European Journal of Pediatrics

, Volume 164, Issue 7, pp 427–431

Differential gene expression of S100 protein family in leukocytes from patients with Kawasaki disease

Authors

  • Takashi Ebihara
    • Department of PaediatricsHokkaido University Graduate School of Medicine
  • Rika Endo
    • Department of PaediatricsHokkaido University Graduate School of Medicine
    • Department of PaediatricsHokkaido University Graduate School of Medicine
  • Nobuhisa Ishiguro
    • Department of PaediatricsHokkaido University Graduate School of Medicine
  • Xiaoming Ma
    • Department of PaediatricsHokkaido University Graduate School of Medicine
  • Mitsunobu Shimazu
    • Department of Infectious DiseasesMitsubishi Kagaku Bio-Clinical Laboratories Inc.
  • Takao Otoguro
    • Department of Infectious DiseasesMitsubishi Kagaku Bio-Clinical Laboratories Inc.
  • Kunihiko Kobayashi
    • Department of PaediatricsHokkaido University Graduate School of Medicine
Original Paper

DOI: 10.1007/s00431-005-1664-5

Cite this article as:
Ebihara, T., Endo, R., Kikuta, H. et al. Eur J Pediatr (2005) 164: 427. doi:10.1007/s00431-005-1664-5

Abstract

S100 family proteins are calcium-binding proteins, some of which have been shown to have intracellular and extracellular functions associated with inflammation. The serum concentration of S100A12 has been reported to increase in the acute phase of Kawasaki disease. The purpose of this study was to evaluate leukocyte gene expressions of S100 family proteins in the acute phase of Kawasaki disease. Ten paired blood samples were obtained from ten patients with Kawasaki disease in the acute phase and in the convalescent phase. We examined leukocyte expression levels of 18 S100 genes in the acute phase compared with those in the convalescent phase by using quantitative real-time polymerase chain reaction. Significantly elevated expression of seven S100 genes (S100A6, A8, A9, A11, A12, S100P, and S100Z) was observed in the acute phase. Conclusion:Of the upregulated S100 genes, calgranulin members of S100 genes (S100A8, S100A9, and S100A12) were most highly expressed in the acute phase. Only one S100 gene, the S100A13 gene, exhibited a significantly decreased expression level in the acute phase.

Keywords

CalgranulinKawasaki diseaseLeukocyte gene expressionReal-time polymerase chain reactionS100 protein

Abbreviations

IVIG

intravenous immunoglobulin

KD

Kawasaki disease

RAGE

the multiligand receptor for advanced glycation end products

Introduction

Kawasaki disease (KD) is an acute multisystem vasculitis that occurs in children usually under 5 years of age. This disease is associated with a range of complications, including life-threatening coronary artery abnormalities. KD is a major cause of acquired heart disease in children in the developed world. Although it has been shown that coronary complications can be significantly reduced by the use of high-dose intravenous immunoglobulin (IVIG) therapy combined with oral acetylsalicylic acid, the aetiology of KD is still unknown [13].

S100 proteins are characterised by two distinct EF-hand motifs displaying different affinities for calcium. An EF hand comprises a Ca2+ binding loop which connects two helices, helices E and F. Of the S100 family of proteins, 23 members have been described [2, 3, 15, 16,26]. S100 proteins are mainly localised in the cytosol, some of which have been shown to translocate from the cytosol to the membrane and cytoskeletal structures with elevations of intracellular calcium concentration [2,3]. Intracellular S100 proteins are key molecules in the transduction of calcium signalling and are involved in enzyme activity, dynamics of cytoskeleton constituents, cell growth and cell differentiation [2,3]. There have been many reports of intracellular functions unassociated with inflammation and a few reports of intracellular functions associated with inflammation. One study has shown that intracellular S100A10 acquires anti-inflammatory activity by binding cytosolic phospholipase A2, resulting in decreased release of arachidonic acid from cells [27].

Most S100 proteins are released into the extracellular space [2,3]. Extracellular functions of S100 proteins have been mainly described in the context of regulatory effects on inflammatory cells, including chemotactic effects and pro-inflammatory effects via the multiligand receptor for advanced glycation end products (RAGE) [9, 17, 20, 22,23]. RAGE is expressed on leukocytes and endothelial cells and has been suggested to be a receptor for S100A12, S100B, S100P and possibly also S100A8 and S100A9 [1, 2,22]. Among these S100 proteins, activation of leukocytes and endothelial cells through RAGE by extracellular S100A12 has been shown to induce secretion of pro-inflammatory cytokines and intercellular adhesion molecules on the surfaces of leukocytes and endothelial cells, which promote adhesion of leukocytes to endothelial cells [9,22]. These extracellular functions of S100A12 via RAGE seem to be involved in the development of vasculitis.

Among the members of the S100 protein family, S100A8, S100A9 and S100A12 are also known as calgranulin A, B and C, respectively [19,25]. These three S100 proteins are grouped as a calgranulin family because they are mainly secreted by activated granulocytes and monocytes [19,24]. Inflammatory disorders such as cystic fibrosis, inflammatory bowel disease and rheumatoid arthritis have been shown to be associated with elevated serum levels of calgranulins [6, 7, 8,22]. Therefore, extracellular calgranulins have been suggested to be clinical laboratory markers of inflammation in various diseases.

In 2003, Foell et al. [5] found that the serum concentration of S100A12 was elevated in the acute phase of KD and quickly decreased in response to high-dose IVIG therapy. There have been no reports of leukocyte expression of the S100A12 gene and other S100 genes in patients with KD. In this study, we therefore examined the gene expression profiles of 18 members of the S100 protein family in patients with KD by quantitative real-time PCR.

Patients and methods

Patients

Blood samples were obtained from ten patients (four females and six males, mean age 25±21 months, range 4 to 59 months) who fulfilled the criteria for KD and who were treated at Tenshi Hospital between November 2002 and May 2003. Paired blood samples were obtained before the start of therapy within 7 days after onset of illness and on a mean of 22 days (range 14 to 40 days) after onset of illness. Laboratory data in the acute and convalescent phases are shown in Table 1. All patients were treated with IVIG (1 g/kg per day for 2 days) and acetylsalicylic acid. IVIG was effective in all patients and they recovered without any coronary artery complications. All blood samples were collected after obtaining informed consent from the children’s parents. This study was approved by the Ethics Committee of Hokkaido University Graduate School of Medicine.
Table 1

Laboratory data of patients

Acute phase

Convalescent phase

CRP (mg/dl)

9.5±3.9

0.2±0.2

WBC (cells/µl)

13703.0±3762.0

8591.0±2605.0

Granulocytes (%)

72.5±16.0

47.0±13.9

Neutrophils (%)

67.1±16.6

36.7±12.4

Eosinophils (%)

1.5±1.8

3.6±2.8

Basophils (%)

0.2±0.3

0.5±0.4

Monocytes (%)

3.7±2.1

6.2±1.5

Lymphocytes (%)

26.9±15.1

51.5±13.8

cDNA synthesis

Whole leukocyte RNA was extracted from freshly drawn whole blood using a PAXgene blood RNA isolation system (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. A sample (1 µg) of each RNA was incubated in a solution containing 200 ng of random hexadeoxynucleotides and 55 U of Moloney murine leukaemia virus reverse transcriptase (First-Strand cDNA Synthesis Kit, Amersham Pharmacia Biotech, Piscataway, USA) in a final volume of 33 µl at 37°C for 1 h to synthesise cDNA.

Quantitative real-time polymerase chain reaction

We preliminarily used a cDNA microarray to compare the expression levels of 2976 leukocyte genes (Human Chip ver.1, DNA Chip Research Inc., Yokohama, Japan) of three KD patients in the acute phase with those in the convalescent phase. Of the 2976 genes, S100A8 and S100A9 genes showed the highest expression levels in the acute phase of KD. The gene expression levels of S100A8, S100A9, and other S100 family proteins were examined by quantitative real-time PCR. S100 transcripts were amplified using each primer pair derived from the corresponding GenBank sequences (Table 2). Primers for PCR were designed using Primer Express software (Perkin Elmer Applied Biosystems, Foster City, USA). Gene expression analysis was performed by a quantitative real-time PCR procedure using an Applied Biosystems 7000 DNA sequence detection system (Perkin Elmer Applied Biosystems). The optimal primer concentration (50 nM, 300 nM or 900 nM) for each gene was chosen to achieve maximum amplification of the gene and minimum non-specific amplification. The PCR reaction mixture contained 25 µl of SYBER Green PCR Master Mix (Perkin Elmer Applied Biosystems), an appropriate concentration of paired primers, and 1 µl of cDNA in a total volume of 50 µl. Beta-actin was also amplified under the same conditions and used as an internal control to normalise reactions. The PCR conditions were 95°C for 10 min, followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Quantitative real-time PCR data were analysed by using the 2–ΔΔCt method as described by Livak et al. [12]. Ct values were converted into linear forms using 2–ΔCt and were analysed by the Student’s t -test to determine statistical significance ( P <0.05) of the difference between the expression levels in the acute phase and in the convalescent phase.
Table 2

Real-time PCR primer sequences

Target gene (accession no.)

Forward (5’→3’)

Reverse (5’→3’)

Product size

S100A1 (NM 006271)

gagctctctggcttcctggat

ttcatcaccttgtccacagca

59 bp

S100A2 (NM 005978)

ggtctgccacagatccatgat

ccctcttggcaggagtacttgt

90 bp

S100A3 (NM 002960)

acctggaccccgactgagtt

gtgagcgcacatactccacaa

106 bp

S100A4 (NM 002961)

gaactaaaggagctgctgaccc

ttcatctgtccttttccccaa

60 bp

S100A5 (NM 002962)

gtccccagcccttgtttgtaa

ccatcacagtgtgcagctcact

135 bp

S100A6 (NM 014624)

ctcaccattggctcgaagct

agtcttccatcagccttgcaa

55 bp

S100A7 (NM 002963)

cccaacttccttagtgcctgtg

aagacgtcggcgaggtaattt

79 bp

S100A8 (NM 002964)

ccgagtgtcctcagtatatcagga

gcccatctttatcaccagaatga

119 bp

S100A9 (NM 002965)

tggctcctcggctttgg

cgacattttgcaagtcatcgtc

51 bp

S100A10 (NM 002966)

aaggcttcaacggaccacac

agcctttatccccagcgaat

97 bp

S100A11 (NM 005620)

ctcagctccaacatggcaaa

tcgatgcaccgctcagtct

56 bp

S100A12 (NM 005621)

cactgctggctttttgctgtag

ttaacccctcaatgcacagga

51 bp

S100A13 (NM 005979)

atagcctcagcgtcaacgagtt

catcaagagagcccacatcctt

81 bp

S100A14 (NM 020672)

tcagccaacgcagaggatg

ctcaatggccctctccacat

54 bp

S100A15 (NM 176823)

cattacctcgccactgtctttg

gcttgtggtagtctgcggctat

171 bp

S100B (NM 006272)

aggatgtctgagctggagaagg

ggtggaaaacgtcgatgagg

52 bp

S100P (NM 005980)

gagctcaaggtgctgatgg

tccttgtcttttccactctgca

63 bp

S100Z (NM 130772)

ggaactgaaactgctcctgca

ccttattggcatccaggtcct

104 bp

βactin (NM 001101)

cctggcacccagcacaat

gccgatccacacggagtact

70 bp

Results

A comparison of mean leukocyte expression levels of 18 members of the S100 gene family in the acute phase and convalescent phase of KD is shown in Table 3. Expression of the S100A5, S100A7 and S100A14 genes was not detected in leukocytes. Expression levels of seven S100 genes (S100A6, A8, A9, A11, A12, S100P, and S100Z) were significantly elevated in the acute phase compared with those in the convalescent phase. Only one S100 gene, the S100A13 gene, showed a significantly reduced gene expression level in the acute phase. In the acute phase of KD, genes expressed at the highest levels (mean fold change >4) by leukocytes were S100A8 ( P =0.0074), S100A9 ( P =0.0014), and S100A12 ( P =0.0068). Genes expressed at relatively higher levels (mean fold change <4) by leukocytes in the acute phase were S100A6 ( P =0.0093), S100A11 ( P =0.00066), S100P ( P =0.0039), and S100Z ( P =0.014).
Table 3

S100 gene expression by leukocytes in the acute phase compared with that in the convalescent phase

Mean fold change (rangea)

P

S100A1

-1.14 (0.69–1.88)

0.39

S100A2

1.10 (0.48–2.49)

0.28

S100A3

1.12 (0.66–1.89)

0.18

S100A4

1.34 (0.68–2.63)

0.23

S100A5

Not detected

S100A6

2.04 (0.93–4.42)

0.0093*

S100A7

Not detected

S100A8

6.96 (4.20–11.54)

0.0074*

S100A9

7.27 (4.44–11.90)

0.0014*

S100A10

-1.31 (0.76–2.28)

0.12

S100A11

3.52 (1.65–7.49)

0.00013*

S100A12

5.68 (2.88–11.18)

0.0068*

S100A13

-1.90 (1.35–2.67)

0.016*

S100A14

Not detected

S100A15

1.13 (0.59–2.17)

0.33

S100B

-1.36 (0.93–2.00)

0.33

S100P

3.94 (1.88–8.26)

0.0039*

S100Z

1.38 (0.59–3.23)

0.025*

aRange was calculated as mean hold change ± SD

* P <0.05 (significantly different () from expression in convalescent phase by Student’s t -test)

Discussion

We found that gene expressions of several S100 proteins of leukocytes were associated with the acute phase of KD. We collected blood samples 2 to 5 weeks after onset of illness as samples in the convalescent phase. We also examined some blood samples from healthy children for the expression of S100 genes. Although the sample number was too small for statistical analysis, S100 gene expression levels in the healthy children were similar to those in the convalescent phase of KD (data not shown).

Of the S100 genes, calgranulin genes exhibited the highest expression levels in the acute phase. Besides pro-inflammatory activity via RAGE, extracellular S100A12 has been reported to display chemotactic activity [16]. Calgranulins might be involved in progression of vasculitis in KD patients.

Besides calgranulins, leukocyte expression of other S100 genes (S100A6, S100A11, S100P and S100Z) was upregulated in the acute phase of KD. S100P has recently been shown to interact with RAGE [1]. Activation of RAGE by extracellular S100P induces cell proliferation with activation of Nuclear factor kappa-B in embryo fibroblasts. However, functions of extracellular S100P in leukocytes and endothelial cells via RAGE remain to be determined. Since there have been few reports on the roles of S100A6, S100A11, and S100Z in inflammatory conditions such as KD, it is difficult to discuss the pathophysiological roles of the increased expression levels of these genes by leukocytes in the acute phase of KD.

The S100A13 gene is the only downregulated S100 gene of leukocytes in the acute phase of KD. Intracellular S100A13 is known to be associated with interleukin-1α secretion, which induces inflammation-related molecules such as tumour necrosis factor-α, transforming growth factor-β, cyclooxygenase 2, and phospholipase A2 [4, 14, 18,21]. Therefore, it seems that a decrease in the level of S100A13 gene expression could be one of compensatory responses to suppress inflammation in the acute phase of KD. However, since nothing is known about extracellular functions of S100A13, the exact roles of S100A13 in inflammatory conditions remain to be determined.

Low levels of S100A10 gene expression, which has anti-inflammatory activities within the cell [27], were observed in the acute phase of KD compared with those in the convalescent phase. However, the differences were not statistically significant. Although S100A2 and S100A7 are chemotactic for eosinophils and CD4+ lymphocytes, respectively [10,11], these genes were not expressed at higher levels by leukocytes in the acute phase than in convalescent phase of KD.

Although changes of S100 gene expression by leukocytes are affected by changes in leukocyte subset composition, S100 gene expressions in the fractionated cells could not be determined because of the limited number of leukocytes. Of the S100 genes with significant changes, calgranulin genes were shown to be mainly expressed by neutrophil among leukocyte components [19,24]. Taking account of neutrophil changes, expression of calgranulin genes was still significantly elevated in the acute phase of KD.

Our results suggest that S100 proteins play potentially important roles in the development of KD. We investigated the expression of S100 proteins only at the gene level but not at the protein level. Therefore, drawing conclusions on the roles of intracellular and extracellular S100 proteins in KD was impossible in the present study. Further study is needed to elucidate the mechanism of interaction between these S100 proteins and the acute multisystem vasculitis in KD.

Acknowledgements

We thank Dr. Yachiyo Ohta, Dr. Takashi Iwai, and Dr. Seido Iwata of Tenshi Hospital and Dr. Mutsuko Konno of Sapporo Kosei General Hospital. We also thank Mr. Stewart Chisholm for proofreading the manuscript.

Copyright information

© Springer-Verlag 2005