Stem Cell Reviews and Reports

, Volume 5, Issue 4, pp 378–386

Embryonic Stem Cell Marker Expression Pattern in Human Mesenchymal Stem Cells Derived from Bone Marrow, Adipose Tissue, Heart and Dermis

Authors

    • Faculty of MedicineUniversity of Latvia
  • Inese Cakstina
    • Faculty of BiologyUniversity of Latvia
  • Vadims Parfejevs
    • Faculty of MedicineUniversity of Latvia
  • Martin Hoogduijn
    • Department of Internal Medicine, Transplantation LaboratoryErasmus Medical Center
  • Georgs Jankovskis
    • Institute of Experimental and Clinical MedicineUniversity of Latvia
  • Indrikis Muiznieks
    • Faculty of BiologyUniversity of Latvia
  • Ruta Muceniece
    • Faculty of MedicineUniversity of Latvia
  • Janis Ancans
    • Faculty of BiologyUniversity of Latvia
Report

DOI: 10.1007/s12015-009-9094-9

Cite this article as:
Riekstina, U., Cakstina, I., Parfejevs, V. et al. Stem Cell Rev and Rep (2009) 5: 378. doi:10.1007/s12015-009-9094-9
  • 1.8k Views

Abstract

Mesenchymal stem cells (MSCs) have been isolated from a variety of human tissues, e.g., bone marrow, adipose tissue, dermis, hair follicles, heart, liver, spleen, dental pulp. Due to their immunomodulatory and regenerative potential MSCs have shown promising results in preclinical and clinical studies for a variety of conditions, such as graft versus host disease (GvHD), Crohn’s disease, osteogenesis imperfecta, cartilage damage and myocardial infarction. MSC cultures are composed of heterogeneous cell populations. Complications in defining MSC arise from the fact that different laboratories have employed different tissue sources, extraction, and cultivation methods. Although cell-surface antigens of MSCs have been extensively explored, there is no conclusive evidence that unique stem cells markers are associated with these adult cells. Therefore the aim of this study was to examine expression of embryonic stem cell markers Oct4, Nanog, SOX2, alkaline phosphatase and SSEA-4 in adult mesenchymal stem cell populations derived from bone marrow, adipose tissue, dermis and heart. Furthermore, we tested whether human mesenchymal stem cells preserve tissue-specific differences under in vitro culture conditions. We found that bone marrow MSCs express embryonic stem cell markers Oct4, Nanog, alkaline phosphatase and SSEA-4, adipose tissue and dermis MSCs express Oct4, Nanog, SOX2, alkaline phosphatase and SSEA-4, whereas heart MSCs express Oct4, Nanog, SOX2 and SSEA-4. Our results also indicate that human adult mesenchymal stem cells preserve tissue-specific differences under in vitro culture conditions during early passages, as shown by distinct germ layer and embryonic stem cell marker expression patterns. Studies are now needed to determine the functional role of embryonic stem cell markers Oct4, Nanog and SOX2 in adult human MSCs.

Keywords

Human mesenchymal stem cellsOct4NanogSOX2SSEA-4

Introduction

Mesenchymal stem cells (MSC) were first discovered as clonogenic, adherent colony-forming fibroblastic cells present in bone marrow stroma [1]. Since then MSCs have been isolated from a vast variety of human tissues, e.g. adipose tissue, dermis, hair follicles, heart, liver, spleen, dental pulp [28]. Due to their immunomodulatory and regenerative potential MSCs have shown promising results in preclinical and clinical studies for a variety of conditions, such as graft versus host disease (GvHD), Crohn’s disease, osteogenesis imperfecta, cartilage damage and myocardial infarction (reviewed in [9, 10]).

Initially assays to confirm MSC identity and potency were the colony forming assay and cell differentiation into adipocytes, osteocytes, and chondrocytes [1113]. More recently several MSC-associated cell surface markers have been identified and general consensus has been reached that MSC co-express markers CD73, CD90, CD105 [4, 11]. Reports listing phenotypic and functional properties of MSCs have indicated that in vitro cultures are composed of heterogeneous cell populations [14, 15]. Definition and characterization of MSCs is further complicated by the fact that researchers have used different tissue sources, cell isolation and cultivation methods. Therefore further analysis of MSC associated markers is an important issue reinforced by necessity for more comprehensive characterization methods of tissue specific MSCs.

Although cell-surface antigens of MSCs have been extensively explored, they do not represent unique stem cell markers and there is no conclusive evidence that unique stem cells markers are associated with these adult cells. Currently the most comprehensive set of unique stem cell markers has been defined and associated with embryonic stem cells (ESC). Whether ESC-associated markers are present in adult stem cells populations and/ or correlate with different tissue source are still open and debated issues.

Embryonic stem cell phenotype has been studied in detail and several markers have been reported as embryonic stem cell (ESC) specific antigens, including transcription factors Oct4, Nanog, SOX2, cell surface antigen SSEA-4 and others [16]. Recent studies have shown that adult stem cells, including MSCs, may express ESC markers: SSEA-4 expression has been detected in bone marrow [17, 18] and dental pulp stem cells [6]; Oct4 expression has been reported in bone marrow [18, 19] and adipose tissue-derived stem cells [20], peripheral blood mononuclear cells [21], dental pulp stem cells [6], heart and liver cells [7]; Nanog expression has been found in bone marrow, heart and liver mesenchymal stem cells [19]. It has been reported that transcription factor SOX2 is expressed in bone marrow, neural tissues and sensory epithelia from the early stages of development [19, 22].

The aim of this study was to examine expression of embryonic stem cell markers Oct4, Nanog, SOX2, alkaline phosphatase and SSEA-4 in adult mesenchymal stem cell populations derived from bone marrow, adipose tissue, dermis and heart. Furthermore, we tested whether human mesenchymal stem cells preserve tissue-specific differences under in vitro culture conditions.

Materials and Methods

BM-MSC Isolation and Propagation

All human tissue samples were obtained with patient consent as approved by the Central Ethical committee of Latvia. Bone marrow samples (donors’ age 60 ± 10) were collected in EDTA-coated tubes (Sarstedt). Erythrocytes were lysed in red blood cell lysing buffer (Sigma-Aldrich) for 5 min at room temperature. Mononuclear cell fraction was separated by Ficoll-Hypaque (Sigma-Aldrich) gradient centrifugation. Cells were washed in Hank’s buffer and suspended in Dulbecco’s Modified Eagle’s Medium DMEM/F12 (3:1 v/v) supplemented with 15% fetal bovine serum (FBS) and 100 U/ml of penicillin, 100 µg/ml of streptomycin (all from Invitrogen). Cells were plated in 75-cm2 tissue culture flasks (T-75; Sarstedt) and grown at 37°C, 5%CO2 until 80% confluence. The bone marrow MSCs were used for experiments between passage 1 and 3.

Adipose Tissue MSC Isolation and Propagation

Human adipose tissue (AT) MSCs (donors’ age 49 ± 10) were isolated as previously described [23]. Briefly, subcutaneous adipose tissue was mechanically disrupted with a scalpel and, after two washes with phosphate—buffered saline (PBS), digested with sterile filtered collagenase type XI (Sigma-Aldrich) at 0.5 mg/ml in DMEM/F12 (3:1 v/v) for 30 min at 37°C with intermittent shaking. Enzyme activity was neutralized with DMEM containing 10% FBS and the floating adipocytes were separated from the stromal—vascular fraction by centrifugation at 500 × g for 5 min. The pellet was resuspended in DMEM/F12 medium with serum as described above, and cells were plated in 25-cm2 tissue culture flasks (T-25; Sarstedt) and grown 2 weeks at 37°C, 5% CO2 until 80% confluence. The adipose tissue MSCs were used for experiments between passage 1 and 3.

Heart MSC Isolation and Propagation

Atrium tissue that is routinely removed from donor hearts during heart transplantation surgery was used for the isolation of MSCs [5]. In brief, heart tissue (donors’ age 18 and 44) was minced and digested with sterile filtered 0.5 mg/ml collagenase type IV (Sigma-Aldrich) in RPMI (Invitrogen) for 30 min at 37°C under continuous stirring. After two washes in RPMI, dissociated tissue and cells were transferred to a tissue culture flask and cultured in alpha-modified Eagle’s medium (α-MEM; Invitrogen) supplemented with 15% fetal bovine serum (FBS), 100 U/ml of penicillin and 100 µg/ml of streptomycin (Invitrogen) at 37°C, 5% CO2 and 95% humidity. Nonadherent cells were removed after 3–4 days. Culture medium was refreshed twice weekly and adherent cells were trypsinised at subconfluency using 0.25% trypsin-EDTA (Invitrogen) and reseeded at 1,000 cells/cm2. The cells were used for experiments between passage 3 and 5.

Dermal MSC Isolation and Propagation

Human skin tissue samples (donors’ age 59 ± 6) were obtained from post-surgery materials. Skin tissue samples were transported to laboratory in ice-cold transport solution containing Ca2+/Mg2+ ion free PBS supplemented with penicillin 200 U/ml, streptomycin 200 µg/ml and fungizone 2 μg/ml. The specimens were washed with cold PBS, cut into 4–6 mm2 pieces and incubated in dispase 0.6 U/ml (Roche Applied Science) for 1–3 h at 37°C to remove epidermis.

Dermal MSC cultures were obtained as described earlier [24, 25]. Dermis was minced manually before enzymatic digestion with Liberase Blendzyme 1 (0.62 Wunsch U/ml; Roche Applied Science) for 30 min at 37°C, then dissociated by vigorous pipetting and passed through a 70-μm cell strainer (BD Falcon), following centrifugation at 1,500 rpm for 5 min. The pellets were suspended in DMEM/F12 (3:1 v/v) supplemented with 10% of FBS and antibiotics (100 U/ml penicillin, 100 µg/ml streptomycin). Cell suspensions were transferred into 25-cm2 tissue culture flasks (T-25; Sarstedt) and grown until 80% confluence. The skin MSCs were used for experiments between passage 1 and 3.

Morphology Analysis

Cell morphology was analyzed on subconfluent cell monolayer at 100× magnification on phase-contrast microscope (Leica). Photos were taken by Kodak camera. Cells were counted in hematocytometer and cell viability was assessed by Trypan blue staining.

Immunophenotyping by Flow Cytometry Analysis

Cell surface antigen phenotyping was performed on bone marrow, adipose tissue, dermal and heart mesenchymal stem cells. The following antibodies were used: CD34-PE, CD45-FITC, CD14-APC, HLA-DR-APC (all from BD Biosciences), CD90-FITC (Dako), CD73 (Abcam), CD105 (R&D Systems), SSEA-4 (R&D Systems), and isotype controls IgG1-FITC (Dako), IgG1-PE (BD Biosciences), IgG2A-APC (BD Biosciences), IgG1 and IgG3 (R&D Systems) as described previously [25]. Secondary goat anti-mouse IgG-PE and goat anti-mouse IgG-APC (R&D Systems) were used when appropriate. 10,000 labeled cells were acquired and analyzed using FACSCalibur and CellQuest (BD Biosciences) software.

Immunophenotyping by Immunocytochemistry and Immunofluorescence Analysis

Mesenchymal stem cells from bone marrow, adipose tissue, dermis and heart were seeded on 24-well tissue culture plate (Sarstedt) at the density 5 × 103 cells per well and cultivated 48 h in DMEM/F12 (3:1 v/v) medium supplemented with 10% FBS and antibiotics. When cells reached 50% confluence, samples were rinsed with PBS. Afterwards, specimens were fixed in 4% paraformaldehyde (PFA) for 20 min at room temperature. Cells were rinsed with PBS and incubated with blocking/permeabilization buffer consisting of 5% bovine serum albumin (BSA), 0.3% Triton X-100 in PBS for 45 min in room temperature. Endogenous peroxidase activity was blocked with 3% H2O2 peroxide for three minutes. Cells were subsequently incubated with primary antibody against alkaline phosphatase in dilution 1:10 (clone B4-78), polyclonal anti-Oct4 antibody in dilution 1:10, polyclonal anti-Nanog antibody in dilution 1:10, primary antibody against SSEA-4 (clone MC-813-70) (all from Human Embryonic Stem cell Functional Identification Kit, R&D Systems), primary antibody against nestin (clone 196908) and CD133 (Miltenyi) in dilution 1:100. As control, IgG1 and IgG3 isotype antibodies were used in dilution 1:100 (R&D Systems). A negative control with no primary antibodies was also included. Samples were incubated at +4°C overnight. After incubation, cells were rinsed three times in PBS. Horse-radish peroxidase (HRP) conjugated secondary reagent and diaminobenzidine (DAB) substrate was applied to the cells according to the manufacturer’s instructions (LSAB+ System-HRP, DakoCytomation). Specimens were counterstained with Mayer’s haematoxylin (Lillie’s modification, DakoCytomation), mounted (GelMount, DakoCytomation) and analyzed under microscope (Leica DMI4000 B). For image analysis, five randomly selected fields per tissue were photographed and recorded using Image-Pro® Express software.

For immunofluorescence analysis, cells were grown in a 4-well chamber slide (Nunc) until 50% confluence was reached. Specimens were rinsed with PBS and fixed with 4% PFA for 20 min at room temperature. After rinsing with PBS, cells were blocked and permeabilized with 5% BSA, 0.1% Triton X-100 in PBS for 45 min. Samples were subsequently incubated with goat polyclonal antibody against human Oct4 in dilution 1:10 (R&D Systems) and mouse monoclonal antibody against human SSEA-4 in dilution 1:100 (Clone MC-813-70, R&D Systems) overnight at +4°C. IgG3 antibodies in dilution 1:100 (R&D Systems) were used for isotype control. A negative control with no primary antibodies was also included. Cells were rinsed three times in PBS and incubated with secondary anti-mouse Ig antibody labeled with FITC (diluted 1:200) and secondary anti-goat Ig antibody labeled with TRITC (diluted 1:50; Jackson Immunolaboratories) 1 h in the dark. Specimens were rinsed with PBS three times and counterstained with DAPI diluted in PBS. Then cells were rinsed, mounted with Fluoromount (Dako) and analyzed under the microscope (Leica DMI4000 B). For image analysis, five randomly selected fields per tissue were photographed and recorded. Image overlay was performed using Image-Pro® Express software.

Semiquantitive Two-step RT-PCR

RNA was extracted from cells using TRIzol reagent (Invitrogen) according to the manufacturer’s protocol. First strand cDNA synthesis was performed from 500 ng total RNA using RevertAid™ M-MuLV Reverse Transcriptase (Fermentas). No template control, containing all the first strand synthesis reagents but lacking RNA template, was also prepared. Three different cultures for each tissue type derived MSC were analyzed.

PCR was performed on the reverse transcription and control reactions using 2×PCR master mix containing Taq DNA Polymerase (Fermentas) with 0.4 μM of gene-specific primer (Operon and Sigma) in GeneAmp®PCR System 9700 (Applied Biosystems). Briefly, 2 μl cDNA was initially denatured at 94°C for 7 min and amplified by 35 cycles of denaturation at 95°C for 15 s, annealing at 58°C for 30 s, and elongation at 72°C for 20 s. PCR was completed with a final elongation step at 72°C for 7 min. All products were resolved on 1.8% agarose gels with a 100 bp DNA ladder (Fermentas). Details of gene-specific primers are listed in Table 1. Primer for pdx1 detection was taken from “Human Pluripotent Stem Cell Assessment Primer Pair Panel” (R&D Systems).
Table 1

Primer sequences used for PCR reactions

Name

Sequence (5′ to 3′)

Product size

GeneBank reference nr.

oct4

F - GTGGAGGAAGCTGACAACAA

119 bp

NM_002701.3

R - ATTCTCCAGGTTGCCTCTCA

nanog

F - CCTGTGATTTGTGGGCCTG

77 bp

NM_024865.2

R - GACAGTCTCCGTGTGAGGCAT

sox2

F - GTATCAGGAGTTGTCAAGGCAGAG

77 bp

NM_003106.2

R - TCCTAGTCTTAAAGAGGCAGCAAAC

nestin

F - GCCCTGACCACTCCAGTTTA

220 bp

NM_006617.1

R - GGAGTCCTGGATTTCCTTCC

GATA4

F – TCATCTCACTACGGGCACAG

233 bp

NM_002052.2

R - GGGAAGAGGGAAGATTACGC

TGF-β1

F - GCGTGCTAATGGTGGAAAC

275 bp

NM_000660.3

R - CGGTGACATCAAAAGATAACCAC

CD90

F - CTAGTGGACCAGAGCCTTCG

333 bp

NM_006288.2

R - TGGAGTGCACACGTGTAGGT

CD105

F - TGCCACTGGACACAGGATAA

204 bp

NM_000118.1

R - CCTTCGAGACCTGGCTAGTG

β-actin

F - TCCTTCCTGGGCATGGAG

207 bp

NM_001101.2

R - AGGAGGAGCAATGATCTTGATCTT

Results

General Characteristics of MSC Cultures

Human adult mesenchymal stem cells were isolated from bone marrow, subcutaneous adipose tissue, dermis and heart and propagated in FBS supplemented DMEM/F12 (3:1 v/v) and α-MEM medium. There were at least three different donor samples examined for each tissue type and all MSC cultures used were at early passages. MSC cultures from all four tissue sources demonstrated adherent, fibroblast-like spindle shaped morphology. Average doubling time for bone marrow, dermal, adipose tissue MSC was 24–48 h, whereas heart MSC population doubling occurred in 48–72 h. Trypan blue exclusion test demonstrated more than 95% cell viability in all cell cultures tested.

Mesenchymal Stem Cell Marker Phenotyping by Flow Cytometry Analysis

MSCs derived from bone marrow, adipose tissue and heart displayed no expression of hematopoietic markers CD14, CD34, CD45 and HLA DR. Dermal MSC were negative for CD14, CD45 and HLA DR expression, however, there was a large fraction of CD34 positive cells (Fig. 1). MSCs derived from all four tissue sources demonstrated expression of CD73, CD90 and CD105 in more than 95% of population except heart MSCs where CD90 was expressed in 38% of the cell population (Fig. 1).
https://static-content.springer.com/image/art%3A10.1007%2Fs12015-009-9094-9/MediaObjects/12015_2009_9094_Fig1_HTML.gif
Fig. 1

Comparison of cell surface proteins CD90, CD73, CD105 and CD34 on primary mesenchymal stem cells derived from bone marrow, adipose tissue, dermis and heart. Solid histograms show nonspecific staining and open histograms show specific staining for the indicated marker. Three different donor MSC populations from each tissue type were analyzed and representative samples are shown. Abbreviations: BM bone marrow, AT adipose tissue, D dermis, H heart

Embryonic Stem Cell Marker Expression Analysis

MSC cell cultures were analyzed for expression of embryonic stem cell markers Oct4, Nanog, alkaline phosphatase, nestin, CD133 and SSEA-4 by immunocytochemistry. Additionally, SSEA-4 expression was determined by immunofluorescence and flow cytometry, and Oct4 was examined by immunofluorescence. Immunochemical phenotyping revealed strong expression of Oct4 and Nanog in bone marrow, adipose tissue and dermal MSCs, and weak expression in heart MSCs (Fig. 2a). Interestingly, a distinct nucleoli staining pattern by Oct4 antibodies was observed, which was also confirmed by immunofluorescence analysis (Fig. 2b). Nanog staining could be observed in both cytosol and nucleus (Fig. 2a). Majority of dermal MSCs demonstrated low expression of alkaline phosphatase, a few distinct alkaline phosphatase positive cells were detected in bone marrow and adipose tissue MSCs, whereas MSCs from heart displayed no alkaline phosphatase expression (Fig. 2a). All MSC populations were 100% positive for nestin and negative for CD133 expression in immunocytochemical analysis (data not shown). A fraction of SSEA-4 positive cells was detected in all tissue MSCs by flow cytometry analysis (Fig. 2c). The average number of SSEA-4 positive cells was 6.9 ± 4.0% in bone marrow, 7.8 ± 3.0% in adipose tissue, 4.7 ± 2.9% in dermis and 1.2 ± 0.3% in heart mesechymal stem cells. SSEA-4 expression was also confirmed by immunofluorescence analysis (Fig. 2b).
https://static-content.springer.com/image/art%3A10.1007%2Fs12015-009-9094-9/MediaObjects/12015_2009_9094_Fig2_HTML.gif
Fig. 2

Comparison of the embryonic stem cell marker expression in primary mesenchymal stem cells derived from bone marrow, adipose tissue, dermis and heart. a. Immunocytochemical localization of Oct4, Nanog and alkaline phosphatase (AP) markers in MSCs. Cells were immunostained for the indicated markers and counterstained with hematoxilin (scale bar 100 µm). b. Immunofluorescence localization of Oct4 and SSEA-4 in bone marrow, adipose tissue, dermal and heart MSCs. Cells were stained for the indicated markers and counterstained with DAPI. Arrows indicate the localization of Oct4 staining in the cell nucleus (scale bar 100 µm). c. Flow cytometric analysis of SSEA-4 expression in bone marrow, adipose tissue, dermal and heart MSCs. Solid histograms show nonspecific staining and open histograms show specific staining for the indicated marker. Three different donor MSC populations from each tissue type were analyzed and representative samples are shown. The average number of SSEA-4 positive cells was 6.9 ± 4.0% in bone marrow (n = 4), 7.8 ± 3.0% in adipose tissue (n = 3), 4.7 ± 2.9% in dermis (n = 3) and 1.2 ± 0.3% in heart (n = 2) mesenchymal stem cells. Abbreviations: BM bone marrow, AT adipose tissue, D dermis, H heart

Semiquantitive RT-PCR

Bone marrow, adipose tissue, dermis and heart derived MSCs were used to perform two-step semiquantitive RT-PCR for embryonic stem cell and germ layer markers. Expression of oct4, nanog and sox2 as embryonic stem cell markers was established and results demonstrate expression of oct4 and nanog in all four tissue derived MSCs (Fig. 3), whereas sox2 is expressed in adipose tissue derived, dermal and heart MSC samples. Bone marrow MSC samples were negative for sox2 expression.
https://static-content.springer.com/image/art%3A10.1007%2Fs12015-009-9094-9/MediaObjects/12015_2009_9094_Fig3_HTML.gif
Fig. 3

Semiquantitive two step reverse transcription polymerase chain (RT-PCR) analysis of embryonic stem cell marker oct4, nanog, sox2, and germ layer marker nestin, GATA4, pdx1 and TGF-β1 expression in bone marrow, adipose tissue, dermal and heart mesenchymal stem cells. Expression of housekeeping gene ß-actin as well as mesenchymal stem cell markers thy-1 (CD90) and endoglin (CD105) is also shown. Abbreviations: BM bone marrow, AT adipose tissue, D dermis, H heart

Expression of ectoderm marker nestin and mesoderm marker TGFß1 was observed in all samples. Endoderm marker GATA4 was observed only in heart derived MSC samples, whereas another endoderm marker pdx1 was detected in all four tissue type derived MSC samples. Strong expression of mesenchymal stem cell associated markers thy-1 (CD90) and endoglin (CD105) was observed in all samples (Fig. 3).

Discussion

Mesenchymal stem cells reside in a variety of tissues and organs within human body and several clinical trials have indicated regenerative and immunosuppressive potential of in vitro expanded MSCs. However, significant variability of MSC populations has been observed and therefore detailed analysis of MSC associated markers is an important issue, reinforced by the necessity for more comprehensive characterization methods of tissue specific MSC.

To address these issues, we compared embryonic stem cell marker and germ layer marker expression patterns in MSCs derived from bone marrow, adipose tissue, dermis and heart. All cell cultures exhibited typical MSC characteristics of fibroblastoid morphology and mesenchymal lineage differentiation capacity. Immunophenotyping of MSCs from bone marrow, adipose tissue, dermis and heart demonstrated that more than 95% of cell populations expressed well defined MSC-associated surface markers CD73, CD90 and CD105. However, our results indicate significant decline in CD90 marker expression in heart MSC cultures after third passage and this was not observed for other tissue MSC cultures. The explanation for the reason, why the level of CD90 by RT-PCR in heart MSCs is the same of the rest of MSCs analysed, could be that heart MSCs used for semiquantitive RT PCR analysis were at passage 3, whereas samples analysed by flow cytometry were from passage 5. Interestingly, similar decline in heart MSC CD90 positive fraction has been reported for donor cells isolated 5 to 26 weeks after heart transplantation [26]. Also, the number of CD90 positive cells may vary between different heart MSC samples, as noted by Hoogduijn et al. [26]. MSCs from bone marrow, adipose tissue, dermis and heart were negative for hematopoietic markers CD14, HLA-DR and CD45 as well as there was no CD34 expression in bone marrow, adipose tissue and heart MSCs. In contrast to other MSC populations, significant fraction of CD34 positive cells was detected in dermal MSC populations. Marker CD34 is usually associated with hematopoietic stem cells, nevertheless its expression in dermis derived cells has been reported previously [3, 25].

Mesenchymal stem cell cultures were examined also for germ layer marker expression. Nestin was used as a marker for ectoderm, TGF-β and GATA4 for mesoderm, and PDX1 for endoderm. Nestin, TGF-β and PDX1 expression was detected in MSC cultures from all tissues. Interestingly, GATA4 expression was found in heart MSCs only and this protein is thought to regulate expression of genes involved in myocardial differentiation and function [27]. It has been reported that cultured MSCs and their progeny exhibit a high degree of plasticity and MSCs can differentiate in vitro also into ectodermal and endodermal lineages [28, 29]. Some authors consider MSC plasticity as a consequence of cell culture conditions rather than an intrinsic MSC in vivo differentiation potential [30]. Our results on germ layer marker expression pattern would support concept that mesenchymal stem cells possess plasticity, as it was shown by three germ line marker co-expression.

Recent worldwide survey conducted by International Stem Cell Initiative assessed expression pattern of stem cell associated markers in hES cell cultures. All hES cell lines tested exhibited a common expression pattern for a specific set of marker antigens and genes: glycolipid antigens SSEA-3 and SSEA-4, the keratan sulfate antigens TRA-1-60, TRA-1-81, GCTM2 and GCT343, and the protein antigens CD9, CD90, tissue-nonspecific alkaline phosphatase, as well as Nanog, Oct4, TDGF1, DNMT3B, GABRB3 and GDF3 [16]. Studies in mouse and human cells indicate that Oct4 is a component of a network of transcription factors, including the homeobox protein Nanog and HMG-box transcription factor SOX2, that cooperatively maintain pluripotency in ESCs [31]. Cell surface marker SSEA-4 is a good indicator for undifferentiated hES cells, but it has also been used for the isolation of MSCs from human bone marrow aspirates [16].

Results of our study demonstrate presence of embryonic stem cell associated markers SSEA-4, Oct4, Nanog, SOX2 and alkaline phosphatase in adult MSCs. SSEA-4 expression in human bone marrow MSC has been previously reported [19, 32]. In this study we further demonstrate that SSEA-4 positive cell fractions are present also in adipose tissue, dermal and heart MSCs. Immunocytochemical and immunofluorescence analysis of Oct4 expression revealed its presence in both nucleoli and cytoplasm of all tissue MSC cultures tested. Interestingly, two Oct4 isoforms, namely, Oct4A in nucleus and Oct4B in cytoplasm have been detected in peripheral blood mononuclear cells and the stem cell associated properties were attributed to Oct4A [21].

The expression pattern of Oct4, Nanog and SOX2 was assessed also by semiquantitive RT-PCR. Overall, results confirmed observations acquired by immunocytochemical and immunofluorescence analysis. RT-PCR revealed expression of Oct4, Nanog and SOX2 in adipose tissue, dermal and heart MSCs. Detection of Oct4 and Nanog expression in human bone marrow and heart cells is consistent with previously reported data by Beltrami at al. [7]. In contrast to previous observations [19], we were not able to detect SOX2 expression in bone marrow MSCs. Expression of embryonic stem cell marker Oct4 has been reported in human adipose tissue MSCs [20] and by this study we have demonstrated that SOX2 and Nanog are also present in adipose tissue MSCs. We have made novel observations that embryonic stem cell marker Oct4 is highly expressed in human dermal MSCs along with Nanog and SOX2.

Little is known about the functional role of these pluripotency markers in adult stem cells. It has been shown that knockdown of Oct4 in human bone marrow MSCs induces changes in cell morphology, decrease growth rates and shifts cells from a cycling to a non-cycling state. Therefore similar regulatory mechanism has been suggested for Oct4 in both ESCs and MSCs [19]. Our data support the hypothesis that tissue specific MSCs could be pluripotent stem cells that were deposited in tissues during development and therefore have ESC-associated markers [14]. Studies are now needed to determine the functional role of embryonic stem cell markers Oct4, Nanog and SOX2 in adult human MSCs from various tissue sources.

In summary, we have characterized embryonic stem cell marker expression in MSCs cultures derived from bone marrow, adipose tissues, dermis and heart. Our findings provide evidence that bone marrow MSCs express embryonic stem cell markers Oct4, Nanog, alkaline phosphatase and SSEA-4, adipose tissue and dermis MSCs express Oct4, Nanog, SOX2, alkaline phosphatase and SSEA-4, whereas heart MSCs express Oct4, Nanog, SOX2 and SSEA-4. Our results also indicate that human adult mesenchymal stem cells preserve tissue-specific differences under in vitro culture conditions during early passages, as shown by distinct germ layer and embryonic stem cell marker expression patterns.

Acknowledgements

The presented work was supported by the European Regional Development Fund (ERDF) project No.VPD/ERAF/CFLA/05/APK/2.5.2./000072/036 and University of Latvia grant ZP-131/2008.

Author Disclosure Statement

No competing financial interests exist.

Copyright information

© Springer Science + Business Media 2009