting reduced seed set (Fig. 4a). To quantify seed set, we counted the seeds of at least 20 siliques per genotype and found a significant decrease in the number of seeds per silique in atsgo1–1 (24.3 ± 4.4) and atsgo12 (21.6 ± 6.4) compared to wt (45.9 ± 8.7) and atsgo21 (48.4 ± 8.2). We pollinated at least 10 stigmas of atsgo1–1 and atsgo12 with wt pollen and we obtained 24.8 ± 6.8 and 9.9 ± 6.0 seeds per silique for atsgo1–1 and atsgo12, respectively. These results indicate that in atsgo1, the reduction in seed set depends on female sterility.
https://static-content.springer.com/image/art%3A10.1007%2Fs00497-013-0231-x/MediaObjects/497_2013_231_Fig4_HTML.jpg
Fig. 4

a Phenotype of mature plants (siliques) of Col-0 wt, atsgo21, atsgo11, and atsgo12. Scale bar 1 mm

From the analysis of male meiosis, through tetrad counting, and female meiosis, by crosses with wt pollen, we can conclude that the atsgo1–1 allele is weaker than atsgo12.

The atsgo1 mutant shows premature separation of sister chromatids before meiosis II

To determine the cellular defect(s) causing the formation of atsgo1 unbalanced tetrads and polyads, we investigated meiosis in pollen mother cells (PMCs) of wt and atsgo1 mutants. In wt plants, homologous chromosomes fully synapse at pachytene and form five condensed bivalents at diplotene, which subsequently align and separate at metaphase I and anaphase I, respectively (Fig. 5a–d). As a result, at prometaphase II, two distinct groups of 5 chromosomes can be detected on opposite sides of the organelle band (Fig. 5e). Afterward, the two sets of 5 chromosomes align in metaphase II and separate in anaphase II, generating four haploid cells that contain 5 chromosomes each (Fig. 5f–h). Meiotic spread analysis of atsgo21 flowers showed no deviations from the wt chromosomal configuration (Fig. 5i–p). Meiosis in atsgo12 proceeded normally until the onset of anaphase I. Chromosomes fully synapsed during pachytene, chiasmata were observed in diakinesis, and bivalents properly aligned in metaphase I (Fig. 5q–s). At anaphase I, however, while homologous chromosomes were separating, chromatids were detected in atsgo1, indicating a premature loss of sister chromatids connection (Fig. 5t, arrow). In support of this, at prometaphase II, atsgo1 PMCs typically showed more than 10 chromosomes (67.5 %, n = 40), indicative of a premature separation of sister chromatids before the onset of meiosis II (Fig. 5u). Then, in metaphase II, sister chromatids failed to properly align (Fig. 5v; 96.7 %, n = 61) showing two sets of 10 scattered chromosomes that randomly segregated at anaphase II (Fig. 5w). As a consequence, atsgo1 meiocytes formed unbalanced spores at the end of male meiosis II (Fig. 5x). Similar observations were obtained for atsgo1–1 (data not shown).
https://static-content.springer.com/image/art%3A10.1007%2Fs00497-013-0231-x/MediaObjects/497_2013_231_Fig5_HTML.jpg
Fig. 5

Meiotic spreads of wt (ah), atsgo21 (i-p), and atsgo12 (qx). Pachytene (a, i, q), diakinesis (b, j, r), metaphase I (c, k, s), anaphase I (d, l, t), prometaphase II (e, m, u), metaphase II (f, n, v), anaphase II (g, o, w), tetrad stage (h, p, x). Arrow in t indicates premature splitting of sister chromatids at anaphase I in atsgo1 mutant. Numbers in e, m, u indicate the number of chromosomes counted at each side of the organelle band. Scale bar 10 μm

AtSGO1 protects centromeric cohesion during meiosis

To investigate the premature loss of sister centromere cohesion, we performed fluorescence in situ hybridizations (FISH) on meiocytes using the probe pAL38 that hybridizes to peri-centromeric regions of the Col-0 chromosomes. In wt nuclei, we observed 5 centromeric FISH signals at pachytene, and 10 signals at diakinesis and metaphase I (Fig. 6a–c). Next, homologous chromosomes segregated at anaphase I giving 5 FISH signals in each polar chromosome group at prometaphase II (anaphase I 100 %, n = 2; prometaphase II 100 %, n = 18) and then sister chromatids aligned at metaphase II, in which 20 centromeres were detected (Fig. 6d–f). Finally, at anaphase II, sister chromatids separated equally, creating four haploid cells that contained 5 centromeric FISH signals each (Fig. 6g). A similar centromeric localization pattern was observed in atsgo21 meiotic cells (Supplemental Fig. 4).
https://static-content.springer.com/image/art%3A10.1007%2Fs00497-013-0231-x/MediaObjects/497_2013_231_Fig6_HTML.jpg
Fig. 6

FISH on Col-0 wt (ag) and atsgo12 (hn) meiocytes. Green dots represent the pAL centromeric signal. Pachytene (a, a′, h, h′), diakinesis (b, b′, i, i′), metaphase I (c, c′, j, j′), anaphase I (d, d′, k, k′), prometaphase II (e, e′, l, l), metaphase II (f, f′, m, m′), tetrad stage (g, g′, n, n′). Numbers in d, e, k, and l indicate the number of FISH signals observed on each side of the equatorial plate. Numbers in g and n indicate the number of centromeric signals counted in each spore. Scale bar 10 μm

By analyzing meiotic centromere localization in atsgo12, we found that centromeres showed a similar behavior to that of wt until metaphase I (Fig. 6h–j), but at anaphase I (50 %, n = 2; Fig. 6k) and prometaphase II (100 %, n = 9; Fig. 6l), we observed more than 10 centromeric signals, in support of premature detachment of sister chromatids before metaphase II. In the final stages of atsgo12 meiosis II, the total number of centromeres was 20 as in the wt; however, these were incorrectly segregated and generated unbalanced sets of centromeric dots at the end of MII (Fig. 6m, n). Therefore, AtSGO1 is essential for centromeric cohesion of sister chromatids in Arabidopsis meiosis I.

SYN1 and ZYP1 localization are not affected in atsgo1

It has been shown in different species that Shugoshin protects the cohesin REC8 from proteolytic cleavage by separase at the centromeres during meiosis I (Clift and Marston 2011). In Arabidopsis, the REC8 homolog SYN1 localizes along the whole chromosome length at pachytene and diakinesis, whereas it specifically localizes on chromosome arms, but not at centromeres, at metaphase I and anaphase I (Cai et al. 2003). After anaphase I, the signal fully disappears (Cai et al. 2003). To test whether loss of Shugoshin affects SYN1 localization, we performed immunolocalization experiments on Col-0, atsgo21, and atsgo12 meiocytes. In Col-0 wt meiocytes, SYN1 was detected along the entire chromosomes at pachytene (Fig. 7a, b), and the signal persisted up until diakinesis (Fig. 7c, d). At metaphase I, the signal was only detected on chromosome arms but not at centromeres (Fig. 7e, f; arrows indicate the position of centromeres) and from prometaphase II, the signal was not detected anymore (Fig. 7g, h).
https://static-content.springer.com/image/art%3A10.1007%2Fs00497-013-0231-x/MediaObjects/497_2013_231_Fig7_HTML.jpg
Fig. 7

SYN1 immunolocalization in Col-0 wt (ah), atsgo21 (jq), and atsgo12 (ry) meiocytes. Pachytene (a, b, j, k, r, s), diakinesis (c, d, l, m, t, u), metaphase I (e, f, n, o, v, w), prometaphase II (g, h, p, q, x, y). On the left panels are shown chromosomes stained with DAPI, while on the right panels, SYN1 signal is shown in green. Arrows in e and f indicate the position of the centromeres. Scale bar 10 μm

The mutants atsgo21 (Fig. 7j–q) and atsgo12 (Fig. 7r–y) displayed a similar SYN1 localization pattern as observed in the wt indicating that the SGO1 centromere cohesion maintenance in meiosis I is not mediated via protection of SYN1 from cleavage.

In rice, OsSGO1 has been shown to act in the maintenance of a stable SC, since homologous chromosomes prematurely separate in Ossgo1 meiocytes at pachytene due to mislocalization of ZEP1 (Wang et al. 2011). From meiotic spreads on atsgo1 meiocytes, pachytene proceeded normally (Fig. 5q). To confirm the absence of defects in the stabilization of the SC, we performed ZYP1 (the Arabidopsis SC transverse filament protein) immunolocalization on chromosome spread preparation of atsgo12 meiocytes at pachytene. A linear ZYP1 signal along the length of the synapsed homologs was observed in the mutant that was indistinguishable from the wt control. We did not detect mislocalization of ZYP1 at pachytene (Supplemental Fig. 5), suggesting that SGO1 is not required for SC maintenance in Arabidopsis.

Discussion

SGO1 acts as centromeric cohesion protector in A. thaliana meiosis

Arabidopsis SGO1 and SGO2 share homology with proteins from the Shugoshin family based on the presence of a tripartite structural architecture that comprises a conserved coiled-coil region at the N-terminus, a central part with preferentially charged, hydroxylated, and rare hydrophobic residues, and a basic domain at the C-terminus of the sequence (Rabitsch et al. 2004). While in Drosophila and in budding yeast, only one Shugoshin protein is present, fission yeast, vertebrates, and plants possess two Shugoshin copies, SGO1 and SGO2, with different functions. In yeasts, SGO1 is responsible for protecting centromeric cohesion during meiosis (Kawashima et al. 2007). Localization studies in S. pombe have demonstrated that Shugoshin 1 is present at centromeres during meiosis I and specifically inhibits cleavage of the α-kleisin subunit REC8 by separase (Watanabe and Kitajima 2003, 2005). Recently, orthologs of Shugoshin 1 have been identified in rice and maize. Both ZmSGO1 and OsSGO1 protect cohesion of sister chromatids at the centromeres in meiosis I and localize at centromeres until anaphase I (Wang et al. 2011; Hamant et al. 2005).

Our findings show that Shugoshin 1 is also required for the maintenance of centromeric cohesion in meiosis I in A. thaliana as disruption of AtSGO1 provokes precocious separation of sister chromatids before the onset of telophase I. Immunolocalization of AtSGO1 in Col-0 wt meiocytes using the OsSGO1 antibody synthesized by Wang et al. (2011) did not produce a signal (data not shown), indicating that the antibody designed to detect OsSGO1 might not share enough homology with AtSGO1 to allow its localization.

Studies in rice have revealed an additional role for OsSGO1 in meiotic prophase I. In fact, loss of OsSGO1 was found to induce premature separation of homologous chromosomes together with a premature dissociation of ZEP1 during late pachytene (Wang et al. 2011) indicating that OsSGO1 is required for the maintenance of the SC in early prophase I. The localization pattern of ZYP1 in Arabidopsis wt is similar to that of ZEP1, first appearing as punctuate foci during leptotene and gradually aligning along the entire chromosomes until late pachytene (Higgins et al. 2005). In the atsgo12 mutant, we detected no abnormalities in the synapsis of homologous chromosomes during pachytene and we observed a normal localization of ZYP1 during pachytene, indicating that SGO1 in Arabidopsis is not essential for the establishment and/or maintenance of the SC.

The study of different alleles of the Drosophila Sgo ortholog, i.e., Mei-S332, has highlighted separate functions for the N- and C-terminus protein domains (Kerrebrock et al. 1995). In particular, the N-terminus seems to be required for homodimerization of the protein and PP2A binding through the formation of a coiled-coil structure (Xu et al. 2009), whereas the C-terminus mediates centromere-specific protein localization. Furthermore, genetic analysis has shown that mutations in the N-terminus coiled-coil domain affect more severely chromosome segregation in male than in females while mutations in the basic C-terminus region only cause a limited chromosome missegregation in the males (Tang et al. 1998).

The two Arabidopsis SGO1 alleles identified in our study are not completely null as we observe remaining expression level with qRT-PCR. In the atsgo1–1, mutant part of the conserved 5′ region (corresponding to aa 106–122, Rabitsch et al. 2004) has not a detectable expression level but the remaining part (corresponding to aa 122–162) together with the 3′ terminus are expressed. In contrast, in atsgo12, the 5′ domain is expressed but no level of expression is detected at the 3′ terminus. Our results show a less severe phenotype for the atsgo1–1 allele, both in male and female meiosis, which is probably due to residual expression of part of the 5′ and of the 3′ terminus region. On the contrary, in atsgo12, we observe an aggravation of the defects in male and in female meiosis compared to atsgo1–1, possibly due to the complete loss of the 3′ terminus part of the transcript. However, we have no proof of the presence of partial AtSGO1 translation products.

SGO2 is not essential for meiosis

In fission, yeast Sgo2 is ubiquitously expressed in meiosis and mitosis and sgo2 knockout shows a slight decrease in mitotic chromosome segregation fidelity and a small increase in non-disjunction of homologous chromosomes during meiosis I. This indicates that Sgo2 has a role in meiosis, which is different from that of Sgo1, since sgo1 does not display evident defects at meiosis I and sgo1 sgo2 double mutants do not show enhanced defects compared to the single mutants (Kitajima et al. 2004). Furthermore, Sgo2 has a role in sensing tension-spindle checkpoint and works together with Bub1 to ensure chromosome segregation in mitosis (Kitajima et al. 2004). In budding yeast, Shugoshin exerts both functions of centromere protector and tension-sensing spindle checkpoint to promote bi-orientation of mitotic chromosomes (Indjeian et al. 2005). So it is possible that the two functions were split during evolution in fission yeast that carries two Shugoshin genes, Sgo1 and Sgo2 (Watanabe 2005). A study conducted on S. pombe reveals two distinct roles for Sgo1 and Sgo2 in meiosis, whereby Sgo1 is required for faithful disjunction of sister chromatids at meiosis II and to preserve sister chromatids linkage between meiosis I and meiosis II, while Sgo2 is required to regulate kinetochore orientation of homologous chromosomes at meiosis I (Rabitsch et al. 2004). In line with this, double sgo1 sgo2 S. pombe mutants show both a high number of premature sister chromatids disjunction at meiosis I and defects in chromosome orientation at meiosis I (Rabitsch et al. 2004). Besides its role in tension-sensing and kinetochore orientation, Sgo2 has been shown to interact with the CPC directly or indirectly for the targeting of the passenger proteins to the centromere, suggesting that Sgo2 regulates distinct processes including cohesion, kinetochore bi-orientation, and microtubule dynamics (Vanoosthuyse et al. 2007; Gutiérrez-Caballero et al. 2012).

Our work did not find any meiotic or vegetative phenotype in atsgo2 indicating that AtSGO2 is dispensable for both meiotic and mitotic cell cycle progression in Arabidopsis. However, the expression of AtSGO1 in the atsgo21 mutant showed a tendency to be higher than in the wt, which could indicate that AtSGO2 loss is compensated by overexpression of AtSGO1. The creation of a double mutant sgo1/sgo2 could help unraveling AtSGO2’s function in Arabidopsis.

SYN1 localization is not affected in atsgo1 meiosis

In all eukaryotes, REC8 is the cohesin’s α-kleisin subunit responsible for sister chromatid cohesion in meiosis. Studies performed in yeasts and vertebrates have demonstrated that Shugoshin plays a role in the protection of REC8 cohesin at the centromeres from cleavage by separase in meiosis I, more specifically by counteracting kinase-mediated REC8 phosphorylation through the recruitment of PP2A phosphatase to the centromere (Katis et al. 2010; Xu et al. 2009). REC8 depletion typically results in premature release of chromosome cohesion before metaphase I, leading to the formation of univalents and chromosome fragmentation (Klein et al. 1999; Pasierbek et al. 2001). In Arabidopsis, the homolog of yeast REC8 has been identified and studied by different groups and has been given different names: SYN1, DIF1, and AtREC8 (Bai et al. 1999; Bhatt et al. 1999; Chelysheva et al. 2005). Cytological analysis of atrec8 meiosis has revealed univalents at metaphase I together with the presence of chromosome fragmentation, which could be restored by introducing the atspo11–1 mutation, indicating that chromosome fragmentation in atrec8 is DSB-dependent. Chelysheva et al. (2005) demonstrated that AtREC8 is necessary for the maintenance of centromeric cohesion in meiosis I but not for the maintenance of complete sister chromatids cohesion until anaphase I, suggesting that additional cohesins are involved in keeping sister chromatids together before anaphase I. Three additional members of the Scc1-REC8 family, such as SYN2, SYN3 and SYN4, have been identified in Arabidopsis and putatively they could be responsible for maintaining sister chromatid cohesion until anaphase I (Dong et al. 2001).

In our study, we used a specific antibody raised against SYN1 in Arabidopsis male meiocytes and show that SYN1 localizes to the chromosome axes from early prophase until late metaphase I. Strikingly, in contrast to its presumed function, we found that AtSYN1 antibodies do not stain centromeres after prometaphase I but instead only label chromosome arm axes, suggesting that the cohesin subunit SYN1 is not present at centromeres in meiosis I. In support of this, several other groups have also found an absence of AtREC8 at the meiotic centromeres (Cai et al. 2003; Chelysheva et al. 2005, 2010). To explain the absence of signal after prometaphase despite AtSYN1 function in the maintenance of centromere cohesion at anaphase I, it has been suggested that the absence of centromeric SYN1 immunolabeling signals might be due to the inability of the antibody to access the centromeric structure rather than to the absence of SYN1 at centromeres (Cai et al. 2003; Chelysheva et al. 2005). However, in vertebrates, this problem seems not to occur and REC8 has been localized at centromeres until the onset of anaphase II (Gómez et al. 2007; Lee and Okada 2006).

Localization experiments in yeasts demonstrated that Shugoshin localizes first at the centromere at late prophase (Kitajima et al. 2004), whereas in rice Shugoshin is recruited on centromeres already at leptotene and stays on the chromosomes until anaphase I (Wang et al. 2011). In our experiment, we could not detect differences in SYN1 localization during meiotic prometaphase I between wt and atsgo1, similar to rice (Wang et al. 2011). Taken together, the data depict two hypotheses: either AtSGO1 is not protecting SYN1 at the centromeres but one of the others cohesins, or the localization of SYN1 in atsgo1 is affected after prometaphase I but at stages where we cannot localize it.

In conclusion, our work shows that AtSGO1 protects sister chromatid centromere cohesion in meiosis I in Arabidopsis but not through the protection of the cohesin SYN1. Moreover, we show that AtSGO2 is dispensable for both meiosis and mitosis in Arabidopsis.

Acknowledgments

We are grateful to the EMBO Short-Term Fellowship and STSM COST Action FA0903. Work in Sue Armstrong’s laboratory is funded from the European Community’s Seventh Framework Programme FP7/2007-2013 under grant agreement number KBBE-2009-222883. We thank Steve Price for his technical support.

Supplementary material

497_2013_231_MOESM1_ESM.doc (28 kb)
Supplementary material 1 (DOC 27 kb)
497_2013_231_MOESM2_ESM.pptx (1.3 mb)
Supplementary material 2 (PPTX 1339 kb)

Copyright information

© Springer-Verlag Berlin Heidelberg 2013