Conservation Genetics Resources

, Volume 2, Supplement 1, pp 385–387

Characterization of nine novel microsatellites isolated from Mozambique tilapia, Oreochromis mossambicus

Authors

    • Reproductive Genomics, Strategic Research ProgramTemasek Life Sciences Laboratory
  • Woo-Jai Lee
    • GenoMar AsA
  • Laszlo Orban
    • Reproductive Genomics, Strategic Research ProgramTemasek Life Sciences Laboratory
    • Department of Biological SciencesNational University of Singapore
Technical Note

DOI: 10.1007/s12686-010-9265-7

Cite this article as:
Saju, J.M., Lee, W. & Orban, L. Conservation Genet Resour (2010) 2: 385. doi:10.1007/s12686-010-9265-7
  • 79 Views

Abstract

Nine polymorphic microsatellites were isolated from a genomic DNA library of Oreochromis mossambicus enriched with di- and tetranucleotide repeats. The three di- and six tetranucleotide-type markers were characterized in 40 Mozambique tilapia individuals collected from a local farm. The number of alleles at the nine microsatellite loci ranged from 3 to 31, with an average of 13.4/locus. The average expected heterozygosity was 0.79 (range: 0.65–0.94), whereas the average observed heterozygosity was 0.67 (range: 0.33–1). Three loci significantly deviated from Hardy–Weinberg equilibrium, presumably due to limited population size. Cross-species amplification was successful for seven markers in Oreochromis niloticus, a phylogenetically closely related species and for six markers in Pseudotropheus lombardi, an ornamental cichlid for which no microsatellites have been described to date. These markers could provide important tools for the determination of genetic diversity and population structure of O. mossambicus.

Keywords

PolymorphicHeterozygosityCross-species amplification

Cichlid fishes are native to tropical regions of the Americas, Africa and Asia and have undergone spectacular adaptive radiations in the lakes of East Africa (Seehausen 2006; Schwarzer et al. 2009). Tilapias are a group of cichlids that are used for the biological control of aquatic weeds and insects, as baitfish and as food fish in aquaculture systems (Canonico et al. 2005). At the same time, their genetic resources have not always been managed well and some species have even become endangered (Agnese et al. 1997). The Mozambique tilapia (Oreochromis mossambicus) possesses greater tolerance to raised salinity and cold temperatures compared to most cultured Nile tilapia (Oreochromis niloticus) stocks (Gupta and Acosta 2004). The remaining natural populations of the Mozambique tilapia in the southern part of Africa are being threatened by hybridization with the rapidly spreading Nile tilapia (D’Amato et al. 2007). Therefore, Mozambique tilapia has been placed on the IUCN Red List of Threatened Species. There are only nine microsatellite sequences from the Mozambique tilapia in the GenBank database. Since these markers have not been characterized, their usefulness is limited.

In this study, we describe the isolation and characterization of nine new microsatellites from the genome of Mozambique tilapia. Genomic DNA was isolated from fin clips using Genomic DNA mini kit (Geneaid). Microsatellite-enriched libraries were developed from a single male. For characterization, fin clips were collected from 40 Mozambique tilapia individuals kept at a local fish farm, whereas the 12 Pseudotropheus lombardi samples for cross-species amplification were obtained from a local pet fish shop.

Microsatellite loci were isolated and cloned according to the protocol described earlier (Yue et al. 2000). The biotinylated oligo mixes used for double enrichment were the following: Mix 1 = (GA)6 + (CA)6; Mix 2 = (AAT)9 + (AGG)9; and Mix 3 = (GACA)8 + (GATA)8. Most of the recombinant clones contained inserts of suitable length (400–1,000 bp) and were sequenced on ABI377-96 sequencer (Applied Biosystems) using BigDye Terminator. Flanking primer pairs were designed using Primer Premier 5 (Premier Biosoft International) computer program. Tests for locus-specific amplification were according to Yue et al. (2000). The resulting data was analysed using GENESCAN and GENEMAPPER software programs (Applied Biosystems). Deviations from Hardy–Weinberg equilibrium (HWE) and genotypic linkage disequilibrium (LD) between all pairs of loci were analysed by using exact tests implemented in Cervus 3.0 software (Kalinowski et al. 2007) and Genetic Data Analysis software (Lewis and Zaykin 2001), respectively.

Of the 16 primer sets tested, nine showed reliable amplification. Among the nine markers, three were dinucleotide microsatellites and six were tetranucleotide microsatellites (Table 1). The average allelic number of these markers was 13.4/locus with a range of 3 to 31. The average expected heterozygosity was 0.79 (range: 0.65–0.94), whereas the average observed heterozygosity was 0.67 (range: 0.33–1). Following Bonferroni correction (Kalinowski et al. 2007), loci Om 03, 04 and 05 showed significant deviations from HWE presumably due to small population size and inbreeding. Significant linkage disequilibrium was observed between loci Om 05/06, 05/09 and 06/09 with Chi-Square P values 0.001, 0.001 and 0.009, respectively, suggesting that these three microsatellites may be linked. These microsatellite markers are expected to facilitate studies on genetic diversity and population structure of O. mossambicus.
Table 1

Nine novel microsatellite markers from the Mozambique tilapia (Oreochromis mossambicus)

Locus

Primer sequence (5′–3′)

Repeat motif

Ta (°C)

No. of alleles

Size range

(bp)

HE

HO

HWE P-value

GenBank accession no.

Om 01

FAM- TTTAAAGTTACACAGCAGTACAAAG

TTGTAGCATTTCAACACAGTCTC

(GT)20

55

12

118–170

0.846

1

0.1214

GU391020

Om 02

FAM- TGTGAATTTGACAACTTCCTTTC

ATCCTTGCAATAAGGTTACAG

(ATCT)30

55

20

138–362

0.892

1

0.1618

GU391021

Om 03

HEX- CTTTTTAATGAGCAACTTTTAAGTC

TGTGAATTTGACAACTTCCTTTC

(GATA)47

55

10

198–366

0.800

0.975

0.0002*

GU391022

Om 04

FAM- AGCTCAAAACCTCATACAAAGG

GCAGAGATGTCAGATGTTGTTC

(GACA)6 (GATA)16

55

14

198–278

0.862

1

0.0000*

GU391023

Om 05

HEX- GTAAAGTTTGGAACAGAAATGCT

GATCACTTTTGGACAGACTGG

(ATCT)22

55

31

144–348

0.940

0.800

0.0000*

GU391024

Om 06

FAM- TGAGCTACCGTAAGGATGTAC

GTTATTTCAATTATATTTGCATG

(GATA)14

50

3

126–156

0.662

0.550

0.1707

GU391025

Om 07

HEX- TTGGCTCAGAGTGGTCAGG

CGCGTGGACTAAAAGCCAG

(ATCT)8

59

12

166–290

0.896

0.325

0.0791

GU391026

Om 08

FAM- TGTTGGTTGGATTACTGGG

GCTGTAATGGTTTTGAGGC

(CA)21

55

5

167–203

0.712

0.850

0.1769

GU391027

Om 09

HEX- GGCTACAACACCTGGATGG

TTGGGCTTACTGAAGCTGAC

(GT)26

50

9

206–238

0.645

0.625

0.1624

GU391028

FAM primer labeled with 6-FAM, HEX primer labeled with HEX, Ta annealing temperature, HE expected heterozygosity, Ho observed heterozygosity; * indicated significant deviation from Hardy–Weinberg Equilibrium (HWE), P value < 0.05

Cross-species amplifications were performed on Oreochromis niloticus and Pseudotropheus lombardi, a cichlid species used in ornamental fish trade. Seven out of nine loci were amplified successfully from O. niloticus and showed polymorphism (Table 2). The same number of loci amplified from P. lombardi, but one of them (Om01) showed lack of polymorphism. One marker (Om09) failed to cross-amplify a product from either of the two cichlid species (Table 2). These are the first markers tested in this ornamental cichlid and could also be used for parentage tests to minimize the rate of inbreeding in breeding programs.
Table 2

Cross-species characterization of the nine microsatellite loci developed in Mozambique tilapia

Locus

Ta (°C)

Oreochromis niloticus

Pseudotropheus lombardi

No. of alleles

Size range (bp)

HE

HO

HWE P-value

No. of alleles

Size range (bp)

HE

HO

HWE P-value

Om 01

55

4

162–206

0.711

0.909

0.6597

1

178

Om 02

55

7

148–296

0.736

0.545

0.0713

10

178–272

0.88

1

0.7668

Om 03

55

8

174–216

0.844

0.727

0.5541

9

179–321

0.826

0.917

0.9643

Om 04

55

0

7

231–259

0.837

1

0.9115

Om 05

55

6

176–216

0.762

0.909

0.3398

7

216–292

0.786

0.833

0.6497

Om 06

50

6

118–168

0.775

0.545

0.0136*

0

Om 07

59

2

232–244

0.519

0

0.0025*

7

268–312

0.819

0.833

0.8568

Om 08

59

8

194–230

0.887

0.727

0.2428

2

178–180

0.344

0.417

0.8349

Om 09

50–60**

0

Ta annealing temperature, HE expected heterozygosity, Ho observed heterozygosity; * indicated significant deviation from Hardy–Weinberg Equilibrium (HWE), P value < 0.05; ** No products were observed through the whole temperature range

Acknowledgments

We acknowledge the technical help of David Bal in obtaining the tilapia samples, the advice provided by Grace Lin, Preethi Ravi, Felicia Feng, Dr. Chun Ming Wang and Dr. Gen Hua Yue and the help of Gandi Ng and Vidar Lund during marker characterization. Research in LO’s lab is financially supported by the Singapore Millenium Foundation and Temasek Holdings, Singapore.

Copyright information

© Springer Science+Business Media B.V. 2010