Food Analytical Methods

, Volume 4, Issue 3, pp 437–445

Construction and Analytical Application of Internal Amplification Controls (IAC) for Detection of Food Supply Chain-Relevant Viruses by Real-Time PCR-Based Assays

  • Marta Diez-Valcarce
  • Katarina Kovač
  • Nigel Cook
  • David Rodríguez-Lázaro
  • Marta Hernández
Open AccessArticle

DOI: 10.1007/s12161-011-9224-2

Cite this article as:
Diez-Valcarce, M., Kovač, K., Cook, N. et al. Food Anal. Methods (2011) 4: 437. doi:10.1007/s12161-011-9224-2

Abstract

Internal amplification controls (IACs) were constructed for incorporation into real-time nucleic acid amplification assays for bovine polyomavirus, hepatitis A virus, hepatitis E virus, human adenovirus, human norovirus genogroup I, human norovirus genogroup II, murine norovirus and porcine adenovirus. The addition of optimised amounts of IAC into the assays did not affect the limits of detection for each specific target virus. A poorly performed extraction of viral nucleic acids was simulated, and the effectiveness of IACs in identifying failed assays was demonstrated. The IACs constructed in this study can be reliably used in their specific assays to provide a robust control that can be routinely applied in the analysis of foods for viruses.

Keywords

Internal amplification controlFalse negativesReal-time PCRFoodEnteric virus

Introduction

Gastroenteritis produced by ingestion of food contaminated with enteric viruses is an important concern for public health. Thus, detection of the presence of enteric viruses—particularly norovirus, hepatitis A and E and adenovirus—in foods is an important issue in food safety, and a rapid and robust diagnostic methodology is needed (Croci et al. 2008; Greening and Hewitt 2008; Cook and Rzezutka 2006). Because at present most of these viruses cannot, or with difficulty, be cultured and integrated cell culture real-time PCR methods are useful but too time-consuming for the quick results required by the food industry, a detection approach based on nucleic acid amplification is necessary (Rodríguez-Lázaro et al. 2007; Bosch et al. 2011). However, the application of nucleic acid amplification to foodstuffs can be complicated by the presence of inhibitory substances (Rodríguez-Lázaro et al. 2004, 2006; Rodríguez-Lázaro and Hernandez 2006), which can cause false negative interpretations of the results. It is imperative therefore for the effective implementation of nucleic acid amplification in food analysis that appropriate controls are used to verify there has been no interference caused by the presence of inhibitory substances (Rodríguez-Lázaro et al. 2007; Bosch et al. 2011). The incorporation of an internal amplification control (IAC) will identify failed reactions (Bosch et al. 2011; Rodríguez-Lázaro et al. 2004, 2007). An IAC is a non-target nucleic acid sequence present in every reaction which can be co-amplified simultaneously with the target sequence (Cone et al. 1992). In a reaction without an IAC, a negative response can mean either that there is no target sequence present in the reaction or that the amplification has been inhibited. However, with the use of an IAC in each reaction, the absence of response both from the target and the IAC indicates that the reaction has failed, and the sample must be retested to avoid any false negative interpretation of its analysis.

The aim of this study was to construct IACs for nucleic acid amplification assays for viruses relevant to the analysis of foods and to define their analytical application. The viruses were human norovirus genogroups I (NoVGI) and II (NoVGII), hepatitis A virus (HAV) and hepatitis E virus (HEV), murine norovirus (MNV; which could be used to assess the efficiency of a pre-nucleic acid amplification sample treatment), human adenovirus (HAdV; which could be used to indicate that routes of virus contamination exist from human sources), porcine adenovirus (PAdV; which could be used to indicate that routes of virus contamination exist from porcine sources) and bovine polyomavirus (BPyV; which could be used to indicate that routes of virus contamination exist from bovine sources).

Materials and Methods

Viruses and Viral Nucleic Acids

Bovine polyomavirus DNA and porcine adenovirus DNA were kindly provided by Professor Rosina Gironés of the University of Barcelona, Spain. Hepatitis A virus suspension was kindly provided by Dr. Dario de Medici of the Istituto Superiore de Sanità, Rome, Italy. Hepatitis E virus RNA was kindly provided by Dr. Malcolm Banks of the Veterinary Laboratories Agency, Weybridge, UK. Murine norovirus (MNV1) was supplied by Herbert W. Virgin IV, Washington University School of Medicine (US) and human adenovirus type 2 (HAdV2) was provided by Dr. Rosina Girones at the University of Barcelona (Spain), both viruses were replicated in the Dr. Franco Ruggeri’s laboratory at the Istituto Superiore de Sanità (Rome, Italy). MNV1 was propagated in RAW264.7 cells and titrated by end-point dilution (final stock concentration, 107 TCID50/ml). HAdV-2 was propagated in A549 cells and titrated by the same technique (final stock concentration, 107 TCID50/ml). Human norovirus genogroup I RNA and human norovirus genogroup II RNA were kindly provided by Dr. Ana Maria de Roda Husman of RIVM, Bilthoven, The Netherlands.

Primers and Probes

The oligonucleotides used in this study are shown in Tables 1 and 2. IAC primers were designed using the software Primer Express™ version 2.0 (Applied Biosystems, Foster City, CA, USA). All oligonucleotides were purchased from MWG Biotech AG (Ebersberg, Germany), except the minor groove binder (MGB) TaqMan probes HAV150(−), MGB-ORF1/ORF2 and PrfAP that were acquired from Applied Biosystems (Warrington, UK) and NV1LCpr that was from Sigma-Aldrich (St. Louis, MO, USA).
Table 1

Hybrid oligonucleotides designed in this study for the construction of the IACs and probe used for IAC detection

Target

Name

Type

Sequence (5′–3′)

IAC size (bp)

BPyV

QB-F1-1IAC

Forward primer

CTAGATCCTACCCTCAAGGGAATGGCTCTATTTGCGGTC

115

QB-R1-1IAC

Reverse primer

TTACTTGGATCTGGACACCAACTCTTGATGCCATCAGGA

HAV

HAVIACF

Forward primer

TCACCGCCGTTTGCCTAGGGCTCTATTTGCGGTC

107

HAVIACR

Reverse primer

GGAGAGCCCTGGAAGAAAGTCTTGATGCCATCAGGA

HEV

HEVIACF

Forward primer

GGTGGTTTCTGGGGTGACGGCTCTATTTGCGGTC

106

HEVIACR

Reverse primer

AGGGGTTGGTTGGATGAATCTTGATGCCATCAGGA

HAdV

IACAdF

Forward primer

CWTACATGCACATCKCSGGGGCTCTATTTGCGGTCAACTT

107

IACAdR

Reverse primer

CRCGGGCRAAYTGCACCAGTCTTGATGCCAT

NoVGI

NOR1IACF

Forward primer

CGCTGGATGCGNTTCCATGGCTCTATTTGCGGTC

111

NOR1IACR

Reverse primer

CCTTAGACGCCATCATCATTTACTCTTGATGCCATCAGGA

NoVGII

NOR2IACF

Forward primer

ATGTTCAGRTGGATGAGRTTCTCWGAGGCTCTATTTGCGGTC

117

NOR2IACR

Reverse primer

TCGACGCCATCTTCATTCACATCTTGATGCCATCAGGA

MNV1

IACMuNvF

Forward primer

CACGCCACCGATCTGTTCTGGGCTCTATTTGCGGT

107

IACMuNvR

Reverse primer

GCGCTGCGCCATCACTCTCTTGATGCCATCAG

PAdV

IACPAdF

Forward primer

AACGGCCGCTACTGCAAGGGCTCTATTTGCGGTC

105

IACPAdR

Reverse primer

AGCAGCAGGCTCTTGAGGTCTTGATGCCATCAGGAG

L. monocytogenes

PrfAP

Probe

VIC-CCATACACATAGGTCAGG-MGBNFQ

 

The sequences shown in bold are identical in each forward or reverse primer and correspond to a fragment of the L. monocytogenes prfA gene. Sequences underlined are identical to the specific primers for each target virus. Bases within the degenerated primers correspond to W = A or T; Y = C or T; K = G or T; R = A or G; S = C or G and N = A, T, C or G

Table 2

Oligonucleotides used in this study to detect target viruses by real-time or RT real-time-PCR

Target

Name

Type

Sequence (5′–3′)

Amplicon size (bp)

Reference

BPyV

QB-F1-1

Forward primer

CTAGATCCTACCCTCAAGGGAAT

77

Hundesa et al. (2010)

QB-R1-1

Reverse primer

TTACTTGGATCTGGACACCAAC

QB-P1-2

Probe

6FAM-GACAAAGATGGTGTGTATCCTGTTGA -BHQ

HAV

HAV68

Forward primer

TCACCGCCGTTTGCCTAG

173

Costafreda et al. (2006)

HAV240

Reverse primer

GGAGAGCCCTGGAAGAAAG

HAV150(−)

Probe

6FAM-CCTGAACCTGCAGGAATTAA-MGBNFQ

HEV

JVHEVF

Forward primer

GGTGGTTTCTGGGGTGAC

70

Jothikumar et al. (2006)

JVHEVR

Reverse primer

AGGGGTTGGTTGGATGAA

JVHEVP

Probe

6FAM-TGATTCTCAGCCCTTCGC-BHQ

HAdV

AdF

Forward primer

CWTACATGCACATCKCSGG

69

Hernroth et al. (2002)

AdR

Reverse primer

CRCGGGCRAAYTGCACCAG

AdP1

Probe

6FAM-CCGGGCTCAGGTACTCCGAGGCGTCCT-BHQ

NoVGI

QNIF4

Forward primer

CGCTGGATGCGNTTCCAT

86

Svraka et al. (2007)

NV1LCR

Reverse primer

CCTTAGACGCCATCATCATTTAC

NV1LCpr

Probe

6FAM-TGGACAGGAGAYCGCRATCT-BHQ

NoVGII

QNIF2d

Forward primer

ATGTTCAGRTGGATGAGRTTCTCWGA

89

da Silva et al. (2007)

COG2R

Reverse primer

TCGACGCCATCTTCATTCACA

QNIFS

Probe

6FAM-AGCACGTGGGAGGGCGATCG-BHQ

MNV1

Fw-ORF1/ORF2

Forward primer

CACGCCACCGATCTGTTCTG

109

Baert et al. (2008)

Rv-ORF1/ORF2

Reverse primer

GCGCTGCGCCATCACTC

MGB-ORF1/ORF2

Probe

6FAM-CGCTTTGGAACAATG-MGB-NFQ

PAdV

Q-PAdV-F

Forward primer

AACGGCCGCTACTGCAAG

68

Hundesa et al. (2009)

Q-PAdV-R

Reverse primer

AGCAGCAGGCTCTTGAGG

Q-PAdV-P

Probe

6FAM-CACATCCAGGTGCCGC-BHQ

Probes were labelled with 6FAM at the 5′ end and MGB-NFQ or BHQ at the 3′ end

6FAM 6-carboxyfluorescein, MGB-NFQ minor groove binder non-fluorescent quencher, BHQ black hole quencher

Bovine Polyomavirus Real-Time PCR

This assay was a duplex real-time PCR using the primers and conditions described by Hundesa et al. (2010), with the inclusion of an IAC and a carryover contamination prevention system utilising uracil N-glycosylase (UNG). The reaction contained 1× TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 0.4 μM each primer, 0.120 μM bovine polyomavirus TaqMan probe (labelled with FAM), 50 nM IAC probe (labelled with VIC) and varying copies of bovine polyomavirus IAC. A 10-μl sample of nucleic acid extract was added to make a final reaction volume of 25 μl. The thermocycling conditions were 10 min at 95 °C, followed by 45 cycles of 15 s at 95 °C and 1 min at 60 °C.

Hepatitis A Virus Reverse Transcription Real-Time PCR

This assay was a one-step duplex reverse transcription real-time PCR using the primers and conditions described by Costafreda et al. (2006), with the inclusion of an IAC. The reaction contained 1× RNA Ultrasense reaction mix (Invitrogen, Carlsbad, CA, USA), 0.5 μM primer HAV68, 0.9 μM primer HAV240, 0.25 μM probe HAV150(−) (labelled with FAM), 50 nM IAC probe (labelled with VIC), 1× ROX reference dye (Invitrogen), 1 μl RNA Ultrasense enzyme mix (Invitrogen) and varying copies of HAV IAC. A 10-μl sample of nucleic acid extract was added to make a final reaction volume of 20 μl. The thermocycling conditions were 15 min at 50 °C, 2 min at 95 °C, followed by 45 cycles of 15 s at 95 °C and 1 min at 60 °C.

Hepatitis E Virus Reverse Transcription Real-Time PCR

This assay was a one-step duplex reverse transcription real-time PCR using the primers and conditions described by Jothikumar et al. (2006), with the inclusion of an IAC. The reaction contained 1× RNA Ultrasense reaction mix (Invitrogen), 0.25 μM each primer, 0.1 μM probe HEV-P (labelled with FAM), 50 nM IAC probe (labelled with VIC), 1× ROX reference dye (Invitrogen), 1 μl RNA Ultrasense enzyme mix (Invitrogen) and varying copies of HEV IAC. A 10-μl sample of nucleic acid extract was added to make a final reaction volume of 20 μl. The thermocycling conditions were 15 min at 50 °C, 2 min at 95 °C, followed by 45 cycles of 10 s at 95 °C, 20 s at 55 °C and 15 s at 72 °C.

Human Adenovirus Real-Time PCR

This assay was a duplex real-time PCR using the primers and conditions described by Hernroth et al. (2002), with the inclusion of an IAC and a carryover contamination prevention system utilising UNG. The reaction contained 1× TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 0.9 μM each primer, 0.225 μM adenovirus TaqMan probe (labelled with FAM), 50 nM IAC probe (labelled with VIC) and varying copies of adenovirus IAC. A 10-μl sample of nucleic acid extract was added to make a final reaction volume of 25 μl. The thermocycling conditions were 10 min at 95 °C, followed by 45 cycles of 15 s at 95 °C and 1 min at 60 °C.

Human Norovirus ggI Reverse Transcription Real-Time PCR

This assay was a one-step duplex reverse transcription real-time PCR using the primers and conditions described by Svraka et al. (2007), with the inclusion of an IAC. The reaction contained 1× RNA Ultrasense reaction mix (Invitrogen), 0.5 μM primer QNIF4, 0.9 μM primer NV1LCR, 0.25 μM probe NV1LCpr (labelled with FAM), 50 nM IAC probe (labelled with VIC), 1× ROX reference dye (Invitrogen), 1 μl RNA Ultrasense enzyme mix (Invitrogen) and varying copies of norovirus ggI IAC. A 10-μl sample of nucleic acid extract was added to make a final reaction volume of 20 μl. The thermocycling conditions were 15 min at 50 °C, 2 min at 95 °C, followed by 45 cycles of 15 s at 95 °C and 1 min at 60 °C.

Human Norovirus ggII Reverse Transcription Real-Time PCR

This assay was a one-step duplex reverse transcription real-time PCR using the primers and conditions described by da Silva et al. (2007), with the inclusion of an IAC. The reaction contained 1× RNA Ultrasense reaction mix (Invitrogen), 0.5 μM primer QNIF2, 0.9 μM primer COG2R, 0.25 μM probe QNIFS (labelled with FAM), 50 nM IAC probe (labelled with VIC), 1× ROX reference dye (Invitrogen), 1 μl RNA Ultrasense enzyme mix (Invitrogen) and varying copies of norovirus ggII IAC. A 10-μl sample of nucleic acid extract was added to make a final reaction volume of 20 μl. The thermocycling conditions were 15 min at 50 °C, 2 min at 95 °C, followed by 45 cycles of 15 s at 95 °C and 1 min at 60 °C.

Murine Norovirus Reverse Transcription Real-Time PCR

This assay was a one-step duplex reverse transcription real-time PCR using the primers and conditions described by Baert et al. (2008), with the inclusion of an IAC. The reaction contained 1× RNA Ultrasense reaction mix (Invitrogen), 0.2 μM each primer, 0.2 μM probe MGB-ORF1/ORF2 (labelled with FAM), 50 nM IAC probe (labelled with VIC), 1× ROX reference dye (Invitrogen), 1 μl RNA Ultrasense enzyme mix (Invitrogen) and varying copies of murine norovirus IAC. A 10-μl sample of nucleic acid extract was added to make a final reaction volume of 20 μl. The thermocycling conditions were 15 min at 50 °C, 2 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C.

Porcine Adenovirus Real-Time PCR

This assay was a duplex real-time PCR using the primers and conditions described by Hundesa et al. (2009), with the inclusion of an IAC and a carryover contamination prevention system utilising UNG. The reaction contained 1× TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 0.9 μM each primer, 0.225 μM porcine adenovirus TaqMan probe (labelled with FAM), 50 nM IAC probe (labelled with VIC) and varying copies of porcine adenovirus IAC. A 10-μl sample of nucleic acid extract was added to make a final reaction volume of 25 μl. The thermocycling conditions were 10 min at 95 °C, followed by 45 cycles of 15 s at 95 °C, 20 s at 55 °C and 20 s at 60 °C.

IAC Construction

The principles for the construction of IACs can be explained in two different phases: First, PCR amplification of non-target DNA is performed using hybrid oligonucleotide primers. This produces a chimeric DNA molecule containing non-target sequences flanked by target sequences complementary to the virus-specific primers. This molecule is then cloned into a plasmid. If the IAC is for RNA virus detection, the plasmid should contain a T7 RNA polymerase promoter, and IAC RNA transcripts are subsequently produced by T7 RNA polymerase. The plasmid or the RNA transcript is the chimeric IAC which is co-amplified with the virus primers and detected using a fluorescent probe complementary to the internal non-target sequence (Fig. 1). When using a real-time PCR-based assay, the virus target amplicons are detected with specific hydrolysis probes, labelled with one fluorophore (e.g. FAM), and the IAC amplicons are detected with the specific IAC probe, labelled with a different fluorophore (e.g. VIC).
https://static-content.springer.com/image/art%3A10.1007%2Fs12161-011-9224-2/MediaObjects/12161_2011_9224_Fig1_HTML.gif
Fig. 1

IAC construction

Each IAC in this study was designed as a DNA or RNA molecule containing sequences from the prfA gene from Listeria monocytogenes (nucleotide positions 2281–2348, AN AY512499) flanked by the sequences complementary to the primers used in the specific assays. With the exception of the prfA sequence, the IAC sequences did not show significant similarity to any other sequence deposited in public databases, as shown by BLAST-N searches (National Center for Biotechnology Information, Bethesda, MD, USA; www.ncbi.nlm.nih.gov). The chimeric DNA molecules were generated by PCR as previously described (Rodríguez-Lázaro et al. 2004, 2005) using as template 5 ng of L. monocytogenes strain CECT 935 DNA and the specific set of construction hybrid primers for each IAC (Table 1), which contained the corresponding prfA target sequence plus a 5′ tail with the virus forward/reverse primer sequences. The PCR products were excised from a 2% 1× TBE agarose gel and purified using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), then cloned into the pCR 2.1-TOPO Vector (Invitrogen) in the case of IACs for the HAV, HEV and NoVGII assays or into the pGEM-T Easy Vector (Promega, Madison, WI, USA) in the case of IACs for the NoVGI, BPyV, HAdV, PAdV and MNV1 assays. The concentration and quality of the plasmid DNA stock solutions were determined by fluorimetry using Quant-iT PicoGreen dsDNA reagents (Invitrogen) in a NanoDrop 3300 Fluorospectrometer (Thermo Fisher Scientific, Wilmington, DE, USA).

Production of IAC RNA

In vitro transcription was performed to obtain RNA fragments for the HAV, HEV, NoVGI, NoVGII and MNV1 IACs using the Riboprobe System—T7 (Promega). To prevent carryover contamination by DNA, RNA was treated with DNase (RQ1 RNase-free DNase, Promega) at a concentration of 1 U/μg for 15 min at 37 °C, then purified using an RNeasy Mini Kit (Qiagen) according to the manufacturer’s recommendations. The concentration and purity of the RNA stock solutions were determined by fluorimetry using Quant-iT RiboGreen RNA and Quant-iT PicoGreen dsDNA reagents (Invitrogen) in a NanoDrop 3300 Fluorospectrometer (Thermo Fisher Scientific).

Copy Number Calculation

The number of IAC copies was calculated by dividing the amount of IAC in each stock solution by the weight of one IAC molecule, as follows:
$$ {\hbox{DNA IAC copies }} = {\hbox{ g in the IAC stock/}}\left( {{\hbox{bp}}\; \times \;{66}0{\hbox{ DA/bp}}\; \times \;{1}.{6}\; \times \;{1}{0^{{ - {27}}}}\;{\hbox{kg/DA}}\; \times \;{1}\; \times \;{1}{0^{{ - {3}}}}\;{\hbox{g/kg}}} \right) $$
$$ {\hbox{RNA IAC copies}} = {\hbox{g in the IAC stock/}}\left( {{\hbox{bp}}\; \times \;{32}0{\hbox{ DA/bp}}\; \times \;{1}.{6}\; \times \;{1}{0^{{ - {27}}}}\;{\hbox{kg/DA}}\; \times \;{1}\; \times \;{1}{0^{{ - {3}}}}\;{\hbox{g/kg}}} \right) $$

Optimization of IAC-Containing Nucleic Acid Amplification Assays

After construction and copy number calculation of the IACs, the following steps were performed, in this particular order:
  1. 1.

    Verification that the IAC could be amplified and detected in a uniplex assay

     
  2. 2.

    Verification that the IAC and the template could be simultaneously amplified and detected in the same reaction tube, i.e. a duplex assay

     
  3. 3.

    Optimization of the IAC probe concentration by performing (reverse transcription) real-time PCRs without virus nucleic acids but containing 3,000 IAC copies (or 2,000 IAC copies for RNA virus methods), 100 nM of virus target probe and increasing amounts of the IAC probe (25, 50 and 100 nM)

     
  4. 4.

    Determination of the optimal amount of IAC. First, each assay’s target consistent limit of detection (LOD) was determined in the absence of an IAC by establishing the lowest number of genome equivalents (GE) that could be detected in every one of five replicate reactions. Then, decreasing numbers of IACs (down to approximately one copy) were added, and the lowest IAC number which could be consistently detected in five replicate reactions without affecting the LOD of the target was established

     

Demonstration of IAC Applicability in the Detection of Viruses in Food

To demonstrate the effectiveness of the IAC approach, a foodstuff artificially contaminated with two virus types was analysed. Strawberry puree (25 g) was placed into a sterile plastic bag. Approximately 106 TCID50 of human adenovirus and 106 TCID50 of murine norovirus were added to the puree. The sample was then processed using the method of Dubois et al. (2006). Approximately 25 g fruit was placed in a sterile beaker. Forty millilitres of Tris-glycine, pH 9.5, buffer containing 1% beef extract and 6,500 U pectinase (Pectinex™ Ultra SPL Solution, Sigma) was added to the sample, which was then agitated at room temperature for 20 min by rocking at 60 rpm. The pH was maintained at 9.0 throughout (if necessary adjusting using 4% (w/v) sodium hydroxide, extending the period of agitation by 10 min each time an adjustment was made. In strongly coloured berries, a change in colour of the eluate from blue/purple to red was considered indicative of acidification and was used to trigger pH adjustment). The liquid was decanted from the beaker through a strainer (e.g. a tea strainer) into one 50-ml or two smaller centrifuge tubes and centrifuged at 10,000×g for 30 min at 4 °C. The supernatant(s) was decanted into a single clean tube or bottle and the pH adjusted to 7.2. Volumes (0.25) of 50% (w/v) polyethylene glycol 8000/1.5 M NaCl were then added and mixed by shaking for 1 min. The suspension was then incubated with gentle rocking at 4 °C for 60 min before centrifugation at 10,000×g for 30 min at 4 °C. The supernatant was discarded and the pellet compacted by centrifugation at 10,000×g for 5 min at 4 °C before resuspension in 500 μl phosphate-buffered saline. The suspension was then transferred to a chloroform-resistant tube, and 500 μl chloroform/butanol (1:1) was added and mixed by vortexing. The sample was allowed to stand for 5 min and then centrifuged at 10,000×g for 15 min at 4 °C. The aqueous phase was transferred to a clean tube and immediately used for nucleic acid extraction or stored at −20 °C. Nucleic acids were extracted using a NucliSENS miniMAG kit (bioMérieux, Marcy l’Etoile, France) according to the manufacturer’s instructions. The final elutions were performed with 150 μl elution buffer, resulting in a 300-μl nucleic acid extract. The nucleic acid extract was assayed immediately or stored at −70 °C.

To demonstrate how the IACs would indicate reaction failure, a situation in which nucleic acid purification had been poorly performed was modelled by adding 50 μl of non-extracted strawberry puree to 50 μl nucleic acid extract prior to nucleic acid amplification.

Results

Optimization of the IAC Probe Concentration

For each virus detection method, several experiments were performed as detailed in “Materials and Methods” in duplex (IAC and target probes) and uniplex (IAC probe) formats, and the best performance concentration chosen was that which showed the lowest Cp value with less difference between the duplex and uniplex formats and having the most similar value within the five replicates (Table 3). The results indicated that a probe concentration of 50 nM in all assays exhibits enough fluorescence intensity and that the assay performance in duplex and uniplex was satisfactory.
Table 3

Optimization of the IAC probe (PrfAP) by testing three different concentrations (25, 50 and 100 nM) in uniplex and duplex formats for each of the target viruses: BPyV, HAV, HEV, HAdV, NoVGI and NoVGII, MNV1, and PAdV

 

BPyV

HAV

HEV

HAdV

NoVGI

NoVGII

MNV1

PAdV

PrfAP (nM)

25

50

100

25

50

100

25

50

100

25

50

100

25

50

100

25

50

100

25

50

100

25

50

100

Duplex

Cp

26.35

26.50

26.74

27.54

25.00

23.82

24.71

24.12

23.92

41.06

28.65

27.16

27.01

24.41

22.86

28.43

23.31

21.16

31.27

29.05

28.19

27.55

26.95

26.09

SD

0.14

0.09

0.07

0.05

0.05

0.14

0.07

0.06

0.11

3.11

0.67

0.16

0.07

0.08

0.14

0.70

0.16

0.22

0.15

0.24

0.13

0.19

0.14

0.33

Uniplex

Cp

26.48

26.59

26.79

27.94

25.41

24.16

24.19

23.67

23.48

36.49

30.11

27.46

24.85

24.12

22.92

24.89

23.88

21.65

30.80

28.77

28.00

27.67

27.07

26.43

SD

0.08

0.04

0.02

0.14

0.09

0.24

0.06

0.38

0.40

1.21

0.18

0.32

0.14

0.08

0.16

0.07

0.29

0.43

0.24

0.16

0.14

0.08

0.07

0.14

BPyV bovine polyomavirus, HAV hepatitis A virus, HEV hepatitis E virus, HAdV human adenovirus, NoVGI human norovirus group I, NoVGII human norovirus group II, MNV1 murine norovirus, PAdV porcine adenovirus

Determination of the Optimal Amount of IAC for Each Assay

After optimization of IAC amount per reaction as detailed in “Materials and Methods”, the target LOD for each virus was recalculated; norovirus GGI had 100 GE per reaction, and the LOD for all other target viruses was 10 GE (Table 4). These LODs were established in the amount of virus GE when the target signal was present in all five replicates, and if just one target signal was not present in all replicates, the results were not considered robust enough. It is remarkable that the LOD of the HEV system was established at 10 GE when Cp values were as high as 41.50 ± 1.80 whilst at 100 GE were 33.56 ± 0.61 (data not shown), indicating consistency of the results.
Table 4

Limits of detection of BPyV, HAV, HEV, HAdV, NoVGI and NoVGII, MNV1 and PAdV assays and optimal number of IAC copies for each assay

 

BPyV

HAV

HEV

HAdV

NoVGI

NoVGII

MNV1

PAdV

LOD

10

10

10

10

100

10

10

10

Cp ± SD

36.37 ± 0.59

26.28 ± 0.61

41.50 ± 1.80

34.62 ± 0.60

29.78 ± 0.21

27.54 ± 0.09

38.74 ± 0.56

36.54 ± 0.56

IAC

300

300

300

100

300

300

600

100

Cp ± SD

28.79 ± 0.06

30.29 ± 0.31

35.48 ± 0.36

33.69 ± 0.25

28.38 ± 0.10

32.65 ± 0.03

36.07 ± 0.44

34.66 ± 0.10

BPyV bovine polyomavirus, HAV hepatitis A virus, HEV hepatitis E virus, HAdV human adenovirus, NoVGI human norovirus group I, NoVGII human norovirus group II, MNV1 murine norovirus, PAdV porcine adenovirus, LOD limit of detection of the specific target virus

Demonstration of IAC Applicability in the Detection of Viruses in Food

The results from the analysis of the purified and inhibitor-containing nucleic acid extracts from the artificially contaminated strawberry puree are shown in Table 5. A signal was obtained for both target viruses and their IACs from the assay of the purified extract. No target virus or IAC signal was obtained from the assay of the inhibitor-containing extract.
Table 5

Detection of viruses in purified and inhibitor-containing nucleic acid extracts of strawberry puree artificially contaminated with human adenovirus and murine norovirus

 

Human adenovirus

Murine norovirus

Interpretation

Target

IAC

Target

IAC

Purified extract

20.88 ± 0.15b

33.52 ± 0.30

35.05 ± 0.35

37.04 ± 0.69

Positive

(9/9)c

(9/9)

(9/9)

(9/9)

Inhibitor-containing extracta

Undet.

Undet.

Undet.

Undet.

False negative

(0/9)

(0/9)

(0/9)

(0/9)

aNon-extracted strawberry puree suspension (50 μl) added to 50 μl of nucleic acid extracted from artificially contaminated strawberry puree

bMean and standard deviation of Cp values of three independent nucleic acid amplification reactions using three replicates in each

cPositive reactions out of nine reactions

Discussion

If monitoring of food supply chains for viruses is to be effectively performed as part of a food safety programme (Rodríguez-Lázaro et al. 2007), then it is vitally necessary that the reliability of the analytical results can be verified. Many matrices from the food supply chains which are most prone to virus contamination—salad vegetable, shellfish and soft fruit—contain substances which can inhibit nucleic acid amplification; therefore, it is essential that this verification includes the recognition of failed assays as these may mask the presence of a virus pathogen by a false negative interpretation of the results (Hoorfar et al. 2004). The use of an amplification control can provide this recognition.

There are two approaches to the use of amplification controls. The first is to run two separate reactions for each sample: One (the test) reaction contains only the sample nucleic acid, but the other (the control reaction) contains the sample nucleic acid plus the amplification control (Costafreda et al. 2006). The latter is thus termed an external amplification control (EAC). If it is successfully amplified to produce a signal, any non-production of a target signal in the test reaction is considered to signify that the sample was uncontaminated. If, however, no signal is produced in both the test and control reactions, it signifies that the nucleic acid extract contains inhibitory substances and the reaction has failed.

In contrast to an EAC, an IAC is a non-target DNA sequence present in the very same reaction as the sample nucleic acid extract (Hoorfar et al. 2004). If it is successfully amplified to produce a signal, any non-production of a target signal in the reaction is considered to signify that the sample was uncontaminated. If, however, the reaction produces neither a signal from the target nor the IAC, it signifies that the reaction has failed.

Optimally, since using different primer sets may cause the amplification control to react to an inhibitory substance differently to the target, it should possess the same primer sequences as the target: This is the “competitive” strategy (Hoorfar et al. 2004). It is so called because the amplification control can compete with the target for the primers. This potential competition issue has led some workers to adopt the EAC approach, but this does contain a degree of ambiguity because one can never be completely certain that the test reaction has not individually failed, for example, through pipetting error or non-homogeneous contamination by inhibitory substances. For example, if an EAC signal is produced in the control reaction but no target signal is produced in the test reaction, one cannot be completely certain that the test reaction has not failed. Using an IAC eliminates this ambiguity since it is present in the mastermix and a signal will always appear when the reaction has not failed or high levels of competing target are not present (if they are, a target signal will be produced anyway).

The concern of the proponents of the EAC approach regards the possibility that a low level of target may be outcompeted by the IAC, leading to a false negative result. However, a thoroughly optimised assay should not present these problems (D’Agostino et al. 2004; Rodríguez-Lázaro et al. 2010). In the current study, the amount of IAC incorporated in each assay was thoroughly optimised to ensure that it did not interfere with the analytical sensitivity of the assay. The limit of detection of the target of each assay remains the same.

Nonetheless, the IAC must be present in the reaction in sufficient quantity to perform its function, and it can only do that reliably if it consistently shows a signal in the absence of a target or in the presence of low target concentrations. The IACs developed in this study all had this capacity.

Finally, it should be demonstrated that an amplification control can identify failed reactions. In this study, using strawberries, which have been implicated in several outbreaks of viral disease (Food and Agriculture Organization of the United Nations/World Health Organization 2008) and which have often been found to contain inhibitory substances (Croci et al. 2008), the IACs showed that the performance of assays for both RNA and DNA viruses could be verified.

In conclusion, this study has produced a suite of IACs for nucleic acid amplification assays suitable for use in the analysis of food supply chain samples for viruses. The IACs constructed in this study can be reliably used in their specific assays and thus provide a robust control that can be routinely applied in the analysis of foods for viruses.

Acknowledgements

This work was supported by the EU VITAL project contract no. 213178. M.D.-V. received a Ph.D. studentship from the Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria (INIA). N.C. acknowledges the support of the United Kingdom Food Standards Agency.

Open Access

This article is distributed under the terms of the Creative Commons Attribution Noncommercial License which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.

Copyright information

© The Author(s) 2011

Authors and Affiliations

  • Marta Diez-Valcarce
    • 1
  • Katarina Kovač
    • 1
  • Nigel Cook
    • 2
  • David Rodríguez-Lázaro
    • 1
  • Marta Hernández
    • 1
  1. 1.Instituto Tecnológico Agrario de Castilla y León (ITACyL)ValladolidSpain
  2. 2.Food and Environment Research Agency (FERA)YorkUK