Virchows Archiv

, Volume 467, Issue 2, pp 203–210

Next-generation sequencing is highly sensitive for the detection of beta-catenin mutations in desmoid-type fibromatoses

  • Sarah J. Aitken
  • Nadège Presneau
  • Sangeetha Kalimuthu
  • Palma Dileo
  • Fitim Berisha
  • Roberto Tirabosco
  • M. Fernanda Amary
  • Adrienne M. Flanagan
Original Article

DOI: 10.1007/s00428-015-1765-0

Cite this article as:
Aitken, S.J., Presneau, N., Kalimuthu, S. et al. Virchows Arch (2015) 467: 203. doi:10.1007/s00428-015-1765-0

Abstract

Desmoid-type fibromatoses are locally aggressive and frequently recurrent tumours, and an accurate diagnosis is essential for patient management. The majority of sporadic lesions harbour beta-catenin (CTNNB1) mutations. We used next-generation sequencing to detect CTNNB1 mutations and to compare the sensitivity and specificity of next-generation sequencing with currently employed mutation detection techniques: mutation-specific restriction enzyme digestion and polymerase chain reaction amplification. DNA was extracted from formalin-fixed paraffin-embedded needle biopsy or resection tissue sections from 144 patients with sporadic desmoid-type fibromatoses, four patients with syndrome-related desmoid-type fibromatoses and 11 morphological mimics. Two primer pairs were designed for CTNNB1 mutation hotspots. Using ≥10 ng of DNA, libraries were generated by Fluidigm and sequenced on the Ion Torrent Personal Genome Machine. Next-generation sequencing had a sensitivity of 92.36 % (133/144, 95 % CIs: 86.74 to 96.12 %) and a specificity of 100 % for the detection of CTNNB1 mutations in desmoid-type fibromatoses-like spindle cell lesions. All mutations detected by mutation-specific restriction enzyme digestion were identified by next-generation sequencing. Next-generation sequencing identified additional mutations in 11 tumours that were not detected by mutation-specific restriction enzyme digestion, two of which have not been previously described. Next-generation sequencing is highly sensitive for the detection of CTNNB1 mutations. This multiplex assay has the advantage of detecting additional mutations compared to those detected by mutation-specific restriction enzyme digestion (sensitivity 82.41 %). The technology requires minimal DNA and is time- and cost-efficient.

Keywords

Next-generation sequencing Desmoid-type fibromatosis Beta-catenin CTNNB1 Molecular pathology 

Introduction

Desmoid-type fibromatoses (DTFs) are soft tissue neoplasms sited deep to subcutaneous tissue and fascia. DTFs have an infiltrative growth pattern and are locally aggressive with a propensity to recur, but they do not metastasise or dedifferentiate (WHO classification: intermediate (locally aggressive, non-metastasising [1]). DTFs are rare, account for <3 % of soft tissue tumours [2] and have an incidence of two to four per million [3].

The histopathological diagnosis of DTF is made on needle core biopsies, which is challenging given the small volume of tissue, varied morphological appearance and known histological mimics; these include low-grade sarcomas [4] and a range of benign tumours and reactive lesions [1]. Since a proportion of DTFs stabilise or regress spontaneously, there has been a change in opinion regarding clinical management, and some groups advocate active surveillance over surgery for first-line management [5, 6, 7]. Patients therefore benefit from a robust accurate diagnosis on needle core biopsy prior to surgery, after which the diagnosis is generally relatively straightforward when abundant tissue specimens are available.

The vast majority of DTFs occur sporadically and are characterised by abnormalities in the Wnt signalling pathway, most of which are caused by somatic mutations in CTNNB1, which encodes beta-catenin [8]. CTNNB1 is located on the short arm of chromosome 3 (3p21), and the majority of reported mutations occur in codons 41 and 45 of exon 3 [9]. Beta-catenin is an integral component of E-cadherin complexes at intercellular adherens junctions, and it also recruits chromatin remodelling complexes to activate transcription in the nucleus [10]. A minority of DTFs arise on a background of adenosis polyposis coli (APC) germline mutations and are associated with familial adenosis polyposis (FAP) and Gardner’s syndrome [11].

Next-generation sequencing (NGS) is increasingly being used to support histological tissue diagnoses. Importantly, for some diseases, certain genetic alterations are very specific when interpreted in the correct clinical setting: In such diseases, targeted mutational analysis using formalin-fixed paraffin-embedded (FFPE) tissue is an efficient means of rapidly providing supportive evidence for the microscopic diagnosis [12, 13]. Targeted NGS has the added benefit of detecting multiple mutations in particular genes of interest in a single test, which also makes it time- and cost-efficient for use in clinical practice [14, 15]. In view of the high incidence of CTNNB1 mutations occurring in DTFs and not in histological mimics, this technology is ideal for development as an adjunctive diagnostic test [4].

The aim of this project was to develop an assay using NGS that could be introduced to the clinical service in order to provide supportive diagnostic evidence for a histological diagnosis of DTF. Such an assay would be required to (a) detect known common mutations in CTNNB1 and (b) be more sensitive and specific than the existing mutation-specific restriction enzyme digestion (MSRED) technology used in our lab to support the diagnosis of DTF.

Materials and methods

Tissue and patient selection

DTF cases diagnosed between 2002 and 2014 were identified from the histopathology computer database at the Royal National Orthopaedic Hospital, Stanmore, UK. Relevant clinical data, including MSRED results, were correlated with these cases. Cases were included in the study on the basis of expert histological review and the existence of available material for DNA sequencing. All haematoxylin and eosin (H&E)-stained sections were reviewed to ensure that the tissue contained at least 10 % lesional cells; no cases failed this criterion since the lesions were homogeneous (which is typical for fibromatosis) and there was, therefore, no need to enrich for tumour content. Four patients with FAP/Gardner’s syndrome were included as negative controls since these tumours are expected to harbour APC mutations and not to have CTNNB1 alterations. For those patients with multiple or recurrent DTFs, all lesions were analysed. Eleven histological mimics were also included: plantar fibromatosis (n = 2), post-radiotherapy scar (n = 2), reactive fibroblastic lesion (n = 2), myofibroblastic lesion (n = 2), pseudoangiomatous stromal hyperplasia (n = 1), post-traumatic scar (n = 1) and nodular fasciitis (n = 1).

The study was approved by the Cambridgeshire 2 Research Ethics committee (reference 09/H0304/78).

DNA extraction

DNA was extracted from either ten or two 10-μm FFPE tissue sections of needle core biopsies or tumour resection specimens, respectively. DNA was extracted using the QIAamp DNA FFPE Tissue Kit (Qiagen, Venlo, Netherlands) according the manufacturer’s instructions and eluted in a final volume of 30 μl. Review of H&E-stained sections showed that the tissue sections were composed almost entirely of lesional cells.

Primer design

Two primer pairs were designed to target CTNNB1 mutation hot spots identified in the Catalogue of Somatic Mutations in Cancer (COSMIC: http://cancer.sanger.ac.uk/).

The human genome 19 (hg19) and CTNNB1 transcript ENST00000349496 were accessed via Ensemble (http://www.ensembl.org/). Primers were designed using Primer 3 (http://primer3.ut.ee/) [16, 17] and checked for single nucleotide polymorphisms (SNPs) using SNP Check (www.snpcheck.net/); specificity and product size were determined with UCSC BLAT/PCR (http://genome.ucsc.edu/), and in-house software (Oligos) was used to assess %GC content and for the unwanted presence of primer dimers. Primers not meeting these criteria were rejected and redesigned. The primers covered codons 34–45, which include the three most common mutations reported in DTFs (c.121A>G p.T41A, c.134C>T p.S45F and c.133T>C p.S45P), and codons 15–22, which include the next most frequent mutations. Bi-directional tags were added to each primer: forward primers the common sequence (CS) CS1 ACACTGACGACATGGTTCTACA and reverse primers with CS2 TACGGTAGCAGAGACTTGGTCT (Table 1).
Table 1

Primers with tags

  

Product size

CTNNB1 34-45 forward

ACACTGACGACATGGTTCTACACCATGGAACCAGACAGAAAAGC

140 bp

CTNNB1 34-45 reverse

TACGGTAGCAGAGACTTGGTCTGGTATCCACATCCTCTTCCTC

CTNNB1 15-22 forward

ACACTGACGACATGGTTCTACAcaatctactaatgctaatactgtttcg

145 bp

CTNNB1 15-22 reverse

TACGGTAGCAGAGACTTGGTCTgtagtggcaccagaatggattcc

Polymerase chain reaction (PCR) using control DNA was used to check that the primers amplified a single amplicon of the correct size on a 6 % acrylamide gel with a 100–400 bp ladder (200 V constant for 40 min).

Pre-amplification

Pre-amplification templates were designed to include three negative controls and at least three positive controls, with samples in all other wells of 48 wells of a 96-well plate. Briefly, 1 μl (≥10 ng) of DNA or PCR-grade water was added to each well containing 9 μl of FastStart High Fidelity PCR System master mix (Roche Applied Science, Penzberg, Germany). The following PCR protocol was then used: 95 °C for 10 min, 2 cycles of 95 °C for 15 s followed by 60 °C for 4 min, then 13 cycles of 95 °C for 15 s and 72 °C for 4 min. The PCR products were then cleaned by adding 4 μl ExoSAP-IT (exonuclease I and shrimp alkaline phosphatase) enzyme mix (Affymetrix, Santa Clara, California, USA) to each well and thermocycled at 37 °C for 15 min and then at 80 °C for 15 min. The cleaned products were diluted by adding 5 μl of product to 13 μl of water.

Fluidigm

A 48 × 48 Access Array Integrated Fluidic Circuit (IFC) (Fluidigm, San Francisco, California, USA) was primed according to the manufacturer’s instructions. One microlitre of diluted pre-amplification product was added to 4 μl of FastStart High Fidelity PCR System master mix (Roche Applied Science). The IFC was then loaded with 4 μl of this sample mix solution into each sample inlet and 4 μl of the primer solutions into each primer inlet. The IFC was cycled (48 × 48 Standard v1). The PCR products were harvested and diluted 1 μl in 99 μl of water.

Barcoding

Custom-designed ten-base oligonucleotides were used to identify each sample. One microlitre of the diluted harvest product was added to 15 μl of FastStart High Fidelity PCR System master mix (Roche Applied Science) and 4 μl of barcode solution. The following PCR protocol was carried out: 95 °C for 10 min followed by 15 cycles of 95 °C for 30 s, 60 °C for 30 s, 72 °C for 1 min and then 72 °C for 3 min. The barcoded PCR products were checked on 6 % acrylamide gels with a 100–400 bp ladder (200 V constant for 40 min).

One microlitre of each barcoded DNA sample was pooled to form the library, which was purified by adding 52.8 μl (1.1× volume) of AMPure Reagent (Beckman Coulter, Pasadena, California, USA). The mixture was placed on the DynaMag (Life Technologies, Carlsbad, California, USA) magnet and washed twice with 200 μl of 70 % ethanol, and then, the DNA was eluted in 20 μl of PCR-grade water. The cleaned library was analysed using a 6 % acrylamide gel (100 V for 90 min) and compared to previous libraries to establish the dilatation ratio.

Emulsion PCR

Twenty five microlitres of the diluted library was added to the Ion OneTouch™ 200 Template Kit v2 amplification solution (Life Technologies) according to the manufacturer’s instructions; 100 μl of ion sphere particles (ISPs) was added and then transferred to the OneTouch reaction assembly. Emulsion PCR was carried out overnight using the Ion OneTouch™ 2 System (Life Technologies). The template-positive ISPs were then enriched according to the manufacturer’s instructions.

The Ion Sphere™ Quality Control Kit (Life Technologies) was used to assess the quality of the library pre- and post-enrichment, which was measured using the Qubit 2.0 Fluorometer (Life Technologies) according to the manufacturer’s instructions. Pre-enrichment samples should have 10–30 % template-positive ISPs; post-enrichment samples should have >70 % template-positive ISPs, and all values must be ≥200 RFU to ensure adequate depth of sequencing without an excess of polyclonal beads.

Sequencing

DNA sequencing was carried out using the Ion Torrent Personal Genome Machine (PGM) (Life Technologies). Following initialisation of the PGM, control ISPs and annealing sequencing primer were added to the enriched ISPs, cycled at 95 °C for 2 min and then 37 °C for 2 min, and then, PGM 200 Sequencing Polymerase was added to produce a total final volume of 30 μl.

An Ion 316 Chip (Life Technologies) was washed with 100 μl of 100 % isopropanol and then twice with 100 μl of annealing buffer. The sample was then loaded onto the chip.

Data and statistical analysis

Sequencing data were aligned to hg19 using Torrent Suite software (Life Technologies) and visualised using IGV software (http://www.broadinstitute.org/igv/). CTNNB1 mutation hot spots were analysed manually by two independent observers in order to identify mutations. A mutation was deemed present when there was ≥5 % variant allele fraction (VAF) in a region with ≥500 reads per base. This threshold corresponds to the morphological inclusion criteria of 10 % lesional cells, equating to 5 % somatic VAF.

The results were compared to MSRED data, where available. Non-concordant results were repeated with technical and biological repeats from DNA re-extracted from the original FFPE tissue; cases with mutations other than the three most common substitutions (previously detected by MSRED) underwent capillary sequencing at UCL Cancer Institute Core Facility. Categorical data were analysed using the chi-squared test (GraphPad Prism), and a p value of <0.05 was considered statistically significant.

Results

Patient and tumour demographics

The patient and tumour demographics are shown in Table 2. The sporadic DTFs from 144 individuals studied had a demographic profile similar to other published literature [2, 18]: Approximately two thirds of patients were female, and approximately one sixth of tumours were recurrent. Those patients who experienced recurrence of their tumour had an earlier average age of presentation: 29.88 versus 39.61 years for non-recurrent tumours (p < 0.001). As expected in a cohort originating from a specialist orthopaedic hospital, most tumours were extra-abdominal (138/144).
Table 2

Patient demographics

  

All cases

Recurrent tumours

Non-recurrent tumours

Number cases

 

144

25

119

Age at first presentation

Mean

37.97

29.88

39.61

SD

17.27

15.43

17.13

Range

8 to 81

8 to 72

8 to 81

Gender

Male

49

7

42

Female

95

18

77

Anatomical site

Leg

31

8

23

Back

21

2

19

Abdominal wall

16

0

16

Arm

10

2

8

Buttock

10

5

5

Chest wall

10

2

8

Shoulder

8

1

7

Hip

7

3

4

Intra-abdominal

6

0

6

Head and neck

5

0

5

Axilla

4

0

4

Foot

4

2

2

Breast

3

0

3

Supraclavicular

2

0

2

Hand

1

0

1

Intra-thoracic

1

0

1

Unknown

5

0

5

Total

 

144

25

119

Next-generation sequencing identifies CTNNB1 mutations in DTFs

The average sequencing depth for the codons 34–45 was 2354 reads (range 657–5569; n = 144) for the sporadic DTFs, 2487 (range 1439–4471; n = 4) for the FAP/Gardner’s syndrome cases and 2007 (range 1145–2983; n = 11) for the morphological mimics; one sporadic DTF case was excluded since it did not meet the minimum threshold of 500 reads. CTNNB1 mutations were identified in 133 of 144 cases: 132 of these were substitutions, with an average of 23.1 % VAF (range 6–47 %); cases with <5 % VAF were not included.

The concordance between NGS and MSRED is good

Both MSRED and NGS results were available for 108 cases (Table 3): Of these, 92.59 % (100/108) were concordant (kappa = 0.694); this strength of agreement is considered to be ‘good’ [19]. In all 89 cases that were found to harbour a mutation by NGS and MSRED, the same substitution was detected using each test (c.121A>G p.T41A, c.134C>T p.S45F or c.133T>C p.S45P), and in eight cases, a second CTNNB1 mutation was detected by NGS in addition to the expected substitution (Table 5).
Table 3

Concordance between MSRED and NGS results

 

NGS result

Total

Mutation detected

No mutation detected

MSRED result

Mutation detected

89

0

89

No mutation detected

8

11

19

Not done

36

0

36

Total

133

11

144

Breakdown of results and mutations not previously reported in DTFs

NGS detected 68 cases with the substitution c.121A>G p.T41A alone, 51 cases with the c.134C>T p.S45F substitution alone and 3 cases with a c.133T>C p.S45P substitution alone (Table 4). There were 11 cases in which rarer, non-synonymous mutations were identified using NGS that had not been detected using MSRED (Table 5): Nine of these cases harboured a second non-synonymous common mutation described above. The mutations in the two cases in which a common mutation was not detected were represented by c.122C>T p.T41I (COSMIC mutation ID COSM5676) and c.134_139delCTCTGA p.S45_S47>C (COSMIC mutation ID COSM28708), neither of which are reported in DTFs in COSMIC.
Table 4

Detailed NGS results

  

NGS result

Total

T41A only

S45F only

S45P only

Additional mutation

No mutation detected

MSRED result

Mutation detected

48

30

3

8

0

89

No mutation detected

1

5

0

2

11

19

Not done

19

16

0

1

0

36

Total

 

68

51

3

11

11

144

Table 5

Less common mutations

MSRED

 

NGS

Negative

No mutation detected

c.122C>T, p.T41I

Negative

No mutation detected

c.134_139delCTCTGA, p.S45_S47>C

Positive

Codon 41 ACC to GCC

c.121A>G, p.T41A; c.61G>A, p.A21T

Positive

Codon 41 ACC to GCC

c.121A>G, p.T41A; c.65T>C p.V22A

Positive

Codon 41 ACC to GCC

c.121A>G, p.T41A; c.115G>A, p.A39T

Positive

Codon 41 ACC to GCC

c.121A>G, p.T41A; c.119C>T, p.T40I

Positive

Codon 41 ACC to GCC

c.121A>G, p.T41A; c.130C>T, p.P44S

Positive

Codon 45 TCT to TTT

c.134C>T, p.S45F; c.107A>C, p.H36P

Positive

Codon 45 TCT to TTT

c.134C>T, p.S45F; c.119C>T, p.T40I

Positive

Codon 45 TCT to TTT

c.134C>T, p.S45F; c.121A>G, p.T41A

Not done

 

c.121A>G, p.T41A; c.134C>T, p.S45F; c.95A>G, p.D32G; c.101G>A, p.G34E; c.109T>C, p.S37P

There were eight cases in which mutations were detected using NGS that were not detected using MSRED: c.134C>T p.S45F (n = 5), 121A > G p.T41A (n = 1), c.122C>T p.T41I (n = 1) and c.134_139delCTCTGA p.S45_S47>C (n = 1). These results were reproducible in repeat, independent experiments using NGS, MSRED and capillary sequencing. All cases in which mutations were detected by MSRED were also detected by NGS.

Sensitivity and specificity

The sensitivity of NGS for detecting mutations in sporadic DTFs was 92.36 % (133/144, 95 % CIs: 86.74 to 96.12 %). The specificity of NGS was 100 %, since no CTNNB1 mutations were detected in the 11 morphological mimics (superficial fibromatosis, nodular fasciitis and reactive lesions) nor the four DTFs with FAP/Gardener’s syndrome (which are driven by APC mutations). Within this same cohort, the sensitivity of MSRED was 82.41 % (89/108, 95 % CIs: 73.90 to 89.06 %).

Recurrent DTFs

This study included 25 recurrent tumours in the same number of individuals, all of which had mutations detected by NGS: Ten cases had the p.T41A mutation and 15 cases had the p.S45F mutation; the p.S45P mutation was not detected in any recurrent tumours. Detection of a mutation (chi-squared test, p = 0.18) or any specific mutation (p = 0.32) was not associated with tumour recurrence.

Discussion

Until now, we have used MSRED to detect CTNNB1 mutations in DTFs in clinical practice. In this study, we compared NGS results using a Fluidigm and Ion Torrent PGM-based NGS approach with those of our previous MSRED results. CTNNB1 mutations were detected in 92.36 % (133/144) of all cases of sporadic DTF compared to only 82.41 % using MSRED. The concordance with MSRED was ‘good’ (92.59 %), and the average read depth (2354 reads) and confidence in mutation detection were high, since genetic alterations were detected in an average of 23.1 % reads per sample and at high read depth. These data demonstrate that the overall sensitivity of NGS is higher than the sensitivity of other techniques previously reported to detect these mutations in DTFs: Lazar et al. [20] reported a mutation rate of 85 % (117/138) by PCR amplification of CTNNB1 exon 3 codons 30–48, and Amary et al. showed that the sensitivity was 86.8 % using MSRED in a cohort of 76 DTFs [9]. However, since not all DTFs are caused by CTNNB1 mutations, this figure is likely to under-represent the true sensitivity of the test, since APC mutations account for up to 20 % of sporadic DTFs [21].

In addition to the possibility that mutation-negative cases harbour an APC mutation, the failure to detect a CTNNB1 mutation may also be explained by the fact that only a limited number of CTNNB1 loci were sequenced by the assay that we used in this study. The CTNNB1 hot spot regions sequenced included the common codon 15–22 and 34–45 exon 3 mutations: Nevertheless, these loci account for only 176/569 of all reported CTNNB1 mutations in COSMIC, equating to 2843/4269 of all reported cases.

In eight cases of sporadic DTF analysed in this study, a mutation was detected using NGS but not with MSRED. Five of these cases had a p.S45F mutation and one case a p.T41A mutation, both of which should have been detected by our routine MSRED assay. In contrast, the other two genetic alterations, one a small deletion c.134_139delCTCTGA and the other a substitution c.122C>T, p.T41I, have been reported in COSMIC but not in DTF, despite this mutation having being reported previously in DTF by Le Guellec et al. [4]. This highlights the value not only of sequencing the DNA of large numbers of tumour subtypes but also reporting the findings to the scientific community. Such reference materials or catalogues provide researchers and clinicians with greater confidence when reporting rare genetic variants, particularly when they occur in rare diseases. Discrepant results between NGS and MSRED may be accounted for by the lower sensitivity of MSRED, i.e. type II (false negative) error. Additional mutations detected by NGS but not MSRED can be accounted for by the fact that MSRED only detects very specific (targeted) nucleotides; any substitutions in the same codon or any other chromosomal region would not be detected. In addition, more complex mutations including indels or translocations cannot be detected by MSRED. NGS allows all mutations present within the targeted regions to be identified, although any mutations falling out with these regions would still be missed unless a whole gene or exome approach was adopted.

It is noteworthy that three of the 14 mutation-negative tumours were sited in the abdominal cavity, a common site for DTFs harbouring an APC mutation. Hence, in the absence of a history of FAP/Gardner’s syndrome, the possibility of an APC genetic alteration cannot be excluded without additional DNA sequencing. However, as we show that six other intra-abdominal cases in our study harboured a CTNNB1 mutation, DFT at this site does not infer an APC genetic alteration. Therefore, we recommend that when a confident diagnosis of DTF is made on morphological features in the absence of a CTNNB1 mutation, the possibility of FAP/Gardner’s syndrome should be raised with the multidisciplinary team to ensure that appropriate measures are taken to exclude a hereditary diagnosis and appropriate referral to a medical genetics practice is made. The multidisciplinary team may also decide to instigate reflex APC mutation testing for all cases for which a confident diagnosis of DTF is made but a CTNNB1 mutation is not detected. One case in our study underscores this point: A patient presented with an intra-abdominal DTF (presumed to be sporadic) but no CTNNB1 mutation was detected. Subsequently, the patient’s 3-year-old daughter was diagnosed with an extra-abdominal CTNNB1 mutation-negative DTF. Although these tumours from mother and child had not been tested for APC mutations, there was a high degree of clinical suspicion for FAP/Gardner’s syndrome, and the mother was referred for genetic counselling.

Neither the presence nor absence of a CTNNB1 mutation (p = 0.18), nor the identification of any specific mutation in CTNNB1 (p = 0.32), were associated with tumour recurrence in this study. Our findings are consistent with those of Mullen et al. [22], who found that there was no significant difference in recurrence of disease associated with either the CTNNB1 mutation status or the presence of a specific CTNNB1 mutation. This is in contrast to the results of Lazar et al. [20] who found that 5-year recurrence-free survival was significantly lower in DTFs with the c.134C>T p.S45F substitution in codon 45 (23 %, p < 0.0001) compared with the presence of a c.121A>G p.T41A in codon 41 (57 %) or tumours in which no CTNNB1 mutation was detected (65 %). This finding was supported by Colombo et al. [23] who found that DTFs with a p.S45F mutation had a greater tendency for local recurrence. It would be of interest to resolve these conflicting results, since confidence in an association of recurrence with a specific mutation may help to stratify patients for closer follow-up or even more aggressive surgery or radiotherapy. One possible confounding factor is that individuals in our study have a slightly older age of presentation (average 37.97 years) compared with the cohort of Lazar et al. [20] (average 32 years). This is noteworthy, as Lazar et al. established an association between risk of recurrence and younger age, which may explain the negative association between recurrence and the p.S45F mutation in our study. This difference in age of the cohort makes the results difficult to compare. Furthermore, conflicting results may reflect that the patients in the different groups received different treatments (more aggressive surgery, radiotherapy, hormone treatment or a combination of the above) when they first presented. Obtaining an answer to this question may require a prospective study in which patients with similar treatments are compared.

In conclusion, we have shown that NGS is a robust technology for detecting CTNNB1 mutations in DTFs and has a sensitivity of 92.36 %, which could be further increased by screening a greater number of loci. In addition, NGS is more efficient than MSRED as it allows screening of multiple alterations in one assay and is as cost-effective as MSRED and other technologies.

Acknowledgments

This work was supported by Skeletal Cancer Action Trust (SCAT), UK. The material was obtained from the RNOH Musculoskeletal Research Programme and Biobank. Support was provided to AMF (UCL) by the National Institute for Health Research, UCLH Biomedical Research Centre and the UCL Experimental Cancer Centre. SJA is a NIHR-funded Academic Clinical Fellow. We are grateful to the patients for participating in the research and to the clinicians and support staff of the London Sarcoma Service.

Conflict of interest

No conflicts of interest to declare.

Copyright information

© Springer-Verlag Berlin Heidelberg 2015

Authors and Affiliations

  • Sarah J. Aitken
    • 1
    • 2
    • 5
  • Nadège Presneau
    • 1
    • 6
  • Sangeetha Kalimuthu
    • 3
  • Palma Dileo
    • 4
  • Fitim Berisha
    • 3
  • Roberto Tirabosco
    • 3
  • M. Fernanda Amary
    • 1
    • 3
  • Adrienne M. Flanagan
    • 1
    • 3
  1. 1.Research Department of PathologyUCL Cancer InstituteLondonUK
  2. 2.Department of HistopathologyAddenbrooke’s HospitalCambridgeUK
  3. 3.Royal National Orthopaedic Hospital NHS TrustStanmoreUK
  4. 4.University College HospitalLondonUK
  5. 5.Cancer Research UK Cambridge InstituteUniversity of CambridgeCambridgeUK
  6. 6.Department of Biomedical SciencesUniversity of WestminsterLondonUK

Personalised recommendations