Conservation Genetics Resources

, Volume 4, Issue 3, pp 595–598

Isolation and characterization of ten microsatellite loci of endangered Anderson’s crocodile newt, Echinotriton andersoni

  • Hirotaka Sugawara
  • Takeshi Igawa
  • Masashi Yokogawa
  • Masaru Okuda
  • Shohei Oumi
  • Seiki Katsuren
  • Singo Kaneko
  • Tetsuya Umino
  • Yuji Isagi
  • Masayuki Sumida
Technical Note

DOI: 10.1007/s12686-012-9600-2

Cite this article as:
Sugawara, H., Igawa, T., Yokogawa, M. et al. Conservation Genet Resour (2012) 4: 595. doi:10.1007/s12686-012-9600-2

Abstract

Due to an originally small distribution range and recent habitat loss, Anderson’s crocodile newt (Echinotriton andersoni) has been steadily declining in number. For effective conservation of this species, a greater amount of genetic information is needed. Here, we isolated ten microsatellite loci of E. andersoni using three different methods, and polymorphism of these 10 loci were evaluated for 27 individuals collected from three islands. The total number of alleles per locus ranged from 3 to 22, and the expected heterozygosity ranged from 0 to 0.876. Taken together, our findings suggest that these novel loci will be applicable for conservation genetic studies across varying scales.

Keywords

Amphibian Echinotriton andersoni Endangered species Island species Microsatellite markers 

Anderson’s crocodile newt (Echinotriton andersoni) is a relatively-large newt belonging to the family Salamandridae and is endemically distributed on the small 6 islands in South-Western Japan. In addition to intrinsically small restricted habitat, recent habitat loss due to deforestation and development are causing population declines in E. andersoni. Therefore, E. andersoni has been listed as a class B1 endangered species in the IUCN Red List of Threatened Species (Kaneko and Matsui 2004). For the effective conservation of E. andersoni, knowledge of its intraspecific population genetic structure is needed. In this study, we described ten newly identified microsatellite loci for E. andersoni that represent useful markers and clarified genetic diversity among the populations inhabiting three islands using these markers.

We employed three methods for the isolation of microsatellite loci: the biotin enrichment protocol (Glenn and Schable 2005), the dual-suppression PCR protocol (Lian and Hogetsu 2002), and the improved compound microsatellite isolation protocol (Lian et al. 2006). We used genomic DNA extracted from clipped caudal extremities of two individuals from Tokunoshima and Okinawa islands using a DNeasy Blood and Tissue Kit (QIAGEN). The details of procedures of the biotin enrichment and the dual-suppression PCR protocols were conducted by following to Igawa et al. (2011). For the biotin enrichment protocol, 145 recombinant plasmids containing inserts were sequenced using the BigDye® Terminator ver. 3.1 (Applied Biosystems) on an ABI 3130xl (Applied Biosystems). Twenty-nine clones containing microsatellites were located using MSATCOMMANDER ver. 0.8.2 (Faircloth 2008), and primer pairs for 20 loci were designed using Primer 3 ver. 0.4.0 (Rozen and Skaletsky 2000). PCR amplifications were performed using ExTaq® (TaKaRa) and a touchdown protocol [5 min at 95°C followed by two cycles of 30 s at 95°C, 30 s at a locus-specific annealing temperature (Table 1), and 30 s at 68°C, followed by 14 cycles of touchdown with a 0.5°C reduction in annealing temperature/cycle (henceforth, 15 s at each stage, respectively), and 30 cycles of final amplification with a constant annealing temperature]. Five primer pairs consistently generated PCR products, and the forward primers of these pairs were labeled with fluorescent dyes (Table 1). Fragment sizes were determined using ABI 3130xl and genotyped using GeneMapper® 4.0 (Applied Biosystems). Finally, three loci (EanderM-n) were screened as polymorphic loci (Table 1).
Table 1

Nucleotide sequences, annealing temperatures, and allele size ranges of ten microsatellite loci isolated from Echinotriton andersoni

Loci

Accession no.

Repeat motif

Primer sequence (5′–3′)

Ta (°C) start–end

Size ranges (bp)

EanderM-2

AB689684

(GT)8

F: [PET]ACTCATTTTGGTGGTGTTTC

R: CAGAAACCACCATCCTTGTC

60–53

170–184

EanderM-13

AB689685

(GT)4…(GT)7(GA)4…(GA)4

F: [NED]GCTGAACATTTGGCTCCCTA

R: GTGACCGTGCAAGCTTCTCT

60–53

217–235

EanderM-18

AB689686

(TG)6

F: [FAM]TAACCCTGGATTTGAGAGAA

R: ACATGCTTTTCCACATCTTC

60–53

161–173

EanderP-12

AB689687

(CA)6

F: [FAM]CAATTTCAGGAGGGCAGGTA

R: CCAGATAGGAGTCGAACCTACAAT

60–53

224–235

EanderPC-1

AB689688

(AC)6(AG)10AC(AG)5

F: [NED]ACACACACACACAGAGAGAGAG

R: TAAGAGCCAGGTCTTGAGTC

60–55

136–211

EanderPC-2

AB689689

(AC)5(AG)7GA(AG)3

F: [FAM]ACACACACACACAGAGAGAGAG

R: TCTGCTCCTGATTTAGCTTC

55–50

212–216

EanderPC-3

AB689690

(AC)5(AG)9CG(AG)4

F: [FAM]ACACACACACACAGAGAGAGAG

R: TGCTGGTAATCACATCACAG

60–55

170–190

EanderPC-4

AB689691

(AC)5(AG)7

F: [FAM]ACACACACACACAGAGAGAGAG

R: ATTTAGGGTCTCCTCCTGAC

60–55

202–214

EanderPC-5

AB689692

(AG)5(AC)9

F: [HEX]AGAGAGAGAGAGACACACACAC

R: TAGTCACAAGACGCAGAGC

55–50

170–183

EanderPC-6

AB689693

(AG)5(AC)10

F: [HEX]AGAGAGAGAGAGACACACACAC

R: TTCCTGGAATTCAGTTATGC

60–55

139–170

Ta annealing temperature

Table 2

Number of alleles and heterozygosities of ten microsatellite loci isolated from Echinotriton andersoni in three island populations

Loci

All sites

Amami (N = 4)

Toku (N = 13)

Okinawa (N = 10)

Na

FST

RST

Na

HO

HE

Na

HO

HE

Na

HO

HE

EanderM-2

7

0.290

0.269

1

0.000

0.000

4

0.308

0.618

5

1.000

0.724

EanderM-13

6

0.288

0.355

3

1.000

0.611

3

0.692

0.607

3

0.222

0.475

EanderM-18

7

0.295

0.264

3

0.250

0.531

5

0.250

0.531

2

0.000

0.180

EanderP-12

3

0.360

0.417

1

0.000

0.000

2

0.077

0.074

2

1.000

0.500

EanderPC-1

22

0.131

0.146

6

0.750

0.813

13

0.692

0.876

8

0.900

0.695

EanderPC-2

3

0.202

0.191

1

0.000

0.000

2

0.231

0.204

3

0.300

0.625

EanderPC-3

9

0.154

0.107

4

1.000

0.719

4

0.462

0.595

8

0.400

0.830

EanderPC-4

5

0.102

0.107

3

0.750

0.656

3

0.308

0.379

5

0.500

0.725

EanderPC-5

9

0.387

0.442

3

0.250

0.531

8

0.769

0.707

2

0.200

0.180

EanderPC-6

8

0.144

0.124

3

0.750

0.656

4

0.615

0.737

6

0.333

0.759

Na number of alleles, HO observed heterozygosity (in bold numbers, if values are significantly deviated from HWE), HE expected heterozygosity

For the dual-suppression PCR protocol, 28 clones were sequenced and all of them were found to contain microsatellite sequences. From four unique clones, locus-specific primers for nested PCR (IP1 and IP2) were designed. Single-banded fragments were observed for one locus (EanderP-12) and directly sequenced. After optimizing PCR conditions using the primer pairs (IP3/IP1, IP3/IP2), the IP3 primer was labeled with fluorescent dye (Table 1). PCR amplifications and genotyping were performed in the same manner as above.

For the improved compound microsatellite isolation protocol, genomic DNAs were separately digested by EcoRV and SspI. The blunt ends of the resulting fragments were ligated with a specific blunt adaptors (consisting of the 48-mer: 5′-GTAATACGACTCACTATAGGGCACGCGTGGTCGACGGCCCGGGCTGGT-3′ and an 8-mer with the 3′-end capped with an amino residue: 5′-ACCAGCCC-NH2-3′) using DNA Ligation Kit (TaKaRa). The fragments were amplified from the these libraries using compound SSR primer (AC)6(AG)7, (AC)6(TC)7, (AG)6(AC)7, or (TC)6(AC)7 and an adaptor primer (5′-CTATAGGGCACGCGTGGT-3′). Amplified fragments were cloned into pCR®2.1-TOPO vector using a TOPO TA Cloning Kit with One Shot TOP10 (Invitrogen). In total, 304 clones were sequenced and 216 clones were found to contain microsatellite sequences. Of these, sixty-nine clones were designed specific primer from the sequence flanking the compound SSR using Primer 3 ver. 0.4.0 (Rozen and Skaletsky 2000). Compound SSR primer (AC)6(AG)5 and (AG)6(AC)5 were labeled with fluorescent dye (Table 1). PCR amplifications were performed using KOD FX (TOYOBO) and a touchdown protocol [5 min at 95°C followed by two cycles of 30 s at 95°C, 30 s at a locus-specific annealing temperature (Table 1), and 30 s at 68°C, followed by 10 cycles of touchdown with a 0.5°C reduction in annealing temperature/cycle, and 30 cycles of final amplification]. Fragment sizes were determined using ABI 3130xl and genotyped using GeneMapper® 4.0. Finally six loci (EanderPC-n) were screened as polymorphic loci (Table 1).

Using the 10 identified loci, we genotyped four, thirteen, and ten individuals from three populations on Amami, Tokunoshima, and Okinawa Islands, respectively. Observed heterozygosity (HO) and expected heterozygosity (HE) in each population were calculated using GENALEX 6 (Peakall and Smouse 2006). FST and RST were also calculated using Arlequin ver 3.5 (Excoffier and Lischer 2010). Tests for deficiency of Hardy–Weinberg equilibrium (HWE) and linkage disequilibrium (LD) were performed using GENEPOP’007 (Rousset 2008). The observed allelic diversity ranged from 3 to 22 alleles among the three populations (Table 2). The observed heterozygosity (HO) and expected heterozygosity (HE) ranged from 0 to 1.000 and 0 to 0.876, respectively (Table 2). After Bonferroni correction, no significant LD occurred and only EanderPC-3 in the Okinawa population showed significant deviation from HWE. FST and RST distances showed greater genetic divergences among populations (Table 2).

In conclusion, the 10 microsatellite markers identified in this study have appropriate properties for use in future population genetic studies on Anderson’s crocodile newt across varying scales from inter- and intra- population to inter-individuals.

Acknowledgments

This work was supported by a Grant-in-Aid for Scientific Research (C) (No. 20510216) to M. S. and a Grant-in-Aid for Young Scientists (B) (No. 23710282) to T. I. from the Ministry of Education, Culture, Sports, Science and Technology, Japan.

Copyright information

© Springer Science+Business Media B.V. 2012

Authors and Affiliations

  • Hirotaka Sugawara
    • 1
  • Takeshi Igawa
    • 1
  • Masashi Yokogawa
    • 2
  • Masaru Okuda
    • 3
  • Shohei Oumi
    • 4
  • Seiki Katsuren
    • 5
  • Singo Kaneko
    • 2
  • Tetsuya Umino
    • 3
  • Yuji Isagi
    • 2
  • Masayuki Sumida
    • 1
  1. 1.Institute for Amphibian Biology, Graduate School of ScienceHiroshima UniversityHigashi-HiroshimaJapan
  2. 2.Graduate School of AgricultureKyoto UniversityKyotoJapan
  3. 3.Graduate School of Biosphere ScienceHiroshima UniversityHigashi-HiroshimaJapan
  4. 4.Section of Agriculture and ForestAmami City GovernmentAmamiJapan
  5. 5.Biology and Ecology GroupOkinawa Prefectural Institute of Health and EnvironmentNanjoJapan

Personalised recommendations