Journal of Gastrointestinal Surgery

, Volume 13, Issue 5, pp 983–993

Somatostatin Limits Intestinal Ischemia-Reperfusion Injury in Macaques via Suppression of TLR4-NF-κB Cytokine Pathway

Authors

  • Hao Wu
    • Department of Gastroenterology, West China HospitalSichuan University
  • Ling Liu
    • Lab. Peptides Related to Human Diseases, West China HospitalSichuan University
  • Qinghua Tan
    • Lab. Peptides Related to Human Diseases, West China HospitalSichuan University
  • Chunhui Wang
    • Department of Gastroenterology, West China HospitalSichuan University
  • Meimei Guo
    • Lab. Peptides Related to Human Diseases, West China HospitalSichuan University
  • Yongmei Xie
    • Lab. Peptides Related to Human Diseases, West China HospitalSichuan University
    • Department of Gastroenterology, West China HospitalSichuan University
Original Article

DOI: 10.1007/s11605-009-0816-8

Cite this article as:
Wu, H., Liu, L., Tan, Q. et al. J Gastrointest Surg (2009) 13: 983. doi:10.1007/s11605-009-0816-8

Abstract

Objective

Intestinal ischemia-reperfusion (IIR)-induced gut injury remains a challenge for critically ill patients despite the oxidative stress theory that has been elaborated. This study aimed to test whether Toll-like receptor 4 (TLR4) is involved in gut injury during IIR and whether somatostatin (SST) affects TLR4-nuclear factor-κB (NF-κB) cytokine pathway in the intestinal mucosa of macaques.

Design

Fifteen macaques were randomized into control, IIR, and SST + IIR groups. Pieces of isolated ileal epithelium from each animal were incubated with lipopolysaccharide (LPS), interferon-γ, or SST. Expression of TLR4 and NF-κBp65 was evaluated by immunohistochemical staining, Western blot analysis and reverse transcription polymerase chain reaction. Cytokine levels were measured by ELISA. Radioimmunoassay was used to determine of SST levels.

Measurements and Main Results

Significant overexpression (IIR vs control) of ileal TLR4 (0.17 ± 0.03 vs 0.05 ± 0.02), NF-κBp65 (0.55 ± 0.11 vs 0.15 ± 0.05), and TNF-α (213.2 ± 29.2 vs 56.0 ± 10.04) after IIR was greatly decreased (p < 0.05) by prophylactic use of SST (TLR4: 0.06 ± 0.02; NF-κBp65: 0.26 ± 0.09; TNF-α: 97.1 ± 32.3) in vivo. TLR4 expression in the ileal epithelium treated with LPS and SST (1,330 ± 93) was significantly lower than that in the ileal epithelium treated with LPS alone (2,088 ± 126) in vitro. SST levels in plasma (3.67 ± 0.41 ng/ml) and ileal mucosa (1,402.3 ± 160 ng/mg protein) of the IIR group were significantly lower than those (6.09 ± 1.29 ng/ml, 2,234. 8 ± 301.8 ng/mg protein) in the control group (p < 0.05).

Conclusions

Endogenous SST is a crucial inhibitor of massive inflammatory injury in the intestinal mucosa via direct suppression of the TLR4-NF-κB cytokine pathway induced by LPS in ileal epithelium. IIR attacks caused shortages of endogenous SST in the plasma and intestinal mucosa of macaques in this study. Therefore, preventive supplements of SST may limit intestinal injury of macaques by IIR.

Keywords

Somatostatin (SST)Toll-like receptor 4 (TLR4)NF-κBIntestinal ischemia-reperfusion (IIR)MacaquesCytokine

Critically ill patients are susceptible to injury of the intestinal mucosa, changes in gut permeability, and failure of intestinal defense mechanisms. These conditions put patients at risk of infection and multiple organ dysfunction syndrome (MODS).1 It has been reported that the splanchnic circulation is particularly vulnerable to hypoperfusion, as occurs with low-flow states such as hemorrhagic shock, infection, acute pancreatitis and transplantation.2 The mechanisms underlying intestinal ischemia-reperfusion (IIR)-induced gut injury are likely to be complex and multifactorial, although the oxidative stress-nuclear factor-κB (NF-κB) pathway has been considered to play a major role in the pathogenesis of lesions in the intestinal mucosa barrier.3,4

The intestinal epithelium is continually exposed to diverse bacteria and bacterial products. The biological response to endotoxins is mediated through the Toll-like receptor 4 (TLR4)-MD-2 receptor complex (TLR4 complex), which results in NF-κB activation and the release of cytokines, including interleukin-1 (IL-1), interleukin-6 (IL-6), and tumor necrosis factor-α TNF-α.5,6 Despite the density of commensal bacteria and their products in the intestinal epithelium, the host has evolved various mechanisms of tolerance to these organisms that allow a peaceful coexistence with resident bacterial flora. However, it is not clear whether TLR4, which is involved in the initiation of the host immune response to microorganisms, is essential for the control of the innate immune responses involved in gut injury during IIR.

Although stimulators for the expression of TLR4, such as lipopolysaccharide (LPS) and cytokines, have been widely reported,79 the regulation of TLR4 expression is still largely unknown. Somatostatin (SST), a multifunctional neuropeptide, is widely distributed in the central nervous system and gastrointestinal tract. Its suppression of the downstream agents of the TLR4-NF-κB pathway, such as IL-1, IL-6, TNF-α, in a paracrine fashion,10,11 suggests that SST may also inhibit the expression or activation of TLR4 or NF-κB, the upstream molecules of these cytokines. It would be wise to control the initiators of the cytokine cascade rather than suppress cytokines in the later stage of the cascade in attempts to prevent the maladaptive outcomes of innate immunity during an IIR attack. In addition, our previous study has shown that SST ameliorates the development of MODS via suppression of intestinal mucosal mast cells.12 These results suggest a probable shortage of endogenous SST in the intestinal mucosa of critically ill patients.

Various intervention studies on IIR or MODS have been widely performed in rodent animal models.13 Discrepancies between species have limited the application of some of this new knowledge in clinical practice. The resemblance of macaques to humans, in regard to anatomy, physiology, and biochemical metabolism, makes these nonhuman primates suitable experimental animals for investigating the pathophysiology of diseases relevant to humans. Therefore, to provide more useful suggestions for the clinical prevention of MODS, a macaque IIR animal model was used in this study.

This study aimed to investigate (1) whether TLR4 is essential for the control of innate immune responses to gut injury during IIR, (2) whether endogenous SST is an inhibitor of the expression or activation of the TLR4-NF-κB cytokine chain, (3) whether endogenous SST is low in ileal mucosa and plasma during critical states of illness, and (4) whether preventive supplements of SST may limit the massive inflammatory injures induced by IIR attacks.

Materials and Methods

Experiment Animals

Healthy adult rhesus macaques (4–7 years, body weight 6.9 ± 1.7 kg, male/female = 9/6) were obtained from the Animal Center of Sichuan University. All macaques were maintained in the facility after a quarantine inspection. The experiments in this study were performed in accordance with the guidelines of the Sichuan University Institutional Animal Care and Use Committee. All animals were fasted for 12 h, kept in an environment at a temperature of 20 ∼ 22°C with alternative illumination every 12 h, and drinking water was withdrawn 2 h before the experiment began.

Surgical Procedures of IIR in Macaques

Animals were anesthetized with xylazine (0.2 ml/kg, i.m.) and maintained with diazepam (0.1 ml/kg, i.v.) and carbrital (30 mg/kg, i.v.) as needed. A catheter was placed in a peripheral vein to infuse 0.9% saline and 20 g glucose (0.1 ∼ 0.2 ml/kg/min, i.v. gtt) for 24 h. Animals were given a midline laparotomy of 5 cm in length. Then, the superior mesenteric artery (SMA) was isolated and occluded with a microsurgical clip. After occlusion for 1 h, the clip was removed, and intestinal perfusion was reestablished. the animals were not given special volume resuscitation during and after the SMA occlusion, and infusion of saline and glucose was maintained at the same speed as mentioned above. Venous blood samples were taken again, and the animals were killed 24 h after IIR via removal of the vital organs.

Experimental Grouping

Fifteen macaques were randomly divided into three groups, with five animals (male/female = 3/2) in each group. For the control group, animals underwent a sham operation with the same treatment mentioned above, except the IIR procedure was not performed. In the IIR group, animals underwent an IIR procedure. In the SST + IIR group, SST-14 (Serono Singapore Pte Ltd, Singapore) was given to animals intravenously with a syringe pump at a dosage of 5 μg/kg/h from 5 min before occlusion of the SMA until the end of the experiment. The dosage (5 μg/kg/h) of SST was referred from the recommendation of 250 μg/h for human being.14 Other treatments for this group were the same as those in the IIR group.

Morphological Evaluation of Macaque Intestine

Specimens from the terminal ileum (5 cm from the distal end of the ileum) and the right colon were taken from each animal and fixed with 10% formaldehyde. After embedding these specimens in paraffin, sections were cut and then stained with hematoxylin and eosin for histological evaluation in a single-blinded fashion. For semiquantitative evaluation of lesions, ten arbitrary microscopic fields were viewed in each sample. The scoring system was based on the area of the inflammatory lesion: +, <1/3 total area; ++, 1/3–2/3 total area; and +++, >2/3 total area.

Visualization of TLR4, MD2, and NF-κBp65 by Immunohistochemistry

Sections of the terminal ileum and the right colon were deparaffinized and treated in a microwave for 15 min. For nonspecific blocking, 10% goat sera was added, and sections were incubated for 20 min at room temperature, then the following polyclonal antibodies were added into individual sections: rabbit anti-human TLR4 (1:100), rabbit anti-human MD2 (1:100), and rabbit anti-human NF-κBp65 (1:100; Santa Cruz Biotechnology Inc, CA, USA). After incubation with polyclonal antibodies for 120 min at 37°C and overnight at 4°C, the sections were stained with a ready-to-use streptavidin-catalase immunohistochemical reagent system as a detection reagent. Color reactions were developed with diaminobenzidine (DAB; Zhongshan Bioagent Company, Beijing, China). A semiquantitative immunohistochemical analysis of raw data with Image-Pro Plus 4.0 software was used to score integrated optical density (IOD) from the nuclear area of ileal epithelium. Each value was the mean ± SD of five visual fields in which duplicate measurements were made.

Isolation of Intestinal Mucosa Epithelial Cells

Epithelial cells from the intestinal mucosa of animals in the control group were isolated in accordance with previously described procedures.15,16 Briefly, the dissected terminal parts of the ileum were immediately placed in cold Hanks fluid and 1 mM DTT for 15 min to remove mucus. Then, samples were cut into small pieces and put into 20 ml EDTA and 10 mM D-Hanks fluid (pH 7.4). The bottle was shaken for 10–20 min at 37°C. After sediment from the tissue samples had settled, the supernatant was collected, filtered, and then centrifuged three times at 4°C, 1,500 rpm for 5 min. The supernatant was discarded, and the sediment was gently resuspended in cold Hanks fluid. With this procedure, more than 95% of cells were identified as mucosal epithelial cells which were confirmed by alkaline phosphatase rapid staining. The positive staining for intestinal epithelia cells was indicated as gray-black cell membrane. The cells were shown to be alive by negative staining with 0.2% Trypan-blue. The culture durations of isolated cells were usually limited ≤ 24 h before the experiment in vitro. Their viability could be guaranteed for 2 ~ 3 days and was checked again at the end of following experiments.

Quantification of TLR4, MD2, and NF-κB with Western Blotting

Protein was extracted from isolated ileum epithelial cells in accordance with Kaiser’s method.17 The extracted protein (30 μg) was incubated in loading buffer and heated at 100°C for 10 min. Samples were loaded onto an 8% sodium dodecyl sulfate-polyacrylamide gel, then transferred to nitrocellulose (65 mA, 90 min), and the nitrocellulose was incubated with rabbit polyclonal TLR4 antibody (1:500), MD2 (1:500), or NF-κBp65 (1:1,000), at 4°C overnight. Filters were then washed three times in blocking solution and incubated with horseradish peroxidase-linked immunoglobulin followed by exposure to an enhanced chemiluminescence Western blot luminal reagent (Promega Biosciences Inc, San Luis Obispo, CA, USA) and exposed to photographic film. Band densities were quantified using Quantity One software 4.5.0 (Bio-Rad Laboratories, Hercules, CA, USA). Each value was expressed as the ratio of the IOD of the TLR4, MD2, or NF-κB band to that of β-actin.

Cytokines Measured by Enzyme-Linked Immunosorbent Assay

Plasma and intestinal levels of IL-1β, IL-6, and TNF-α were measured by an enzyme-linked immunosorbent assay (ELISA) kit (Senxiong Company, Shanghai, China). The plasma levels of cytokines were normalized as picograms per milliliter. The ileal concentration of cytokines was normalized as picograms per gram of protein.

Detection of mRNA for TLR4, MD2, IL-1β, and TNF-α with the Reverse Transcription–Polymerase Chain Reaction

Total RNA was extracted from isolated ileum epithelial cells using the TRIZOL reagent (Roche, Burlington, NC, USA). Quantification and purity of extracted RNA were determined by the ratio of absorbance at 260 and 280 nm (A260/A280), which was ensured to be between 1.8 and 2.2. Reverse transcription (RT) and polymerase chain reaction (PCR) amplification were conducted by using PTC-100 PCR (Bio-Rad Laboratories Inc, Hercules, CA, USA). In accordance with the protocols of RT–PCR core kit (TaKaRa, Shiga, Japan). The sequences of primers and PCR products are listed in Table 1.
Table 1

The Sequences of Primers and PCR Products

mRNA

Sense

Antisense

Size(bp)

TLR4

TGCAATGGATCAAGGACCAGAGGC

GTGCTGGGACACCACAACAATCACC

449

MD2

GAAGCTCAGAAGCAGTATTGGGTC

GGTTGGTGTAGGATGACAAACTCC

422

IL-1β

AAACAGATGAAGTGGTCCTTCCAGG

TGGAGAACACCACTTGTTGCTCCA

388

TNF-α

AGGGCTCCAGGCGGTGCTTG

TGGTAGGAGACGGCGATGCGG

418

β - actin

CACCACACCTTCTACAATGAGC

GTGATCTCCTTCTGCATCCTGT

695

After denaturation of samples at 94°C for 1 min, PCR was carried out for 40 cycles (94°C for 30 s, 55°C for 30 s, 72°C for 60 s). The amplification was terminated by a final extension step at 72°C for 2 min. A positive control (human small intestine RNA) and an internal control (β-actin) were amplified at the same time. PCR products were quantified by running them on a gel and scanning the gel in an imaging system (Bio-Rad Gel Doc 2000). The data were normalized as a ratio of gray scale (IOD) of objective band over β-actin.

Effects of LPS, IFN-γ and SST on Ileal TLR4 Expression and Cytokine Levels In Vitro

Isolated ileum epithelial cells were incubated in DMEM medium (10% bovine serum, 100 U/ml penicillin, 100 U/ml streptomycin, 10 U/ml gentamycin) at 37°C for 3 h and grown in a six-well plate with 1 × 106 cells/ml in each well.

The isolated ileum epithelial cells were incubated separately with (1) LPS (10 μg/ml; Sigma, St Louis, MO, USA); (2) IFN-γ (20 ng/ml; Roche, Indianapolis, IN, USA); (3) SST-14 (2.2 μM/ml, Sigma); (4) LPS (10 μg/ml) + SST (2.2 μM/ml); (5) LPS (10 μg/ml) + IFN-γ (20 ng/ml); and (6) LPS (10 μg/ml) + IFN-γ (20 ng/ml) + SST (2.2 μM/m) for 24 h. Control wells were incubated with DMEM medium only. After incubation, the supernatant of each well was collected to measure TLR4 and cytokines by Western blotting, RT–PCR and ELISA.

In Situ Hybridization Detection of SST Receptor Subtype 2

Endogenous peroxidase was deactivated in deparaffinized sections of terminal ileum by 20% dioxogen, and 3% pepsase freshly diluted by citric acid was added to the sections before soaking in 1% paraform containing DEPC. The sections were incubated at 37°C for 4 h in prehybridization solution and covered with special coverslips for in situ hybridization, then washed in SSC at 37°C with hybridization solution and completed with confining solution. The sections were stained with biotinylated rat anti-cardiox and biotinylated peroxidase (Boshide, Wuhan, China). Color reactions were developed with DAB (Zhongshan, Beijing, China).

Radioimmunoassay for SST Levels in the Plasma and Ileal Mucosa

SST levels in the plasma and ileal mucosa of animals in each group were measured by a SST radioimmunoassay kit (Navy Radioimmunoassay Center, Beijing, China). Briefly, 2 ml of venous blood were mixed with 10% ENDA—Na2 30 μl and aprotinin (Trasylol, 500 KIU/ml) l0 ml in the pre-cooled tubes and immediately centrifuged (4°C, 5 min, 2,500 rpm). The 0.5 ml plasma was put into 50 μl acetic acid in another tube. Two milliliters of 100% acetone precooled at 4°C was added and centrifuged (4°C, 15 min, 1,500 rpm) twice. The supernatant was collected, dried with freeze dryer, and frozen at −70°C until analyzed. The ileal specimens (0.2 g) were boiled for 3 min in 1 ml sodium chlorine, homogenized in 0.5 ml 1 N ice-cold acetic acid, left at 4°C for 1 ~ 2 h, neutralized with 0.5 ml 1 N NaOH, and then centrifuged at 4°C, 15 min, 2,500 rpm. The supernatants were lyophilized and kept at −20°C until analysis.

RIA analysis was performed as the protocol of the kit. After the supernatant was completely aspirated, the radioactivity of the pellet was counted in a gamma counter. SST level was normalized as nanogram per milliliter for plasma or nanogram per milligram protein for ileal mucosa.

Statistical Analysis

All quantitative data were presented as mean ± SD from the five animals in each group. Duplicate measurements were made for each animal and were analyzed using the Statistical Package for the Social Sciences for Windows software (SPSS, version 10.0; SPSS, Inc., Cary, NC, USA). The data were evaluated with ANOVA then confirmed by a post hoc test for multiple comparisons. Significance was set at p < 0.05.

Results

Diverse Pathological Changes in the Small Intestine and not the Colon after IIR

All animals in the IIR group presented with small intestines fully inflated with gas, pale intestinal wall, multiple focus of hemorrhage, and mucosal erosion compared with the control group. No apparent changes were observed in the colon. Marked mucosal inflammatory injury of the ileum, including ablation of ileal villi, necrosis or erosion of the intestinal epithelium, hemorrhage of the intestinal mucosa, and inflammatory cell infiltration were observed under the microscope. The inflammatory lesion score in IIR group was significantly higher than that of the control group, p < 0.05 (Table 2). In contrast, histopathological lesions observed in the right colon were minor (Fig. 1).
https://static-content.springer.com/image/art%3A10.1007%2Fs11605-009-0816-8/MediaObjects/11605_2009_816_Fig1_HTML.gif
Figure 1

Histological sections of ileum (upper line) and right colon (lower line) from the three groups (Haematoxylin and Eosin stain, ×400).

Table 2

The Inflammatory Lesion Scores in Three Groups

Group

M/F

+

++

+++

Control

3/2

44

6

0

IIR

3/2

7*

23*

20*

SST + IIR

3/2

30**

14**

6**

M male, F female

*p < 0.05 vs control, **p < 0.05 vs IIR group

SST Prevented Intestinal Inflammatory Injury in Macaques with IIR In Vivo

The small intestines of macaques in the SST + IIR group were not as distended as those in IIR group. The inflammatory injuries of the intestines in SST + IIR group were obviously relieved when compared with those in IIR group (Fig. 1).The histopathological lesion score for the ileum in the SST + IIR group was significantly lower than that of the IIR group (p < 0.05; Table 2).

Activation of Ileal TLR4-NF-κB Cytokine Pathway and Cytokinemia after IIR

Immunohistochemistry revealed faint positive staining for TLR4, MD2, and NF-κBp65 in the ileal epithelium of the control group. After IIR, the ileal epithelium showed strong positive staining for TLR4, MD2, and NF-κBp65 (Figs. 23). Positive staining for TLR4 or MD2 was located in the cytoplasm and membrane of ileum epithelial cells. Strong positive staining of NF-κBp65 was visualized in the cytoplasm and nuclei of epithelial cells (Fig. 3). The nuclear expression of NF-κBp65 (IOD = 211.6 ± 16.0) in the IIR group was significantly higher than that (IOD = 32.4 ± 3.2) in the control group, p < 0.05 (Fig. 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs11605-009-0816-8/MediaObjects/11605_2009_816_Fig2_HTML.gif
Figure 2

Expression of TLR4, MD2 and NF-κBp65 in the ileal epithelium of macaques (Immunohistochemical stain, ×400).

https://static-content.springer.com/image/art%3A10.1007%2Fs11605-009-0816-8/MediaObjects/11605_2009_816_Fig3_HTML.gif
Figure 3

Visualization of NF-κBp65 in the nuclei of ileal epithelia (Immunohistochemical stain, ×800). Compared to the normal control group or SST + IIR group, much stronger positive staining for NF-kBp65 was not only showed in the cytoplasm but also visualized in the nuclei of ileal epithelia in IIR group.

The upregulation of ileal TLR4, MD2, and NF-κBp65 after IIR, shown by immunohistochemistry, was further supported by the quantification of protein expression using Western blotting (Fig. 4). In addition, cytokine levels in the ileum of the IIR group increased significantly (Table 3). Along with the upregulation of protein expression, increased levels of ileal TLR4, MD2, and cytokine mRNA after IIR was found (Fig. 5). Moreover, the plasma cytokines increased significantly at the same time (Table 3).
https://static-content.springer.com/image/art%3A10.1007%2Fs11605-009-0816-8/MediaObjects/11605_2009_816_Fig4_HTML.gif
Figure 4

Expression of TLR4, MD2, and NF-κBp65 in the ileal epithelia of macaque.

https://static-content.springer.com/image/art%3A10.1007%2Fs11605-009-0816-8/MediaObjects/11605_2009_816_Fig5_HTML.gif
Figure 5

mRNA for TLR4, MD2, TNF-α, and IL-1β in ileal epithelia of macaque (RT-PCR).

Table 3

Quantification of the Ileal and Plasma Cytokines in the Three Groups (ELISA)

Group

TNF-α

IL-1β

IL-6

Ileum (pg/g protein)

Plasma (pg/ml)

Ileum (pg/g protein)

Plasma (pg/ml)

Ileum (pg/g protein)

Plasma (pg/ml)

Control

56.0 ± 10.04

3.04 ± 1.01

82.8 ± 20.5

27.3 ± 7.17

709.6 ± 211.2

13.9 ± 10.50

IIR

213.2 ± 29.2*

64.8 ± 18.7*

294.0 ± 46.4*

79.2 ± 14.4*

1527 ± 160.8*

1261 ± 297.5*

SST +IIR

97.1 ± 32.3 **,***

19.2 ± 10.1**

129.1 ± 30.0**

40.0 ± 9.9**

950.4 ± 160 **

244.4 ± 70.0**

n = 5 in each group

*p < 0.01 vs control group, **p < 0.01 vs IIR group, ***p < 0.05 vs control group

SST Prevented the Activation of Ileal TLR4-NF-κB Cytokine Pathway and Cytokinemia in Macaques with IIR in vivo

Consistent with the histopathological changes, the downregulation of ileal TLR4-NF-κB cytokine pathway after prophylactic use of SST was visualized by immunohistochemistry (Figs. 2 and 3) and quantified in protein and mRNA levels by Western blot, ELISA, and RT–PCR (Figs. 45; Table 3). Positive staining for NF-κBp65 was rare and was dramatically lower in the nuclei of epithelial cells (Fig. 3). The nuclear expression of NF-κBp65 (IOD = 67.8 ± 7.4) in the SST + IIR group was significantly lower than that (IOD = 211.6 ± 16.0) in the IIR group (p < 0.05). In addition, plasma levels of cytokines in the SST + IIR group were significantly lower than those in the IIR group (Table 3).

Effects of LPS, IFN-γ, and SST on TLR4 Expression of Ileal Epithelium In Vitro

TLR4 expression in the isolated ileal epithelium was obviously induced by LPS. When given in combination with IFN-γ, LPS promoted more TLR4 expression than it did alone. SST significantly reduced TLR4 expression induced by LPS and notably arrested TLR4 expression promoted by LPS plus IFN-γ (Figs. 67; Table 4).
https://static-content.springer.com/image/art%3A10.1007%2Fs11605-009-0816-8/MediaObjects/11605_2009_816_Fig6_HTML.gif
Figure 6

Effects of treatments on TLR4 expression in the ileal epithelia of macaque. Western blot: first line, objective bands (89 KD). Second line, β-actin (42 KD).

https://static-content.springer.com/image/art%3A10.1007%2Fs11605-009-0816-8/MediaObjects/11605_2009_816_Fig7_HTML.gif
Figure 7

Effects of treatments on TLR4 mRNA expression (449 bp) in the ileal epithelia of macaque (RT-PCR).

Table 4

Effects of LPS, IFN-γ, and SST on Cytokine Levels in the Ileal Mucosa

Group

Control

LPS

SST

LPS+SST

IFN-γ

LPS+IFN-γ

LPS+IFN-γ+SST

IL-6

6.17 ± 2.15

52.03 ± 2.39*

8.20 ± 1.78

43.43 ± 11.4

9.87 ± 3.36

156.53 ± 33.74*

60.07 ± 15.32*,***

IL-1β

20.63 ± 5.79

39.07 ± 3.07*

23.67 ± 2.05

29.10 ± 8.55**

26.93 ± 5.67

68.67 ± 11.36*

30.73 ± 8.60*,***

TNF-α

7.57 ± 4.00

28.13 ± 5.99*

6.57 ± 1.81

18.37 ± 7.27**

13.33 ± 2.75

68.80 ± 7.36*

30.60 ± 7.71*,***

n = 5 in each group. The data (pg/ml) were detected by ELISA

* p < 0.01 vs control group, **p < 0.05 vs LPS group, ***p < 0.01 vs LPS+ IFN-γ group

Effects of LPS, IFN-γ, and SST on Ileal Cytokine Levels In Vitro

The levels of IL-6, IL-1β, and TNF-α in isolated ileal epithelium were stimulated by LPS. When given in combination with IFN-γ, LPS enhanced cytokine levels more than it did alone. SST significantly reduced the levels of IL-1β and TNF-α induced by LPS and notably decreased the levels of IL-6, IL-1β, and TNF-α promoted by LPS plus IFN-γ (Table 4).

Expression of SST Receptor Subtype 2 in Ileal Epithelium of Macaques

Positive staining for SST Receptor Subtype 2 (SSTR2) was visualized in the ileal epithelium of macaques. Stronger positive staining for SSTR2 was located in the epithelial crypt than in the villi epithelium (Fig. 8).
https://static-content.springer.com/image/art%3A10.1007%2Fs11605-009-0816-8/MediaObjects/11605_2009_816_Fig8_HTML.gif
Figure 8

Expression of SSTR2 in the ileal epithelia of macaques (in situ hybridization, ×400).

Changes of SST Levels in Plasma and Ileal Mucosa of Macaques with Different Treatments

SST levels in the plasma and ileal mucosa of macaques treated with IIR were significantly lower than those in the control group (p < 0.05). Prophylactic use of SST greatly enhanced SST levels both in the plasma and ileal mucosa (Table 5).
Table 5

SST Levels in the Plasma and Ileal Mucosa

Group

Plasma (ng/ml)

Ileal mucosa (ng/mg protein)

Control

6.09 ± 1.29

2234. 8 ± 301.8

IIR

3.67 ± 0.41*

1402.3 ± 160.0*

SST +IIR

29.3 ± 5.97**

2975.7 ± 354.4**

n = 5 in each group

* p < 0.05 vs control group, **p < 0.01 vs IIR group

Discussion

Gut injury because of ischemia and subsequent reperfusion events is a common pathophysiology that occurs in patients in various critical states. However, the major location of intestinal mucosal lesions has not been clearly described.13,18 We observed that the severe inflammatory damage associated with IIR is located in the ileal mucosa of macaque monkeys after occlusion of the SMA, whereas the histopathological changes of the whole colon were slight. Because the SMA supplies the small intestine and the right colon,19 the inflammatory lesions mainly located in the ileum cannot easily be explained by disturbances of local oxygen metabolism, oxyradical-dependent lesions, or bacteria toxin. This suggests that mechanisms other than oxidative stress might be involved. The small intestine, which is one of the major peripheral immune organs, may be more sensitive to insults during IIR than the right colon because of the initiation required for its intensive innate immune system.

As a type of pattern recognition receptor, TLRs play a pivotal role in the cellular activation of the innate immune response. Recognition of LPS by TLR4 requires mediation by MD2 and CD14 on the cell surface to form the LPS recognition compound.20 MD2 may increase the reactivity of TLR4 to LPS.21,22 A mutated form of MD2 can interrupt the LPS-mediated stimulation of TLR4.23 In this study, we visualized an overexpression of TLR4 in the ileal epithelium of macaques in the IIR group, which suggests the activation of TLR4 is upregulated by the significantly increased transcription and expression of MD2.

It has been widely accepted that two signaling pathways follow the TLR4 activation, the MyD88-dependent, and the MyD88-independent pathways 24,25. Endotoxin activation of the MyD88-dependent pathway results in rapid NF-κB activation and release of pro-inflammatory cytokines, such as TNF-α, IL-1β, IL-6, etc. Whereas the MyD88-independent pathway results in rapid activation of interferon regulatory factor 3 leading to beta interferon release and delayed NF-κB activation. NF-κB, a transcriptional factor involved in the regulation of the expression of multiple immune or inflammatory genes, usually remains inactive in the cytoplasm through association with the inhibitor IκB. As an upstream molecule, the activated TLR4 may cause the degradation of IκB that allows the translocation of NF-κB from the cytosol into the nucleus to induce the transcription of downstream gene expression.26,27 Immunohistochemical staining in this study revealed that a lot of NF-κB entered the nucleus of the ileal epithelial cells. Combined with the increased TNF-α, IL-1β, and IL-6, it is reasonable to deduce that the IIR-induced inflammatory injuries of the intestine are mainly related to the activation of the TLR4-MyD88-dependent pathway in macaques rather than the activation of the MyD88-independent pathway.

It is worth noting that only very faint expression of TLR4 was detected, and inflammatory injury of the ileal mucosa did not occur in the control group, although the mucosal surfaces and intestinal lumen were populated with a complex mixture of microorganisms. We hypothesized that decreased levels of endogenous SST during critical states might be involved in the expression of TLR4 after IIR. Indeed, SST levels in the plasma and ileal mucosa of macaques that underwent IIR were dramatically decreased by 40% and 37%, respectively.

Furthermore, the direct inhibitory effect of SST on the expression of TLR4 in isolated macaque intestinal epithelium was confirmed in our experiments in vitro. These experiments showed that SST was unable to affect the expression of TLR4 without the participation of LPS. In addition, SST exerted a maximum inhibitive effect on TLR4 expression when LPS coexisted with IFN-γ. Moreover, SSTR2, the molecular target for SST, was visualized in the ileal epithelium of macaques. Although the pathway between SSTR2 and TLR4 mRNA remains to be investigated, the data from this study is the first to demonstrate that SST is a direct inhibitor for the expression of TLR4 in ileal epithelium.

In vivo evidence that expression of TLR4-MD2 in the ileal epithelium of macaques was greatly decreased in the SST + IIR group further supports that SST is a strong suppressor of the expression and activation of TLR4. Consequently, the inactivated upstream molecule arrested the activation of NF-κB, which was supported by rarely observed positive staining for NF-κB in the nuclei of epithelial cells of the SST + IIR group. Along with these changes, the plasma cytokines obviously decreased. This series of events suggests that SST suppresses the TLR4-MyD88-dependent pathway in the ileal epithelium of macaques. Therefore, the shortage of SST following mesenteric ischemia reperfusion results in the loss of a vital endogenous inhibitor for inflammation and leads to massive damage of the gut mucosal barrier. The negative control of SST on the LPS/TLR4-NF-κB cytokine cascade gives us further insights into the regulation of the intestinal innate immune system in primates.

The circulatory level of SST may be a useful indicator in the clinical supervision of patients with stress or trauma. Prophylactic supplements of SST in the initial stages of IIR may maintain sufficient SST levels in plasma and the intestinal mucosa and might be a beneficial clinical strategy for the prevention of massive inflammatory injury of the intestinal mucosa in critically ill patients. Usually, IIR would follow the events such as hemorrhagic shock, infection, acute pancreatitis, and transplantation. Therefore, prophylactic supplements of SST should be given as soon as these clinical settings start other than the appearance of severe organ injury. As a therapeutic agent, SST may be too late to suppress massive inflammatory injury.

In conclusion, endogenous SST is a crucial inhibitor of massive inflammatory injury of intestinal mucosa via the direct suppression of the TLR4-NF-kB-cytokine pathway induced by LPS in ileal epithelium. IIR attacks cause shortages of endogenous SST in the plasma and intestinal mucosa of macaques. Therefore, preventive supplements of SST may limit intestinal injury of macaques with IIR.

Acknowledgment

This work was performed at the Laboratory of Peptides Related to Human Diseases, West China Hospital, Sichuan University and was supported by the technicians in that laboratory.

Copyright information

© The Society for Surgery of the Alimentary Tract 2009