Conservation Genetics Resources

, 1:475

Development of microsatellite markers for Brachiaria humidicola (Rendle) Schweick

Authors

  • L. Jungmann
    • Plant Biotechnology LaboratoryEMBRAPA Beef Cattle
  • B. B. Z. Vigna
    • Center for Molecular Biology and Genetic EngineeringUniversity of Campinas (UNICAMP)
  • J. Paiva
    • Center for Molecular Biology and Genetic EngineeringUniversity of Campinas (UNICAMP)
  • A. C. B. Sousa
    • Center for Molecular Biology and Genetic EngineeringUniversity of Campinas (UNICAMP)
  • C. B. do Valle
    • Plant Biotechnology LaboratoryEMBRAPA Beef Cattle
  • P. R. Laborda
    • Center for Molecular Biology and Genetic EngineeringUniversity of Campinas (UNICAMP)
  • M. I. Zucchi
    • Agronomic Institute of Campinas (IAC)
    • Center for Molecular Biology and Genetic EngineeringUniversity of Campinas (UNICAMP)
    • Biology Institute, Plant Biology DepartmentUniversity of Campinas (UNICAMP)
Technical Note

DOI: 10.1007/s12686-009-9111-y

Cite this article as:
Jungmann, L., Vigna, B.B.Z., Paiva, J. et al. Conservation Genet Resour (2009) 1: 475. doi:10.1007/s12686-009-9111-y

Abstract

We describe the first panel of nuclear simple sequence repeats (SSRs) loci for Brachiaria humidicola (Rendle) Schweick., a warmseason grass with facultative apomixis, variation in ploidy levels (6X–9X), and important forage grass species in the Tropics. Of 38 pairs of primers obtained by using an enriched-library methodology, 27 revealed polymorphism in 58 accessions of the Germplasm Collection of B. humidicola held at Embrapa Beef Cattle, Brazil. Eleven loci amplified in B. dictyoneura, a closely related species with unclear taxonomic boundaries with B. humidicola. Transferability to other three Brachiaria species was also evaluated. The developed microsatellites are potentially useful for genetic studies of B. humidicola, as well as phylogenetic evaluations, conservation and breeding applications.

Keywords

Urochloa humidicolaKoroviniagrassSSRsTaxonomyGenetic diversity

Brachiaria (Trin.) Griseb. is a large genus of grasses that belongs to the tribe Paniceae, in the subfamily Panicoideae of the family Poaceae. It contains about 100 species distributed throughout the Tropics. Many aspects of taxonomic relationships among Brachiaria species and the related genera Urochloa, Eriochloa and Panicum remain unclear. Such taxonomic issues have been largely discussed since Brachiaria was elevated to the category of genus by Grisebach (1853).

Brachiaria humidicola (Rendle) Schweick. is an African perennial stoloniferous species that aposporous pseudogamus apomixis is the predominant reproduction mode. Although apomixes is facultative, in most genotypes it prevails over sexuality. Sexual biotypes analyzed to date are hexaploides, while apomitics present ploidy varying from hexa to nanoploids. According to the W3TROPICOS, the nomenclatural database of the Missouri Botanical Garden, this species has been classified as Urochloa dictyoneura (Fig. & De Not.) Veldkamp, by Veldkamp (1996), Brachiaria dictyoneura subspecies humidicola (Rendle) Catasús, by Catasús Guerra (2001) and Urochloa humidicola (Rendle) Morrone & Zuloaga, by Zuloaga and Morrone (2003). In fact, B. humidicola (Rendle) Schweick. is closely related to B. dictyoneura (Fig. & De Not.) Stap. and, at times, the identification of these two species is not unequivocal. The disputable taxonomic allocation of B. humidicola is, in part, a consequence of taxonomic studies based only on morphological descriptors. Based on internal transcribed spacer sequences of nuclear ribosomal DNA (ITS), Gonzalez and Morton (2005) reviewed taxonomic relationships among Brachiaria, Eriochloa, Urochloa, including U. humidicola within the classification of Morrone and Zuloaga (1992), and six other Paniceae species. Further investigations using markers spread across the genome have not been reported.

The present work describes the first panel of microsatellites (SSRs) isolated from B. humidicola, some of which can be transferred to other Brachiaria species. The objective was to develop SSR markers potentially useful for elucidating phylogenetic aspects within this taxon, and also for conservation and breeding purposes.

Genomic DNA samples were extracted from freeze-dried leaf samples using the cetyltrimethyl ammonium bromide (CTAB) method (Doyle and Doyle 1987). A genomic library was constructed using one B. humidicola genotype, following the methodology of Billotte et al. (1999) and according to Jungmann et al. (2009). A total of 384 clones were sequenced in an ABI 377 automated sequencer (PE Applied Biosystems) using the BigDye Terminator Cycle Sequencing Kit (Applied Biosystems). Thirty-eight pairs of primers were designed with the Primer Select 5.01 software (DNASTAR Inc.) and assayed in 58 genotypes of B. humidicola from the germplasm collection of Embrapa Beef Cattle.

Polymerase chain reactions (PCR) were carried out on a MJ Research PTC-100TM thermocycler in 25 µl final volume of reaction mixture consisting of buffer (20 mM Tris–HCl pH 8.4, 50 mM KCl and 1.5 mM MgCl), 50 ng of genomic DNA, 0.8 µM of each primer, 150 µM dNTPs and 1 U Taq DNA polymerase. After an initial denaturation step at 94°C for 1 min, PCR amplifications were performed in 30 cycles of 94ºC for 1 min, XºC for 1 min and 72ºC for 1 min, and a final elongation step at 72ºC for 7 min, being XºC the annealing temperature (Ta) for each locus (Table 1). Amplification products were resolved by electrophoresis in 3% agarose and 6% denaturing polyacrylamide gels, silver stained according to Creste et al. (2001).
Table 1

Description of SSR markers developed for B.humidicola

SSR locus

GenBank accession number

Repeat motif

Ta (ºC)

Predicted product size (bp)

Primer sequences (5′–3′)

Characteristics in B. humidicola

Transferabilitya,b

No. of bands

Size range (bp)

PIC

B. brizantha

B. decumbens

B. dictyoneura

B. ruziziensis

BhUNICAMP001

GQ981353

(GA)5

60

248

CATAGAAGCTCCTCAATGTGTTT

9

248–268

0.79

0/3

0/3

2/8

0/3

GATGGATATGGATGGGTGTAAT

BhUNICAMP002

GQ981354

(GT)3…(CTT)3…(GT)7…(CT)

60

251

AGCCATACCTCCTTGTTGT

8

236–264

0.72

1/3

3/3

7/8

0/3

AGCTCTTGATACCACTTGTTAG

BhUNICAMP003

GQ981355

(AC)6…(AT)3…(AT)3

60

193

CTGTCAGCATGGTTCACTAATAA

17

174–204

0.79

3/3

3/3

8/8

0/3

GCATCGAATAAAGCTCAGAAAG

BhUNICAMP004

GQ981356

(GT)10…(GT)3

60

231

AGTTTGCTGCCTCTTTGATTC

10

230–260

0.81

1/3

2/3

5/8

0/3

GTGGCGCTACCTTCTTGTG

BhUNICAMP005

GQ981357

(CA)8T(AC)3

62

205

CACTGCATCAACTACCCACCAC

12

180–218

0.86

3/3

2/3

8/8

2/3

GTCTGCTTTGCTTGCGTTACCT

BhUNICAMP006

GQ981358

(TTTG)4

48

226

ATGAAGAACGGCGATAAAT

7

196–218

0.64

0/3

0/3

0/8

0/3

AGCTGACCCCGATAACTG

BhUNICAMP007

GQ981359

(TG)16…(GCA)4

57

201

CTAGGCAACAAAGCACTCAAAA

10

179–212

0.61

0/3

0/3

0/8

0/3

GCACCACAACTCCATAGCAGAT

BhUNICAMP008

GQ981360

(GA)18

60

264

AACAGAATAACTGCGAGAAGG

9

248–278

0.56

1/3

0/3

6/8

0/3

ACTGAGCCGGTTGGAAATA

BhUNICAMP009

GQ981361

(AG)8

57

211

GGCTCTCGCTGGTCTGAAT

9

210–250

0.78

0/3

0/3

0/8

0/3

TGTGCTAGGCTCGGGAATAC

BhUNICAMP010

GQ981362

(TG)6

55

198

GGGTTCGTCGTCGTTTCTT

13

172–202

0.81

0/3

0/3

8/8

0/3

CAGTTGACCTACACCGCTACAC

BhUNICAMP011

GQ981363

(TA)5

57

193

ACGTTAACTTTCCCGCTTCT

4

192–198

0.55

0/3

0/3

1/8

0/3

TGCTAAATATGATCGCCAACT

BhUNICAMP012

GQ981364

(GT)9G(GA)5

60

166

TGGGTCAGCCGAAAACTC

11

160–182

0.74

2/3

2/3

2/8

2/3

TCGCCTTACTACGTCTGTCTCA

BhUNICAMP013

GQ981365

(TCA)6

60

205

TTTCTCGCCCTTTGTCTTCT

5

187–208

0.70

0/3

0/3

2/8

0/3

TTCATACCTCCACTGCCTCTAA

BhUNICAMP014

GQ981366

(AC)6AT(AC)4

57

262

GGAGTATGTGCTATGATTATGT

9

250–264

0.77

0/3

0/3

2/8

0/3

CAAAGGTCCTATTCGTGA

BhUNICAMP015

GQ981367

(GT)8

60

269

AGGGGAGAACTGTGGTGGTGTC

8

248–272

0.73

0/3

0/3

2/8

3/3

TCGAGTTTTGAGGGTGGGATTG

BhUNICAMP016

GQ981368

(CT)6(AT)6(GT)9

60

266

CATGCGTAGCCCCACTGT

21

260–320

0.95

3/3

0/3

2/8

0/3

GCTTTCCTTCATGTTCCTATCC

BhUNICAMP017

GQ981369

(GT)3GA(GT)3

60

219

ACTGCTTCTCGATGCTGTG

2

218–222

0.06

1/3

3/3

8/8

0/3

GTGTTTACGATGCCCTGAG

BhUNICAMP018

GQ981370

(AC)3TC(AC)4

62

197

TCCATATCCAACAAGGCAACAT

9

190–210

0.82

3/3

3/3

8/8

0/3

GCGCGAGCTGGTGAAGT

BhUNICAMP019

GQ981371

(AAAAC)3…(CT)17

60

262

ATGAGAGGGAAGGAAGGGTAGA

29

250–340

0.94

0/3

0/3

8/8

0/3

CTTAAAGTGGGTCAGTGTCGTC

BhUNICAMP020

GQ981372

(GCCG)3…(AC)9

60

231

CCGGCCGGTTCACTCGT

14

220–256

0.81

3/3

3/3

8/8

3/3

GGCACTCGGACTCCCATAACTC

BhUNICAMP021

GQ981373

(AG)18

60

311

TCACATGCTGCGAAGAAT

17

268–330

0.86

2/3

2/3

8/8

2/3

GCCATGTCCTCAGTTGTTT

BhUNICAMP022

GQ981374

(AG)17

60

223

TTAAGCAATGAGGAAGTGTGGA

15

190–242

0.83

0/3

0/3

8/8

0/3

ATGTTTTCAGTGGAGGGGTTCT

BhUNICAMP023

GQ981375

(CA)7

60

288

AGGCGTTGTATCTCCGTCGTCT

10

230–310

0.77

NE

NE

NE

NE

GGCTCACTCACTTCCCCACTG

BhUNICAMP024

GQ981376

(CA)7

60

194

TCAATGTCGCTCAGAAT

9

186–206

0.66

NE

NE

NE

NE

GACACTCTTTCGTTCAATG

BhUNICAMP025

GQ981377

(TC)3(TG)5(AG)5

60

184

GAGAGTGGGGTGCTATCAT

18

168–246

0.90

2/3

2/3

8/8

2/3

GACAGAGGGCGTATCACAT

BhUNICAMP026

GQ981378

(GT)7

60

233

CCTCCACGGGTTACTTCAAA

16

214–238

0.85

0/3

0/3

3/8

0/3

AAATATTCCGAGCTCCAACATC

BhUNICAMP027

GQ981379

(CT)16

60

199

CATTGGTCTGGCTTTGATTG

22

166–214

0.94

1/3

2/3

8/8

2/3

TGCACTTCCCTTGATGACTTAC

NE not evaluated

a Number of successfully amplified genotypes/Number of tested genotypes

b Nomenclatural classification: Brachiaria brizantha (Hochst. ex A. Rich.) Stap, Brachiaria decumbens Stap, Brachiaria dictyoneura (Fig. & De Not.) Stap, Brachiaria ruziziensis Germain & Evrard

Of the 38 SSRs primer pairs tested, 36 amplified successfully in B. humidicola and 27 SSRs were polymorphic (Table 1). Polymorphism Information Content (PIC) values for each locus was obtained according to Cordeiro et al. (2003) for 58 accessions of B. humidicola. Mean PIC of all loci was 0.75. The highest PIC values were 0.95, 0.94 and 0.94 for the loci BhUNICAMP016, BhUNICAMP019 and BhUNICAMP027, respectively. Therefore, these three loci are the most informative in this panel of SSRs. The locus BhUNICAMP017 resulted in a low PIC value (0.06), as expected because of its low polymorphism observed. This locus showed only two bands and one of these bands was present exclusively in one genotype, while the other was present in all genotypes (data not shown).

Transferability of the developed SSR primer pairs was tested in B. brizantha, B. decumbens, B. dictyoneura and B. ruziziensis for 25 microsatellite primer pairs, under the same PCR conditions used for B. humidicola. Number of successfully amplified genotypes per number of genotypes tested per species is indicated in Table 1. The primers used to amplify the SSR loci BhUNICAMP006, BhUNICAMP007 and BhUNICAMP009 did not amplify in any of the tested genotypes. In general, the highest success of transferability was obtained in B. dictyoneura, in which 22 SSR primer pairs were cross-amplified in at least one genotype. Of these 22 SSR primer pairs, 13 cross-amplified in more than 75% of the individuals evaluated from other Brachiaria species. These results were expected since the B. dictyoneura species is more closely related to B. humidicola than to the other three species (Renvoize et al. 1996; Gonzalez and Morton 2005). B. ruziziensis was a scoreless species in which only seven SSR primer pairs could be cross-amplified.

The data reported herein indicated that the SSR markers developed for B. humidicola represent a set of powerful genetic resources that are potentially useful for further studies of genetic diversity and mapping in B. humidicola and in other Brachiaria species.

Acknowledgements

The authors would like to thank Felipe Rodrigues da Silva for assisting with bioinformatics. This work was supported by grants from Brazilian Agricultural Research Corporation (EMBRAPA), Brazilian National Council for Scientific and Technological Development (CNPq), State of São Paulo Research Foundation (FAPESP) and Foundation for Science and Technological Development of the State of Mato Grosso do Sul (FUNDECT). The authors are also grateful to FUNDECT for graduate fellowship to Jungmann, L., FAPESP for undergraduate fellowships to Paiva, J. and Vigna, B.B.Z. and graduate fellowships to Sousa, A. C. B. and Laborda, P, R. and, to CNPq for a research fellowship awarded to Souza, A. P.

Copyright information

© Springer Science+Business Media B.V. 2009