Conservation Genetics Resources

, Volume 1, Issue 1, pp 373–376

Characterization of EST–SSRs from Cryptomeria japonica

Authors

  • Yoshinari Moriguchi
    • Department of Forest GeneticsForestry and Forest Products Research Institute
  • Saneyoshi Ueno
    • Department of Forest GeneticsForestry and Forest Products Research Institute
  • Tokuko Ujino-Ihara
    • Department of Forest GeneticsForestry and Forest Products Research Institute
  • Norihiro Futamura
    • Department of Molecular and Cell BiologyForestry and Forest Products Research Institute
  • Asako Matsumoto
    • Department of Forest GeneticsForestry and Forest Products Research Institute
  • Kenji Shinohara
    • Department of Molecular and Cell BiologyForestry and Forest Products Research Institute
    • Department of Forest GeneticsForestry and Forest Products Research Institute
Technical Note

DOI: 10.1007/s12686-009-9086-8

Cite this article as:
Moriguchi, Y., Ueno, S., Ujino-Ihara, T. et al. Conservation Genet Resour (2009) 1: 373. doi:10.1007/s12686-009-9086-8

Abstract

Simple sequence repeat (SSR) markers were developed for Cryptomeria japonica from 55,530 expressed sequence tags (ESTs). Of the 219 designed primer pairs, 176 showed clear PCR amplification products and 27 of these revealed polymorphisms in six individuals sampled at sites across Japan. When these 27 loci were examined in 48 individuals from a single population, the number of alleles and the Polymorphism Information Content (PIC) ranged from 2 to 17 and 0.09 to 0.86, respectively. The average PIC value obtained from EST–SSR markers (0.40) was lower than that from genomic SSR markers (0.67 and 0.62). We observed a significant departure from Hardy–Weinberg equilibrium in five of the 27 loci. These EST–SSR markers will be useful for the evaluation of genetic variation in C. japonica and for genetic mapping.

Keywords

Cryptomeria japonicaEST–SSR

Sugi (Cryptomeria japonica D. Don) is one of the most important commercial forest species in Japan; it has a government tree improvement program that began in 1957. The extant natural forests of C. japonica that have a very limited distribution are an important genetic resource in Japan. The evaluation of genetic variation in natural forests of C. japonica has been examined previously (Tsumura et al. 2007). In addition, to accelerate breeding, a genetic linkage map has been constructed (Tani et al. 2003). In the linkage map, however, the number of linkage groups is not consistent with the number of chromosomes. In this study, we developed EST-derived SSR markers for C. japonica to facilitate population genetic studies and to allow the construction of a high density linkage map.

An EST database for C. japonica (ForestGEN; http://forestgen.ffpri.affrc.go.jp/en/info_cj.html) has been constructed from several cDNA libraries (Tsumura et al. 1997; Ujino-Ihara et al. 2000, 2003, 2005; Futamura et al. 2006, 2008; Yoshida et al. 2007). The EST sequences were downloaded and processed by the read2Marker software (Fukuoka et al. 2005) using the default settings. A total of 219 primer pairs were designed for sequences from 55,530 ESTs. For each primer pair, PCR amplification was checked using two individuals. PCR amplifications were carried out using the GeneAmp 9700 PCR system (Applied Biosystems) in reaction mixtures with a total volume of 10 μl, containing: 20 mM Tris–HCl (pH 8.0), 50 mM KCl, 1.5 mM of MgCl2, 0.16 mM of each dNTP, 0.2 μM of each primer, 5 ng of template DNA, and 0.625 units of Go-Taq polymerase (PROMEGA). The PCR amplification conditions used were: 5 min at 94°C, then 30 cycles of 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C, followed by a 5 min extension step at 72°C. The PCR products were electrophoretically separated on 2% agarose gels stained with ethidium bromide. One hundred and seventy-six loci exhibited clear PCR amplification products with a single band. The polymorphism of these fragments was evaluated using six individuals sampled from different regions of Japan. The PCR products of each locus that were amplified using the above PCR protocol were labeled with ChromaTide Rhodamine Green-5-dUTP, as described by Kondo et al. (2000), and analyzed using an ABI3100 Genetic Analyzer (Applied Biosystems). Twenty-seven of these loci (Table 1), which yielded clear chromatograms and polymorphisms, were further screened for their suitability using 48 individuals from a natural population at Honna (37.25 E, 139.30 N). We performed multiplex PCR in 8 μl reaction volumes consisting of 1 × Multiplex PCR master mix (Qiagen), 0.2 μM of fluorescent-labeled forward primers, 0.2 μM of reverse primers and 5 ng of genomic DNA. The PCR amplification conditions used were: 15 min at 94°C, then 32 cycles of 30 s at 94°C, 90 s at 60°C, and 60 s at 72°C, followed by a 30 min extension step at 72°C. The PCR products were analyzed using an ABI3100 genetic analyzer.
Table 1

Characteristics and genetic variation of the 27 polymorphic EST–SSRs in the natural population of Cryptomeria japonica at Honna

Accession no.

Repeat motif

Primer sequence

Blastx top hit description [species]

E value

N

Na

PIC

Signifδ

BY897634

(GAA)3(GAT)9

F: ACGCAAAAGAATGCAAGTGTCCTA

Predicted protein [Physcomitrella patens subsp. patens]

6e-24

48

2

0.36

ns

R: GTTTGCAGCTTACAGAGGCTTTTTCC

AU298739

(TAA)8

F: ACATGTATGCAAACAAATCAACCC

Unknown [Picea sitchensis]

5e-44

35

4

0.43

*

R: GTTTGAAATGGAAGAGGTGTGGGCTAGA

BW992692

(AT)3ttttatagcaatacctataaacaaa(TA)4

F: ATACTGGATCTAAAAACATGCTCAC

Proton-dependent oligopeptide transport (POT) family protein [Arabidopsis thaliana]

2e-45

48

2

0.30

ns

R: GTTTCCTGCTCTGTGCTCAATGGTA

BY898881

(TC)3c(TA)4tgatatacag(CA)3

F: ATTTTCGAAGGACAAGACCCTGTG

Unnamed protein product [Vitis vinifera]

3e-21

48

6

0.81

*

R: GTTTCCACAAAAATGACCACTGTTCC

AU299114

(CGC)4

F: AGAAAAGAAAACGGAAACGGAAAC

Unknown [Picea sitchensis]

3e-12

48

2

0.18

ns

R: GTTTCTCATCCAGCTTCCCGTAATG

BY899142

(TC)20(AC)8

F: ATAGCAGGAGATGATCCAGACGTT

Unknown [Picea sitchensis]

2e-18

48

6

0.51

ns

R: GTTTGGCTATTATGTGTGTGCACATGG

BY899267

(TA)7

F: AAGAACACAAAGCCAAAGGGACAG

Unknown [Picea sitchensis]

4e-93

48

6

0.63

ns

R: GTTTCACCAAACTCTTAAGAAGGGAA

BY900594

(GAA)4

F: ATGTGTGGAAACAGAAGTGGGTCC

Ethylene-forming enzyme [Picea glauca]

1e-54

41

2

0.32

*

R: GTTTCGTGCAGTTCATTACATTACCGA

BY900902

(GGT)3gttgctgtcatttctgcttcgtcgcaa(ACC)3

F: ATGGAAGGAAAGTGAGGTGGGAAT

 

48

6

0.54

ns

R: GTTTCGCGGAGAGGATTAGATGAAGAC

BY900667

(TC)17

F: ACATTCATTCTTGTCCTTTGGAGG

 

48

17

0.86

ns

R: GTTTAATTCCTGCTTTTAGGCTGC

BY893784

(GT)3ttttatttgtttgaacattttagat(CA)3

F: ATGCATGAGCATGACAAGAAGAGC

Putative pectin methylesterase [Picea abies]

3e-58

48

3

0.39

ns

R: GTTTAGCGCTACTGCAACTTTAGCCATC

BY887283

(AT)3ttcgctat(CG)3gtcgaattctcagagac (CT)3tcacttcgatggcttc(AG)3

F: ACAAAGTGCCAGCCCTAAGTACAA

Predicted protein [Physcomitrella patens subsp. patens]

2e-39

48

2

0.11

ns

R: GTTTCGGGAAGGGTTTTCCTCTTCTCTA

BY883996

(CCA)3(GC)3

F: ATCAAAACTCAATTCTTCGGCCAC

Hypothetical protein OsJ_021819 [Oryza sativa (japonica cultivar-group)]

4e-35

48

2

0.21

ns

R: GTTTGAGAGGGAGTAGCGGTTTGTAGGG

 

BY883611

(AG)6

F: ACAAGCTCTGTAATTGGAAAGGGG

Unnamed protein product [Vitis vinifera]

5e-32

48

3

0.40

ns

R: GTTTATTAACGAGACGGGCGACAATC

BY888980

(TC)3tacaccacgcttacctcccc(TC)4

F: ACAACTTTAGATGGCGTGCAAGGT

 

48

3

0.33

ns

R: GTTTCCCTTCAAACAAACCAATTCATCC

BW993777

(TA)7

F: AGGTAATTTTCGGGTTTTGTCGAT

Predicted protein [Physcomitrella patens subsp. patens]

1e-104

47

2

0.38

ns

R: GTTTGAAAACAAAGAACATTTGCCAGCC

AU085154

(GC)3tagaggagaagaggagga(AC)3

F: AGGCACGAACACCCATCTGATATT

 

48

2

0.33

ns

R: GTTTGAAGCAGACATGCAACTGAGC

BP175537

(CGA)5

F: ATTGAAAGCACAAACGAACACCCT

 

48

2

0.30

ns

R: GTTTCTATGATATCGATCTTTCCGCCG

BY910397

(TA)6

F: ATTGCTCATTGCACTGCCGATTAC

Unnamed protein product [Vitis vinifera]

2e-05

48

2

0.37

ns

R: GTTTGACGTCCATTACCCACTAACCCAA

BY909057

(CGC)10

F: ATACCCTATGGCGTCTGTGCTGTA

Cysteine protease [Gossypium hirsutum]

1e-43

48

6

0.74

*

R: GTTTCTCGTCAGAGGCACAGTACGAA

BY908968

(TC)3tgttgaatccttttcataa(ATT)3

F: ACCTAGGGCTTCTCTTTCTCTTTTTC

 

48

2

0.19

ns

R: GTTTCATGGAAGCTATGCCGTTCAGTA

DC432202

(TA)4cactgtgtatacgtctgacgtgg(TA)3

F: ATCCCCAGATTATTTTTGGGTGCT

Predicted protein [Physcomitrella patens subsp. patens]

1e-70

44

2

0.36

ns

R: GTTTCCAATGCCCAGCTCATTAAATC

BY896143

(TA)4catc(TA)4

F: AGCTGGGTCAATTAAATCCTTCTG

Unknown [Picea sitchensis]

1e-39

48

2

0.36

ns

R: GTTTCCCCCAAAGATCCTCAGGTAACAT

BY894091

(CT)3tttca(AT)3

F: ATTTTGTCCGCTGCTATTACCGAT

Hypothetical protein [Vitis vinifera]

3e-05

47

3

0.20

ns

R: GTTTCCATGAGGTGAGCTTGCTGTTAGA

BY894295

(GCA)4atgatgata(TCT)3

F: ATCTGGAGTTTGAAGGAGCCAAAA

Predicted protein [Physcomitrella patens subsp. patens]

1e-27

43

3

0.46

*

R: GTTTGATCTTCACACCACCCTGAG

BJ939325

(GCA)4

F: ATAATAAGGGGAGAATGTCTGGGG

Unknown [Solanum tuberosum]

2e-23

42

2

0.09

ns

R: GTTTGCTGCTCTCGATCCATTTCAATA

BJ939490

(TC)9

F: ACTTGTTTATTTTGGCAGGCGAGT

 

48

5

0.63

ns

R: GTTTACAGCCTTAACACATCAGACGCAG

N Number of individuals genotyped, Na Number of alleles per locus, PIC polymorphic information contents

δ Deviation from Hardy–Weinberg equiliburium, ns not significant, * P < 0.05

Twenty-seven of the 176 loci were polymorphic with a clear fragment pattern. Genetic diversity parameters assessed included the observed number of alleles (Na) and the Polymorphism Information Content (PIC), which were calculated by the G-DIVERSE program developed by H. Iwata (http://cse.naro.affrc.go.jp/iwatah/). The significance of deviations from Hardy–Weinberg equilibrium (HWE) and genotypic disequilibrium for all locus-pairs was tested using randomization by the FSTAT software (Goudet 1995). The number of alleles and PIC ranged from 2 to 17 and 0.09 to 0.86, respectively (Table 1). The average PIC value obtained from the EST–SSRs (0.40) was lower than that from genomic SSR markers (0.67; Moriguchi et al. 2003, 0.62; Tani et al. 2004). This is consistent with reports about a number of other taxa (Eillis and Burke 2007). We observed a significant departure from HW in 5 of the 27 loci (Table 1). No significant genotype disequilibrium was found for any loci-pair. Twenty of the 27 loci showed similarities with other proteins and therefore we proposed putative functions (Table 1). These EST–SSRs will be useful for evaluating the genetic variation in C. japonica populations and genome mapping.

Acknowledgments

The authors would like to thank Drs. Maki Saito and Hideaki Taira for providing samples. We are also grateful to Mr. Yasuyuki Komatsu for assistance with laboratory work. This work was supported by a Grant-in-Aid (Development of Technologies for Control of Pollen Production by Genetic Engineering) from the Forest Agency of Japan and Program for Promotion of Basic and Applied Researches for Innovations in Bio-oriented Industry.

Copyright information

© Springer Science+Business Media B.V. 2009