Applied Biochemistry and Biotechnology

, Volume 170, Issue 4, pp 819–830

Enhanced In Vitro Refolding of Soluble Human Glucocorticoid-Induced TNF Receptor-Related Ligand

Authors

  • Erika Kovács
    • Department of BioengineeringSapientia Hungarian University of Transylvania
  • László Szilágyi
    • Department of BioengineeringSapientia Hungarian University of Transylvania
    • Department of BiochemistryEötvös Loránd University
  • Gábor Koncz
    • Department of Immunology, Medical and Health Science CentreUniversity of Debrecen
  • Szabolcs Lányi
    • Department of BioengineeringSapientia Hungarian University of Transylvania
    • Department of BioengineeringSapientia Hungarian University of Transylvania
Article

DOI: 10.1007/s12010-013-0232-0

Cite this article as:
Kovács, E., Szilágyi, L., Koncz, G. et al. Appl Biochem Biotechnol (2013) 170: 819. doi:10.1007/s12010-013-0232-0
  • 183 Views

Abstract

The glucocorticoid-induced tumor necrosis factor receptor (GITR) is a member of the tumor necrosis factor receptor superfamily. Attachment of GITR to its ligand (GITRL) regulates diverse biological functions, including cell proliferation, differentiation, and survival. In this study, the extracellular region of human GITRL (hGITRL) was cloned, expressed, and purified. The coding sequence of the extracellular region of hGITRL was isolated from human brain cDNA and inserted in pET20b vector. The hGITRL was expressed in Escherichia coli BL21 (DE3) Star at 37 and 25 °C. The majority of the protein was found in inclusion bodies. We identified three important factors for efficient refolding of hGITRL: a ratio of GSH/GSSG, pH, and addition of polyethylene glycol. The renaturated protein was purified by Ni-NTA chromatography. The overall yield of the expression and refolding was higher than 50 mg/l E. coli culture grown at 37 °C. Size exclusion chromatography showed that hGITRL exists as mixture of various multimeric forms in solution. We tested the association of recombinant hGITRL with THP-1 and U937 cell lines and its activity to promote extracellular signal-regulated protein kinase phosphorylation. The results showed that the recombinant protein was biologically active.

Keywords

GITRLHeterologous expressionInclusion bodyPEGSize exclusion chromatography

Introduction

The tumor necrosis factor (TNF) superfamily members are regulators of cell proliferation, differentiation, and survival [1]. The glucocorticoid-induced tumor necrosis factor receptor (GITR) is member of the TNF receptor superfamily (TNFRSF); it was originally cloned in a glucocorticoid-treated hybridoma T cell line [2]. GITR is a type I transmembrane protein with a cysteine-rich extracellular domain and is also known as AITR (activation-inducible TNFR family member) or TNFRSF18 [3, 4]. In mice, expression of GITR has been detected in regulatory T cells, B cells, natural killer (NK) cells, granulocytes, and macrophages [57], whereas in humans, GITR expression has been described in macrophages and NK cells [810]. Effector CD4+ and CD8+ T cells express GITR at low levels but rapidly upregulate GITR expression upon activation [5]. GITRL is the natural ligand of GITR [3, 6] and is expressed on the surface of various antigen-presenting cells, including macrophages, B cells, and immature and mature dendritic cells [5, 7]. Addition of soluble GITRL or anti-GITR antibody arrested the suppressive activities of CD4+CD25+ regulatory T cells [11, 12].

Human GITRL (hGITRL) expression was detected in CD8 cells, and expression level was increased in CD8 cells from tumor-positive lymph node of breast cancer patient [13]. Tumor cell lines and patient leukemia cells express substantial levels of GITRL, and elevated levels of soluble GITRL (sGITRL) are present in sera of patients with various cancers [8, 10, 14]. NK cells contribute to cancer immunosurveillance; GITR triggering diminishes NK cell effector function [9]. Addition of sGITRL-containing patient sera to cocultures of NK and tumor cells reduced NK cell cytotoxicity. Neutralization of sGITRL using a GITR-Ig fusion protein restored NK cell reactivity [10]. It was also described that GITR/GITRL system plays a key role in both acute and chronic inflammation [1517]. Recent studies show that GITR and GITRL expression increases in macrophages from human atherosclerotic plaques [18], rheumatoid arthritis [19], in lymphocytes from rheumatoid arthritis patients [20], and stimulation of GITRL-induced expression of proinflammatory cytokines in synovial macrophages [19]. GITRL expression also increases in patients with systemic lupus erythematosus [21]. In light of these findings, it is likely that an efficient method for the preparation of recombinant hGITRL would open alternative pathways for some human disease detection and for monitoring of efficacy for the use of GITRL in various therapies.

In the present paper, we described an efficient procedure for refolding of the hGITRL form inclusion body.

Materials and Methods

Construction of the pET20b-hGITRL Recombinant Vector

Human brain cDNA was a generous gift from Dr. Júlia Tóth [22]. The putative extracellular portion of hGITRL (amino acid positions 56–177) from human brain cDNA was amplified by polymerase chain reaction. The forward primer 5′- GGCATATGGAGCCCTGTATGGCTAAGTTTGGACC −3′ contained an NdeI restriction site at the 5′ end of the gene, and the reverse oligonucleotide 5′-GGAGGATCCTGGGAGATGAATTGGGGATTTGC-3′ contained a BamHI restriction site at the 3′ end of the coding sequence of the hGITRL. The amplified fragment was inserted in pET20b expression plasmid producing recombinant vector pET20b-hGITRL. The plasmid encodes a His6-tag, which promotes the purification of the recombinant protein by affinity chromatography.

Production of the hGITRL in Escherichia coli BL21 Star (DE3)

The recombinant plasmid was transformed into chemically competent E. coli BL21 (DE3) Star cell. The transformed cell suspension was plated on Lysogeny broth (LB) agar containing 100 μg/ml ampicillin supplemented with 1 % glucose and incubated overnight at 37 °C in order to select transformed colonies.

Starter culture of single colony was obtained by overnight incubation at 37 °C, at 250 rpm shaking in LB ampicillin supplemented with 1 % glucose. Expression culture was set up in volumes of 250 ml in LB media supplemented with 100 μg/ml ampicillin. The culture was grown at 37 °C to an OD600 value of about 0.8–0.9, isopropyl β-d-1-thiogalactopyranoside (IPTG) was added to a final concentration of 0.5 mM, and the culture was incubated for 4 h at 37 °C. The cells were harvested by centrifugation (5,000 rpm, 10 min, 4 °C) and lysed by sonication. The results of the expression were analyzed by 16.5 % sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gels and visualized by Coomassie Blue staining.

Solubilization and Refolding of the Inclusion Bodies

The inclusion body obtained from 250 ml culture grown at 37 °C was solubilized overnight at room temperature in 5 ml 6 M guanidine hydrochloride (50 mM Tris–HCl buffer, pH 8.8, and 1 mM dithiothreitol). The solubilized inclusion body was centrifuged at 14,000 rpm for 10 min, filtered (0.22 μm, Millipore), and stored at 4 °C. Protein concentration was determined by using the Quick Start Bradford Protein Assay kit (Bio-Rad) using bovine gamma-globulin standard.

Factorial screening for optimal conditions of refolding was performed in a final volume of 1 ml, following a modified protocol described previously [23]. The final concentrations of components in the refolding buffers are as follows: 0.1 M MES, pH 6.0; 0.1 M Na-phosphate, pH 7.0; 0.1 M Tris–HCl, pH 8.0; 0.1 M Tricine, pH 9.0; and 0.05 % polyethylene glycol (PEG-3350). Concentration of reduced and oxidized glutathione was either 5 and 0.5 mM or 0.5 and 5 mM. To 1 ml refolding buffer, 50 μl of solubilized protein was added at a final concentration of 0.16 mg/ml. After dilution, the samples were mixed on a shaker overnight at 4 °C and then centrifuged at 14,000 rpm for 10 min. Protein concentration in the supernatant was evaluated from optical density at 280 nm using the calculated molar extinction coefficient, ε = 2.54 × 104 M−1 cm−1. Absorbance values were corrected with the readings of appropriate buffers. On the basis of the screen results, the protein refolding was repeated in a final volume of 60 ml (2 ml of the solubilized material was diluted into 60 ml ice-cold refolding buffer). The composition of the refolding puffer, 0.8 M Gu–HCl; 0.1 M Tris–HCl, pH 8.0; 5 mM reduced glutathione; and 0.5 mM oxidized glutathione, was supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF, Sigma) and 0.05 % PEG-3350.

Ni-NTA Purification

The refolded protein was purified by adsorption on a Ni-charged polymer matrix (Profinity IMAC Ni-charged Resin, Bio-Rad). The nonspecifically bound proteins were washed with 50 mM sodium phosphate buffer, pH 8.0, containing 500 mM NaCl. Elution of the protein was carried out by 50 mM sodium phosphate buffer, pH 8.0, containing 300 mM NaCl and 250 mM imidazole. Imidazole was removed by dialysis against 20 mM sodium phosphate buffer, pH 8.0, and supplemented with 100 mM NaCl. The protein was stored at 4 °C.

Reverse-Phase Chromatography

To about 50–100 μl of dialyzed GITRL preparation, 1 ml of 10 % acetonitrile, 0.1 % trifluoroacetic acid was added, and the sample was loaded onto a Vydac C8 reverse-phase column (208TP54). The chromatography was performed by using an Agilent HP 1100 system at room temperature. Flow rate was 0.75 ml/min; buffer A contained 0.1 % (v/v) trifluoroacetic acid in water, and buffer B was 0.09 % trifluoroacetic acid in acetonitrile. After an initial wash with 10 % B, a linear gradient from 10 to 90 % B was applied in 8 min.

Gel Filtration

Gel filtration analysis was performed using a Superdex-75 column on a fast protein liquid chromatography system (ÄKTA, GE Healthcare Life Sciences) at a flow rate of 0.5 ml/min with buffer composed of 10 mM Na-phosphate, pH 8.0, and 100 mM NaCl. The protein elution was monitored at 280 nm, and the fractions were analyzed by electrophoresis on a 16.5 % SDS-PAGE gel. The column was calibrated with molecular weight marker proteins thyroglobulin (667 kDa), γ-globulin (158 kDa), ovalbumin (44 kDa), and myoglobin (17 kDa), and vitamin B12 (1.35 kDa), and a graph was drawn by plotting the partition coefficient Kav on the x-axis and log molecular weight on the y-axis. From this calibration graph, the molecular weights of the eluted proteins were calculated.

Fluorescent Labeling

The hGITRL was biotinylated using the EZ-Link Sulfo-NHS-LC-Biotinylation kit according to the protocol provided by the manufacturer (Pierce). The biotinylation reaction was stopped by adding 10 mM diethanolamine and then was verified by western blot analysis. The polyvinylidene difluoride (PVDF) membrane (Immobilon-P; Millipore) was blocked with 1× Tris-buffered saline (TBS)–Tween for 1 h and then treated with ExtrAvidin peroxidase conjugate (Sigma, dilution of 1:3,000) for 1 h at room temperature with shaking. The membrane was washed using a solution containing 20 mg diaminobenzidine, 25 μl H2O2, and 50 μl 100 mM NiCl2 in 50 ml TBS.

Flow Cytometric Analysis

Flow cytometric analysis was performed on the FACSCalibur system (Becton-Dickinson, Mountain View, CA). Cells (2 × 105) were washed with PBS containing 0.5 % BSA and 0.1 % sodium azide and incubated with 5 μg of recombinant hGITRL for 1 h on ice. Cells were washed twice and incubated with 0.3 μg of avidin-FITC (Alexa Fluor, Invitrogen) for 20 min. For detection of anti-GITR-PE (Miltenyi Biotec) binding, following preincubation with 5 μg of human IgG for 5 min, the cells were labeled with 2 μg of anti-GITR-PE for 20 min.

Extracellular Signal-Regulated Protein Kinase Phosphorylation Assay

A total of 2 × 106 THP-1 cells were treated with hGITRL (10 μg/ml) for 10 and 30 min at 37 °C. The cells were harvested by centrifugation and boiled in 100 μl of reducing Laemmle buffer, and 25–25 μl sample was loaded onto two 10 % SDS-PAGE. After separation, proteins were transferred to a PVDF membrane. The membranes were incubated either with the anti-phospho-extracellular signal-regulated protein kinase (ERK)1/2 (Thermo Scientific, dilution of 1:1,000) or anti-ERK1/2 (Cell Signaling Technology, 1:1,000) for overnight at 4 °C. The membranes were then incubated with horseradish peroxidase-conjugated secondary antibody (Cell Signaling Technology, 1:5,000) for 1 h. The proteins of interest were detected by using the Chemiluminescent Substrate kit (Thermo Scientific).

Results and Discussion

E. coli is frequently used as the host for protein production; however, the target proteins often accumulated in the form of inclusion bodies [24]. Some recombinant proteins appear in both the soluble and insoluble cell fractions, and many others are only produced as inclusion bodies (IBs) [2527].

Previous studies reported that the expression of the hGITRL resulted in the formation of inclusion body in a bacterial system [28, 29] but do not contain information about efficiency of hGITRL refolding. As we showed previously, a pETM52 expression vector containing the coding region of hGITRL produced soluble protein. In this construct, the fusion partner is DsbA, a chaperon protein believed to promote formation of the native structure of its fusion partners. In our case, about 30 % of DsbA-hGITRL fusion was found in a soluble form, but inclusion bodies were also formed. Cleaving the fusion partner, DsbA by TEV protease treatment from soluble hGITRL-DsbA resulted in precipitation of hGITRL, indicating that its folding was not correct [30]. Therefore, we decided to construct a simpler bacterial expression system which did not require proteolytic processing. For expression of the hGITRL gene, we chose pET20b plasmid. The recombinant vector, pET20b-hGITRL, was introduced into E. coli BL21 (DE3) Star, and the expression was realized at different temperatures (37 and 25 °C). Samples, taken before and after expression induction, were then analyzed by SDS-PAGE, thus providing a confirmation of protein expression. Much of the target protein was found to aggregate in inclusion bodies as presented in Fig. 1a, lane 4. On the basis of this gel, the size of the protein was 17 kDa, a value that agrees well with the calculated molecular weight of 16.4 kDa. It is a general tendency that the amount of soluble proteins increases at lower temperature (23 and 16 °C) [31, 32]. In our study, however, the amount of soluble GITRL at 25 °C was only slightly higher compared to 37 °C, and the majority of the target protein was accumulated in the form of inclusion bodies (Fig. 1b, lane 4). The yield of soluble hGITRL was about 10 % of the total expressed target protein at 37 °C, while 15 % of the hGITRL was found in a soluble form and accumulated in the cytoplasm at 25 °C.
https://static-content.springer.com/image/art%3A10.1007%2Fs12010-013-0232-0/MediaObjects/12010_2013_232_Fig1_HTML.gif
Fig. 1

Recombinant hGITRL analyzed by 16.5 % SDS-PAGE. a hGITRL expression in E. coli at 37 °C. b hGITRL expression in E. coli at 25 °C. Lanes M protein molecular weight marker (SDS7 Sigma), 1 proteins from the expression culture before induction, 2 cellular proteins after 4 h of expression (induced with 0.5 mM IPTG), 4 soluble proteins, 5 insoluble proteins. The gels were stained with Coomassie Blue. The arrows indicate the recombinant hGITRL. c SDS-PAGE analysis of purified hGITRL by a Ni-NTA column. The solubilized inclusion body obtained from 37 °C was refolded at optimal refolding conditions (pH 8.0, GSH/GSSG 5:0.5 mM, 0.05 % PEG-3350) and was purified on a NI-NTA column as described in “Materials and Methods.” Lanes M protein molecular weight marker (17-0446-01 Amersham), 1 purified refolded hGITRL

The proteins in IBs are not biologically active, so refolding of proteins is necessary. After isolation, inclusion body was solubilized in 6 M guanidine hydrochloride supplemented with 1 mM DTT. The solubilized inclusion body was centrifuged, filtered, and used for refolding screen as described in “Materials and Methods.” The aim of this screen was to obtain the optimal pH and ratio of the reduced and oxidized glutathione during refolding. We also tested the effect of PEG-3350 during refolding of hGITRL [23]. Only one concentration of each additive was studied in the refolding screen.

Refolding was initiated by rapid dilution of the solubilized protein into 20-fold excess of appropriate buffer solution. After overnight shaking, the precipitate was removed by centrifugation. The efficacy of refolding was estimated on the basis of the buffer-corrected absorbance of the supernatants at 280 nm using the calculated molar extinction coefficient (ε = 2.54 × 104 M−1 cm−1). Under our experimental conditions, A280 = 0.25 corresponded to 100 % refolding.

The yield of refolding by dilution of the solubilized inclusion body with buffers without any additive was rather low and poorly reproducible. It scattered in the range of 10–40 % independently of the pH of the buffer (data not shown). Addition of GSH/GSSG redox buffer significantly increased the yield and reproducibility of refolding. As expected, more reducing conditions (GSH/GSSG = 10:1) resulted in higher yields (Fig. 2). The amount of soluble hGITRL was highest at pH 8.0, both at high and low GSH/GSSG ratios. The higher yield at pH 8.0 compared to pH 6.0 is reasonable, since the reduction potential of glutathione buffer turns more negative as the pH increases [33]. The drop of the yield at pH 9.0 is somewhat unexpected. The fact that it occurs both at high and low GSH/GSSG ratios indicates that other factors than the reduction potential of the buffer influences refolding. Addition of 0.05 % PEG-3350 generally increased the yield by 5–15 %, except at pH 6.0 with high GSH/GSSG ratio and at pH 8.0 and 9.0 with low GSH/GSSG ratio. Based on the results, the pH of the refolding buffer, ratio of reduced and oxidized glutathione, and addition of PEG were identified to influence the refolding yields. Efficiency of the refolding was higher than 95 % at optimal conditions (pH 8.0, ratio of GSH/GSSG 10:1, 0.05 % PEG-3350).
https://static-content.springer.com/image/art%3A10.1007%2Fs12010-013-0232-0/MediaObjects/12010_2013_232_Fig2_HTML.gif
Fig. 2

Illustration of the renaturation yields of hGITRL from the refolding screen. After the refolding, the samples were centrifuged at 18,000 rpm. The protein concentration was checked out by measuring the optical density at 280 nm

Refolding of hGITRL at determined optimal refolding conditions was repeated at preparative scale. The solubilized inclusion bodies were refolded by rapid dilution into a redox buffer composed of 0.5 mM oxidized and 5 mM reduced glutathione supplemented with 1 mM PMSF protease inhibitor and 0.05 % PEG and then were dialyzed against Tris–HCl buffer, pH 8.0, as described in “Materials and Methods.” The refolded protein was further purified by adsorption on a Ni-charged polymer matrix as described in “Materials and Methods.” The purification of the refolded protein was followed by SDS-PAGE as presented in Fig. 1c. The overall yield of refolded hGITRL was higher than 50 mg/l E. coli culture. The purity of the final product was checked by reverse-phase chromatography (Fig. 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs12010-013-0232-0/MediaObjects/12010_2013_232_Fig3_HTML.gif
Fig. 3

Reverse-phase chromatographic profiles of recombinant hGITRL on a Vydac 208TP54 column. About 50 μg protein was injected. Flow rate was 0.75 ml/min, and elution was followed at 280 nm (a) and 220 nm (b), respectively (thick lines). In both panels, thin lines show the concentration of acetonitrile in the effluent

To determine multimeric forms in solution of the ligand, the purified hGITRL was then analyzed by size exclusion chromatography. The hGITRL displays a unique monomer–trimer equilibrium in solution, the trimer being the biologically active species in terms of receptor binding [29]. Zhou et al. expressed the extracellular region of the hGITRL and found that the hGITRL exists as a mixture of dimers and trimers in solution, and hGITRL shows a dynamic equilibrium between these oligomeric forms [18]. In our study, the molecular mass of the protein in the peak was about 37 kDa as presented in Fig. 4. The elution profile of the protein shows a rather broad peak, indicating the coexistence of several multimeric forms in rapid equilibrium.
https://static-content.springer.com/image/art%3A10.1007%2Fs12010-013-0232-0/MediaObjects/12010_2013_232_Fig4_HTML.gif
Fig. 4

Elution profile of the hGITRL from a Superdex G-75 gel-filtration column. Sample was eluted at a flow rate of 0.5 ml/min with buffer composing of 10 mM Na-phosphate buffer, pH 8.0, and 100 mM NaCl as the eluent, and the UV absorption at 280 nm was measured. The hGITRL was eluted as a broad single peak. The column was calibrated with molecular weight marker proteins of 670, 158, 44, and 17 kDa (Bio-Rad)

It has been shown that the receptor for hGITRL is expressed on both THP-1 and U937 cells [18]. Our results confirm this finding (Fig. 5a). To demonstrate binding activity of hGITRL, recombinant hGITRL was biotinylated, and the association of hGITRL with these cell lines was tested. The results show that biotinylated hGITRL binds to the surface of THP-1 (Fig. 5b) and U937 (data not shown) cell lines.
https://static-content.springer.com/image/art%3A10.1007%2Fs12010-013-0232-0/MediaObjects/12010_2013_232_Fig5_HTML.gif
Fig. 5

Interaction of the hGITRL and hGITR was measured by flow cytometry. a THP-1 cells (2 × 105 cells) were incubated with human anti-GITR-PE antibody (open area). b THP-1 cells (2 × 105 cells) were incubated with 5 μg recombinant biotinylated hGITRL and stained with avidin-FITC (open area). For background fluorescence, the cells were stained with avidin-FITC alone (filled area)

To demonstrate the biological activity of hGITRL, we tested whether GITRL activates ERK phosphorylation in THP-1 and U937 cells. GITRL-induced ERK phosphorylation has been documented already [34]. Cells were treated with recombinant hGITRL, and the levels of ERK1/2 phosphorylation at different time points were measured by western blotting as described in “Materials and Methods.” Our data showed that hGITRL induced ERK phosphorylation within 10 min, and the phosphorylation continued for 30 min (Fig. 6). In contrast, stimulation of THP-1 cells with hGITRL does not induce p38 MAPK phosphorylation (data not shown). Similar data were described previously in the case of Treg cells [35].
https://static-content.springer.com/image/art%3A10.1007%2Fs12010-013-0232-0/MediaObjects/12010_2013_232_Fig6_HTML.gif
Fig. 6

Effect of recombinant hGITRL on ERK phosphorylation. THP-1 cells were stimulated with hGITRL for 10 and 30 min, and ERK phosphorylation was analyzed by western blot analysis. However, as a control, the same sample was analyzed for total ERK as well. The phosphorylated ERK and total ERK were visualized by chemiluminescence. The C represents the unstimulated THP-1 cells. Experiments were repeated three times

In summary, we cloned and expressed the extracellular region of the hGITRL and determined optimal conditions for its refolding. We identified three important factors for the refolding of hGITRL: a ratio of GSH/GSSG, pH, and addition of PEG. We have shown that refolded recombinant hGITRL exists in solution as mixture of various multimeric forms, probably dimers and trimers. Using flow cytometric analysis, we demonstrated that the refolded hGITRL could bind to GITR of U937 and THP-1 cell lines. In vitro stimulation of this cell lines with recombinant hGITR ligand induced phosphorylation of ERK. From these results, we concluded that hGITRL was in its proper conformation. The obtained recombinant hGITRL would provide a way for further in vitro studies on the relation between GITR and GITRL in the antitumor immune response and inflammation.

Acknowledgments

This work was supported by the Department of Bioengineering, Sapientia Hungarian University of Transylvania; the Department of Biochemistry of Eötvös Loránd University; and the Department of Immunology, University of Debrecen.

Copyright information

© Springer Science+Business Media New York 2013