Medical Oncology

, Volume 28, Issue 4, pp 1469–1474

MicroRNA-21 is involved in osteosarcoma cell invasion and migration

Authors

  • Wu Ziyan
    • Department of OrthopedicsUnion Hospital, Tongji Medical College, Huazhong University of Science and Technology
  • Yang Shuhua
    • Department of OrthopedicsUnion Hospital, Tongji Medical College, Huazhong University of Science and Technology
  • Weng Xiufang
    • Department of ImmunologyTongji Medical College, Huazhong University of Science and Technology
    • Department of OrthopedicsUnion Hospital, Tongji Medical College, Huazhong University of Science and Technology
Original paper

DOI: 10.1007/s12032-010-9563-7

Cite this article as:
Ziyan, W., Shuhua, Y., Xiufang, W. et al. Med Oncol (2011) 28: 1469. doi:10.1007/s12032-010-9563-7

Abstract

MicroRNAs are involved in different cancer-related processes. MicroRNA-21 (miR-21), as an oncomiR, is overexpressed in all kinds of tumors and the role of miR-21 in carcinogenesis is elucidated in many cancers gradually. However, the function of miR-21 in osteosarcoma is still unclear. In our study, we found that miR-21 was significantly overexpressed in osteosarcoma tissues. More importantly, we confirmed that knockdown of miR-21 greatly decreased cell invasion and migration of MG-63. Furthermore, we identified that RECK (reversion-inducing-cysteine-rich protein with kazal motifs), a tumor suppressor gene, was a direct target of miR-21. Finally, the expression of RECK protein negatively correlated with the expression of miR-21 in human osteosarcoma tissues, indicating the potential regulation of RECK by miR-21. Our results suggest that miR-21 expression has a key role in regulating cellular processes in osteosarcoma, likely through regulating RECK and may serve as a therapeutic target.

Keywords

OsteosarcomamiR-21InvasionMigrationRECK

Introduction

Osteosarcoma is a primary malignant bone tumor with high morbidity in young adults and adolescents. Despite the recent advance in therapeutic strategies, such as wide tumor excision, adjuvant chemotherapy and radiotherapy, the prognosis of osteosarcoma patients remains poor. Because approximately 80% of patients eventually develop metastatic disease after surgical treatment [1], pulmonary metastasis of osteosarcoma patients is the major cause of fatal outcome [2].

MicroRNAs are small non-coding RNA molecules that exhibit a high degree conservation of structure and function in metazoa. They exist in two forms of pre-miRNAs and mature miRNAs, and only the mature miRNAs mediated by the two RNase III endonucleases Dicer and Drosha [3] play a key biological role. The mature miRNAs inhibit protein translation through binding the 3′-untranslated region (3′-UTR) of target mRNA partly, while they induce target mRNA cleavage through binding mRNA with perfect complementarity [4, 5]. At present, approximately 450 miRNAs have been cloned in mammalian cells, and it is believed that up to 1,000 miRNAs genes exist [6, 7]. Moreover, it is estimated that 30% genes of the human genome are regulated by miRNAs [8]. Though the biological functions of a small amount of identified miRNAs are elucidated, miRNAs have been proved to be important for cell growth, differentiation, and apoptosis [911].

Recently, miR-21 was reported aberrantly overexpressed in all types of tumors examined [1217]. Obviously, miR-21 was involved in cancer pathogenesis. Further, the effects of miR-21 on proliferation, migration, invasion, and apoptosis were gradually elucidated. Zhu [18] found that miR-21 inhibited tumor growth through down-regulation of tropomyosin 1 (TPM1) in breast cancer MCF-7. Meng et al. [17] reported that miR-21 was overexpressed in human hepatocellular cancer (HCC) and implicated in mediating phenotypic characteristics of cancer cells such as cell growth, migration and invasion. Asangani et al. [19] observed that programmed cell death protein 4 (Pdcd4) was regulated by miR-21 negatively and miR-21 induced invasion, intravasation, metastasis in colorectal cancer.

However, the role and relevant pathway of miR-21 in osteosarcoma carcinogenesis is still unknown. In this study we showed that miR-21 regulated invasion and metastasis of osteosarcoma cell MG-63 by targeting RECK, a tumor suppressor gene. Besides, we found that there was an inverse correlation between miR-21 and RECK protein through examining human osteosarcoma tissues.

Materials and methods

Cell culture and human tissues

Human osteosarcoma cell line MG-63 was cultured in DMEM with 10% fetal bovine serum (FBS) and incubated at 37°C in 5% CO2. Human osteosarcoma tissues and adjacent normal bone tissues were surgically obtained from patients in Union Hospital (Wuhan, China) and diagnosed by an independent pathologist. Informed consent was taken from all subjects, and the Institute Ethics Committee approved the study protocol.

TaqMan quantitative real-time PCR analysis of miR-21 expression

Total RNA was extracted from tissues and cells using a TaqMan miRNA Isolation Kit (Applied Biosystems, Foster City, CA). A TaqMan microRNA assay together with the TaqMan Universal PCR Master Mix (Applied Biosystems, Foster City, CA) were used to measure the expression of mature miR-21 in tissues and cells after reverse transcription (RT). The real-time PCR results were analyzed and expressed as relative miRNA expression of CT (threshold cycle) value, which was then converted to fold changes. Each sample was measured in triplicate, and the analysis was repeated if the coefficient of variation (CV) was greater than 5%. U6 was used as endogenous control.

Detection of RECK mRNA

Total RNA from cells or tissues was isolated using TRIzol reagent (Invitrogen) and reverse transcribed using reverse transcription kit (Applied Biosystems, Foster City, CA) according to manufacturer’s instructions. Reactions were performed and analyzed using ABI 7000 system (Applied Biosystems). Forward (F) and reverse (R) primes were as follows: RECK (F) 5′-AACCAAATGTGCCGTGAT-3′, RECK (R) 5′-ATGGCTTGACAGTATTCTCG-3′. β-Actin was used as an internal control. All qRT-PCRs were performed in triplicate.

Transfection

MG-63 cells were seeded in six-well plates at 30% confluence on the day before transfection. Transfection with anti-miR-21 (5′-UCAACAUCAGUCUGAUAAGCUA-3′) or negative control oligonucleotide (5′-UAGCUUAUCAGACUGAUGUUGA-3′) (Shanghai GenePharma Co., Ltd) was performed using Lipofectamine 2,000 reagent (Invitrogen). Transfection complexes were prepared according to the manufacturer’s instructions. Transfection efficiency was evaluated by GFP expression.

Luciferase activity assay

A fragment of the 3′-UTR of RECK was amplified from MG-63 cells by PCR using the forward primers ATTAACTAGTACCTCTATTCGCCACACAG and the reverse primers CTACATCAGCACTGACATATTCTG [20]. After digestion of the PCR product by SpeI and Hind III, the RECK 3′-UTR was cloned into pMiR-Report (Ambion) at the SpeI and HindIII site. A mutated 3′-UTR of RECK was introduced in the potential miR-21 binding site by using the two-step PCR approach. All PCR products were verified by DNA sequencing. MG-63 cells were cotransfected with the pMiR-Report vectors containing the 3′-UTR variants and anti-miR-21 or negative control oligonucleotide. Luciferase was measured 24 h after transfection. The firefly luciferase activity was then normalized to β-galactosidase activity.

Western blotting

Total proteins were isolated from tumor samples, normal bone tissues or MG-63 cells. Protein concentrations were measured using a Micro BCA protein assay kit (Pierce, USA). Proteins were resolved by 10% SDS–PAGE gel, transferred to the nitrocellulose membrane, blocked in 5% non-fat dry milk in Tris-buffered saline PH 7.4, containing 0.05% Tween 20, and blotted with the antibody against RECK (1:1,000, Cell Signaling), and blotted with goat anti-rabbit IgG (1:3,000, Santa Cruz), then β-actin was used as a loading control. Signals were detected by secondary antibodies labeled with HRP.

In vitro invasion assay

Invasion assays were performed in triplicate using Transwell invasion chambers coated with Matrigel (50 μl per filter) (BD, USA) as described in the manufacturer’s protocol. MG-63 cells were transfected with either anti-miR-21 or negative control oligonucleotide, cultured for 48 h, and transferred on the top of Matrigel-coated invasion chambers in a serum-free DMEM (1 × 105 cells per Transwell). DMEM containing 10% fetal calf serum was added to the lower chambers. After incubation for 24 h, cells that remained on the top of the filter were scrubbed off and cells that migrated to the lower surface were fixed in 90% alcohol and followed by crystal violet stain. Five random fields were counted.

Scratch migration assay

When MG-63 cells transfected with anti-miR-21 or negative control oligonucleotide were grown to confluence, a scratch in the cell monolayer was made with a cell scratch spatula. After the cells were incubated under standard conditions for 24 h, the plates were washed twice with fresh medium and pictures were taken at different times. The potential of migration was based on the counting cells that migrated from the wound edge.

Statistical analysis

Data are expressed as means ± SE. Differences/correlations between groups were calculated with Student’s t-test or Pearson. A P value <0.05 was defined as significant.

Results

miR-21 is aberrantly overexpressed in osteosarcoma tissues

We quantified mature miR-21 in eight pairs of osteosarcoma tissues and matched normal bone tissues by using TaqMan quantitative real-time PCR and mature miR-21 expression showed an obviously higher level in tumors than in matched normal tissues (Fig. 1; P < 0.01). The level of miR-21 expression was calculated by the formula: 2(−ΔCt) where ΔCt = CtmiR-21 − CtU6 [21]. Ct is the predetermined threshold of amplification cycle number.
https://static-content.springer.com/image/art%3A10.1007%2Fs12032-010-9563-7/MediaObjects/12032_2010_9563_Fig1_HTML.gif
Fig. 1

Relative expression of miR-21 in 8 clinical osteosarcoma tissues, matched normal bone tissues and MG-63 cells. miR-21 was overexpressed in tumor tissues in comparison with normal tissues. The expression level of miR-21 was normalized by using U6 as an internal control. All specimens were analyzed in triplicate

miR-21 regulates RECK protein in MG-63 cells negatively

To investigate the relation between miR-21 and RECK, miR-21 was knocked down with anti-miR-21 in MG-63 cells. Relative to the response of negative control oligonucleotide, reduced miR-21 in cells transfected with anti-miR-21 led to a corresponding increase in endogenous RECK protein level (Fig. 2a, c and d; P < 0.05). However, the level of RECK mRNA in MG-63 cells was not different when cells were transfected with anti-miR-21 or negative control oligonucleotide (Fig. 2b; P > 0.05). These initial experiments indicate that miR-21 might negatively regulate RECK protein.
https://static-content.springer.com/image/art%3A10.1007%2Fs12032-010-9563-7/MediaObjects/12032_2010_9563_Fig2_HTML.gif
Fig. 2

miR-21 and RECK protein correlate inversely. a Detection of mature miR-21 in MG-63 cells after transfection with anti-miR-21 or negative control oligonucleotide by TaqMan real-time PCR. b Anti-miR-21 had no effect on the mRNA level of RECK, as determined by real-time qRT-PCR. c RECK protein level in MG-63 cells after transfection with anti-miR-21 inhibitor or negative control oligonucleotide detected by western blotting. d Quantification of RECK protein level in MG-63 cells after transfection with anti-miR-21 inhibitor or negative control oligonucleotide. e Expression of RECK protein in eight pairs of matched osteosarcoma and normal bone tissues, as detected by western blotting. Normal bone tissues (N) and tumor tissues (T). f Quantification of RECK protein level in eight pairs of matched osteosarcoma and normal bone tissues. g A negative correlation between miR-21 and RECK in eight matched tumor specimens. ** P < 0.05

RECK and miR-21 are inversely expressed in resected tumor specimens in vivo

To determine the relation of RECK and miR-21 in tumor specimens, we examined the expression level of RECK and miR-21 in eight pairs of matched osteosarcoma specimens by western blotting and TaqMan real-time PCR. As expected, lower level of RECK protein was found in tumor tissues (Fig. 2e, f; P < 0.05). Accordingly, higher level of miR-21 expression was detected in all tumor tissues (Fig. 1; P < 0.01). However, the expression level of RECK mRNA in eight pairs of matched osteosarcoma specimens was not different (data not shown). Statistical analysis indicates that there is an obvious inverse correlation between RECK protein and miR-21 in these tumor tissue specimens by using the Pearson’s method (Fig. 2g; P < 0.05), with a correlation coefficient of −0.892.

miR-21 affects cell invasion and migration in vitro

To corroborate the effect of anti-miR-21 treatment on cell invasion and migration, we employed the cell invasion assay and scratch migration assay. MG-63 was transfected with anti-miR-21 or negative control oligonucleotide and we observed a significant downregulation of invasion into Matrigel in anti-miR-21-transfected MG-63 cells (Fig. 3; P < 0.05). Meanwhile we noticed that the number of the migrated cells transfected with anti-miR-21 were significantly fewer than negative control (Fig. 4; P < 0.05). These two observations emphasize the function of miR-21 in the invasion and metastasis of MG-63 cells.
https://static-content.springer.com/image/art%3A10.1007%2Fs12032-010-9563-7/MediaObjects/12032_2010_9563_Fig3_HTML.gif
Fig. 3

miR-21 regulates cell invasion in MG-63 cells. a MG-63 cells that invaded through Matrigel-coated invasion chambers after transfection with anti-miR-21 or b transfection with negative control oligonucleotide. c Quantification of MG-63 cells that invaded through Matrigel-coated invasion chambers after transfection with anti-miR-21 or negative control oligonucleotide. ** P < 0.05

https://static-content.springer.com/image/art%3A10.1007%2Fs12032-010-9563-7/MediaObjects/12032_2010_9563_Fig4_HTML.gif
Fig. 4

miR-21 affects the ability of MG-63 cell migration. a MG-63 cells that migrated from the wound edge after transfection with anti-miR-21 or b transfection with negative control oligonucleotide. c Quantification of MG-63 cells that migrated after transfection with anti-miR-21 or negative control oligonucleotide. ** P < 0.05

RECK is a direct target of miR-21

To validate whether miR-21 could regulate RECK directly through a putative binding site in MG-63 cells, we cloned RECK 3′-UTR and its relevant mutant with mutation in the predicted miRNA binding site into the downstream of the luciferase gene (pMiR-Report; Ambion). After cotransfection with the pMiR-Report vectors and anti-miR-21 or negative control oligonucleotide, the inhibition of miR-21 by anti-miR-21 resulted in a significant increase in the luciferase activity of the wild-type RECK 3′-UTR, whereas mutation of the miR-21 binding site blocked this effect (Fig. 5; P < 0.05). These results indicate that RECK is a direct miR-21 target.
https://static-content.springer.com/image/art%3A10.1007%2Fs12032-010-9563-7/MediaObjects/12032_2010_9563_Fig5_HTML.gif
Fig. 5

The RECK-3′-UTR is a target for miR-21. a Predicted miR-21 binding sites in RECK 3′-UTR (wild type: wt or mutated: mut) and miR-21 mature sequence. b Effect of miR-21 on the luciferase activity of wild-type RECK 3′-UTR (RECK wt) or RECK 3′-UTR with a mutated miR-21 binding site (RECK mut). The assay was done in MG-63 cells as described in section “Materials and methods”. The inhibition of miR-21 by anti-miR-21 resulted in a significant increase in luciferase signals of RECK wt- but not RECK mut-transfected cells. ** P < 0.05

Discussion

Recent studies have revealed that miRNAs are involved in the progression of various tumors through regulation of expression of multiple target genes. However, the report of the aberrant expression and the function of miRNAs in osteosarcoma is seldom found. Our research indicated that miR-21 was overexpressed in osteosarcoma tissues than in matched normal bone tissues. We also showed that miR-21 affected tumor cell invasion and migration. Moreover, miR-21 targeted RECK directly through interacting with its 3′-UTR and regulated the expression of RECK protein inversely.

Previous studies by Gabriely et al. [20] and Zhu et al. [18] showed that miR-21 had a role in tumor invasion and metastasis in glioblastoma and in breast cancer, respectively. Consistent with these, we also found that miR-21 knockdown significantly decrease the potential of invasion and metastasis in MG-63 in vitro. Moreover, in the xenograft carcinoma models, breast tumor growth was inhibited after transfection with anti-miR-21 [22]. These raise the possibility that miR-21 may be a target for therapeutic intervention [23].

Lu et al. [24] found that miR-21 promoted cell transformation by down-regulating Pdcd4 protein levels in MCF-7 human breast cancer cells and mouse epidermal JB6 cells. Papagiannakopoulos et al. [25] confirmed that miR-21 targeted a network of p53, TGF-β, and mitochondrial apoptosis tumor suppressor gene and caused repression of growth, increased apoptosis, and cell cycle arrest in glioblastoma cells. In our study, we also found that miR-21 had a negative correlation with the expression of RECK protein in osteosarcoma tissues and MG-63 cells. Moreover, our data suggested that RECK was a direct target of miR-21. RECK, as a tumor suppressor gene, plays a key role in tumor metastasis and angiogenesis by regulating the activities of matrix metalloproteases (MMPs). Kang et al. [26] showed that RECK suppressed osteosarcoma invasion by decreasing MMP activation. So we propose that miR-21 might affect osteosarcoma cell migration and invasion by regulating the expression of RECK. However, RECK is not the only target gene of miR-21 in osteosarcoma. To have a better idea of miR-21-mediated network, further research should put emphasis on more altered genes and find their correlations.

Conclusion

Our present study indicates that expression of tumor suppressor gene RECK is negatively regulated by miR-21 through a special binding site of the RECK-3′-UTR. Moreover, miR-21 modulates cell invasion and migration in MG-63 cells. Together, these results suggest that by altering expression of miR-21 it is possible to regulate the expression of one or multiple oncogenes or tumor suppressor genes and simultaneously trigger some cellular activities that these genes mediate. Therefore, miR-21 may serve as a target for effective therapies.

Acknowledgments

This research was supported by the National Natural Science Foundation of China (No: 30672130).

Copyright information

© Springer Science+Business Media, LLC 2010