Tree Genetics & Genomes

, Volume 5, Issue 1, pp 133–145

Development of “universal” gene-specific markers from Malus spp. cDNA sequences, their mapping and use in synteny studies within Rosaceae

Authors

    • East Malling Research
  • Annalisa Marchese
    • East Malling Research
    • Dipartimento di Colture ArboreeUniversità di Palermo
  • David W. Simpson
    • East Malling Research
  • Werner Howad
    • IRTA, Centre de Recerca en Agrigenòmica (CSIC-IRTA-UAB)
  • Felicidad Fernández-Fernández
    • East Malling Research
  • Amparo Monfort
    • IRTA, Centre de Recerca en Agrigenòmica (CSIC-IRTA-UAB)
  • Pere Arús
    • IRTA, Centre de Recerca en Agrigenòmica (CSIC-IRTA-UAB)
  • Kate M. Evans
    • East Malling Research
  • Kenneth R. Tobutt
    • East Malling Research
Original Paper

DOI: 10.1007/s11295-008-0178-5

Cite this article as:
Sargent, D.J., Marchese, A., Simpson, D.W. et al. Tree Genetics & Genomes (2009) 5: 133. doi:10.1007/s11295-008-0178-5

Abstract

The Rosaceae contains many economically valuable crop genera, including Malus (apple), Fragaria (strawberry), and Prunus (stone fruit). There has been increasing interest in the development of linkage maps for these species, with a view to marker-assisted selection to assist breeding programs and, recently, in the development of transferable markers to permit syntenic comparisons of maps of different rosaceous genera. In this investigation, a set of Malus cDNA sequences were downloaded from the European Molecular Biology Laboratory database. The sequences were aligned with homologous full-length Arabidopsis genomic DNA sequences to identify putative intron–exon junctions and conserved flanking exon sequences. Primer pairs were designed from the conserved exon sequences flanking predicted intron–exon junctions in the Malus cDNA sequences. These were used to amplify products by polymerase chain reaction from the parents of the Malus mapping progeny “Fiesta” × “Totem.” Eleven loci, representing ten genes (39%), were polymorphic in the “Fiesta” × “Totem” population and mapped to seven Malus linkage groups. Transferability to other rosaceous genera was high, with primer pairs representing 85% of genes, amplifying products from Fragaria and primer pairs representing 85% of genes, amplifying products from Prunus genomic DNA. These primers were screened in the Fragaria and Prunus mapping bin sets and 38% of the genes were successfully located on both maps. Analysis of the markers mapped in more than one rosaceous genus revealed patterns of synteny between genera, while a comparison with the physical positions of homologous genes on the Arabidopsis genome revealed high sequence conservation but only fragmentary patterns of macrosynteny.

Keywords

ArabidopsisComparative mappingRosaceaeBin mappingFragariaPrunus

Introduction

Comparative mapping and the assessment of macrosynteny has been studied in many plant families including the Brassicaceae (Lukens et al. 2003), Leguminosae (Kaló et al. 2004), Poaceae (Devos and Gale 2000), and Solanaceae (Doganlar et al. 2002). These studies have shown that genome evolution within a family proceeds through chromosomal restructuring (inversions and translocations) and, as a result, chromosomal regions in which marker order is highly conserved have been identified. This has permitted a comparative marker framework to be used for map-based predictions of the location of genes determining traits of economic importance within the different species of the family. In the eudicots, conserved syntenic regions have been identified between representative species of the three major eudicot species groups: caryophyllids, rosids, and asterids (Dominguez et al. 2003). In closely related species within the Solanaceae, such as potato and tomato, extensive genome collinearity has been observed between linkage maps (Bonierbale et al. 1988).

The Rosaceae, a horticulturally important family, contains four subfamilies, the Rosoideae (2n = 2x = 14; including strawberries, rose, raspberries, and blackberries), the Prunoideae (2n = 2x = 16; containing the stone fruits and almonds), the Maloideae (2n = 2x = 34; which includes apples and pears), and the Spiraeoideae (2n = 2x = 18; containing many ornamental species). There has been much interest recently in developing linkage maps of rosaceous crop species and as many have been constructed with transferable markers, it has been possible to conduct synteny studies within the family. Yamamoto et al. (2004) studied the synteny between maps of Japanese (Pyrus pyrifolia Nakai) and European (Pyrus communis L.) pears and maps of apple (Malus) and found essentially complete macrosynteny between the maps of these two closely related genera. Likewise, Dirlewanger et al. (2004) demonstrated that the genomes of species of the genus Prunus are largely collinear. Dirlewanger et al. (2004) also studied synteny between subfamilies, between maps of Malus and Prunus using 24 restriction fragment length polymorphisms (RFLPs) and six isoenzyme loci. Their comparisons revealed a high degree of synteny between the Malus and Prunus genomes and they were able to relate a number of Prunus linkage groups to Malus linkage groups using three or more markers, the positions of which were generally conserved between maps of the two genera.

Comparisons in silico between Prunus and Arabidopsis have revealed fragmentary patterns of conserved synteny. Georgi et al. (2003) compared homologous coding regions in Prunus persica and Arabidopsis and concluded that, while Prunus gene neighborhoods congruent with Arabidopsis were short, gene structure was remarkably well conserved and Arabidopsis genomic DNA sequence could be used to identify likely intron–exon junctions within Prunus expressed sequence tag (EST) sequences with a high degree of accuracy. Dominguez et al. (2003) comparatively mapped loci in Prunus and Arabidopsis and, comparing a total of 227 loci, identified 37 syntenic blocks spanning 23% of the Prunus reference map and 17% of the Arabidopsis genome sequence. Likewise, Jung et al. (2006) compared the map positions of 475 peach ESTs with their homologs on the Arabidopsis genome and found 139 syntenic regions—20 of which contained three or more gene pairs—the largest spanning 20 cM.

While highly transferable, the RFLPs and isoenzymes employed in a large number of the intergeneric studies to date require labor-intensive extraction and screening protocols to permit mapping, which are both time-consuming and costly. Sargent et al. (2007) designed gene-specific markers from Fragaria cDNA sequences that they showed were transferable to other rosaceous genera. However, their approach to marker development required sequencing to reveal intron sites, and often the primer pairs designed did not transfer between genera. Choi et al. (2004) successfully used the Arabidopsis gene set to predict intron sites in DNA sequences derived from a Medicago EST library and, likewise, Wei et al. (2005) developed polymerase chain reaction (PCR)-based markers from Rhododendron ESTs using the Arabidopsis genomic DNA sequence to predict intron–exon sites.

Since intron–exon junctions have been shown to be conserved between Arabidopsis and other species such as Medicago, Prunus, and Rhododendron (Georgi et al. 2003; Choi et al. 2004; Wei et al. 2005), we hypothesized that intron sites would be conserved between Arabidopsis and Malus. In this study, we compared Malus mRNA sequences and Arabidopsis genomic DNA sequences to locate the probable intron–exon junctions in Malus. We then designed primer pairs within conserved exon regions flanking putative introns in the Malus gene sequences and used these to amplify introns from genomic DNA of Malus, Fragaria, and Prunus. Polymorphisms were identified within these intron sequences and these were used to map homologous genes in mapping populations of these three rosaceous subfamilies. Moreover, we were able to compare the positions of genes mapped in the three rosaceous genera with their physical positions on the Arabidopsis genome.

Materials and methods

Plant material and DNA extraction

Four progenies were used for mapping in this investigation, the Malus mapping population (N = 84) Malus pumila “Fiesta” × M. sp. “Totem” (F × T; Fernández-Fernández et al. 2008), the diploid Fragaria reference bin mapping population (N = 6) Fragaria vesca 815 × Fragaria nubicola 601 F2 (FV × FN; Sargent et al. 2008), and the Prunus reference bin mapping population (N = 6) Prunus dulcis “Texas” × P. persica “Earlygold” F2 (T × E; Howad et al. 2005). An additional diploid Fragaria population—the 815 × 903BC population (N = 93) of Nier et al. (2006)—was used to confirm the map position of one marker where the segregation scores produced using the FV × FN bin set were ambiguous. DNA was extracted from all progenies using the DNeasy Plant minikit (Qiagen) according the manufacturer’s protocol and diluted 1:10 for use in PCR.

Sequence identification and primer design

The European Molecular Biology Laboratory (EMBL) database was used to retrieve DNA sequences from full-length Malus mRNA sequences, 62 of the 622 which were inspected, which were not part of multigene families. These sequences were downloaded and used as queries to blast the Arabidopsis gene set with introns (AGI) using the Arabidopsis information resource (TAIR) Blast 2.2.8 form on the TAIR website (Rhee et al. 2003; http://www.arabidopsis.org). The Arabidopsis genomic DNA and full-length coding sequence homologs with a significant match to each Malus gene sequence (generally sequences with an Arabidopsis match with a bit score above 60 and an E value cutoff of 1e−4) were downloaded from the TAIR website and aligned with the Malus sequences using MegAlign 6.1 (DNAStar Inc.) to identify conserved exon regions and putative intron–exon junctions within the Malus mRNA sequences. Once these junctions had been identified, primer sequences were designed from the flanking exon sequences that showed a high degree of sequence conservation to the Arabidopsis gene sequence, the intention being to create primers that would amplify homologous products across a wide range of rosaceous genera.

Primer pairs were designed using the software PRIMER 3 (Rozen and Skaletsky 1998). The criteria for design were a Tm of 55 to 65°C (optimum 60°C), a primer length of 20 to 24 bp (optimum 22 bp), and a 2-bp GC-clamp at the 3’ end. All forward primers were synthesized with an M13 tail at the 5’ end (i.e., 5’ TGT AAA ACG ACG GCC AGT-PRIMER 3’) for subsequent fluorescent labeling for genotyping or for direct sequencing using an M13 primer. Primers were named Mp, for M. pumila, followed by a two- to seven-character abbreviation of the gene name (i.e., Calcium-dependent protein kinaseCPK), followed by a number to indicate the intron that the primers flanked (1, 2, 3 etc.).

PCR conditions, product visualization, and marker segregation in Malus

PCR was performed on genomic DNA of “Fiesta” and “Totem” following the methods of Fukatsu et al. (2005) with minor modifications. Each PCR reaction was performed in a final volume of 12.5 μl comprising ∼1 ng template DNA, 1× PCR buffer, 1.5 mM Mg2+, 200 μM dNTPs, 0.2 μM reverse primer and M13F primer labeled with 6-FAM (5’ 6-FAM TGT AAA ACG ACG GCC AGT 3’), 0.008 μM M13-tagged forward primer (5’ TGT AAA ACG ACG GCC AGT-PRIMER 3’), and 0.25 U Taq polymerase (Invitrogen). Reactions were then carried out following the touchdown protocol described by Sargent et al. (2003) between 55°C and 50°C. Products were visualized firstly by electrophoresis through a 300 ml 1.2% TAE agarose gel (110 V for 2.5 h) which was stained with ethidium bromide for 30 min. Products under 500 bp were then separated by electrophoresis on an ABI 3100 prism genetic analyzer (Applied Biosystems) and data generated were collected and analyzed using the GENESCAN and GENOTYPER (Applied Biosystems) software. Primer pairs revealing heterozygous polymorphisms between the parental genotypes were then used to score the F × T progeny and the data generated were analyzed using the methods and software described above.

PCR conditions, product visualization, and marker segregation in Fragaria and Prunus

PCR was performed initially on DNA of the grandparental genotypes of both the Fragaria (Sargent et al. 2008) and Prunus (Howad et al. 2005) bin mapping populations, following the methods described above for Malus. Those primer pairs that revealed length polymorphisms between the grandparental genotypes were scored in the bin set. Products greater than 500 bp in length or that did not reveal length polymorphisms were sequenced directly from PCR products from the M13-tailed primer. Briefly, PCR was performed in a final volume of 100 μl comprising ∼10 ng template DNA, 1× PCR buffer, 1.5 mM Mg2+, 200 μM dNTPs, 0.2 μM primers, and 2.0 U Taq polymerase (Invitrogen). Reactions were carried out following the touchdown protocol described by Sargent et al. (2003) between 55°C and 50°C. The PCR products were purified using the QiaQuick PCR purification kit (Qiagen) according to the manufacturer’s protocol and resuspended in 30-μl sterile distilled water. The products were sequenced by Qiagen Genomics Services Germany, using the M13 primer sequence incorporated into all forward primers, and single-nucleotide polymorphisms (SNPs) were identified using SeqMan 6.1 of the Lazergene software package (DNAStar). For one locus (MdACAULIS4), the heterozygous products generated by sequencing from the FV × FN bin set seedlings were difficult to interpret unambiguously. This locus was mapped in the 815 × 903 BC diploid Fragaria population of Nier et al. (2006) to confirm its map position, following the methods described above for mapping in Malus.

Segregation data analysis and marker mapping

Alleles at segregating loci in the F × T mapping population were coded for analysis using JoinMap 4.0 and incorporated into the dataset of Fernández-Fernández et al. (2008) as follows. Genetic distances were calculated using regression mapping applying the Kosambi mapping function and marker positions were determined using a recombination fraction threshold of 0.35, ripple value of 1.0, jump threshold of 3.0, and triplet threshold of 5.0. The LOD threshold for acceptance of linkage between markers was ≥3.0. Markers were assimilated into the linkage groups defined by Fernández-Fernández et al. (2008) and the map presented was visualized using MapChart 2.0 for Windows (Voorrips 2002).

Primer pairs producing amplicons in which intron length polymorphisms or polymorphic SNP sites were revealed between the grandparents of the Fragaria and/or Prunus bin mapping populations were used to generate products for sequencing following the protocols described above. The length polymorphisms or SNPs were scored in the bin set seedlings and their locations were added to the respective bin maps of those genera.

Linkage group and mapping bin nomenclature

The Malus linkage groups presented here have been labeled 1–17 in accordance with Maliepaard et al. (1998) and Fernández-Fernández et al. (2008). However, for clarity in this investigation, Malus linkage group numbers are preceded by MG, i.e., MG1–MG17. Bin nomenclature referred to for Fragaria and Prunus follows that of Sargent et al. (2008) and Howad et al. (2005), respectively. For clarity, when referred to in the text, Fragaria linkage groups, usually denoted I–VII (after Davis and Yu 1997), are given in Arabic numerals, preceded by FG, i.e., FG1–FG7, and numbering for Prunus follows that of Dirlewanger et al. (2004), with linkage group names preceded by PG, i.e., PG1–PG8.

Identification of markers on the Arabidopsis genome

The SeqViewer tool on the TAIR website (http://www.arabidopsis.org) was used to view the TIGR 7.0 version of the Arabidopsis genome and its associated annotation and to identify the locations on the Arabidopsis genome of the closest homologs to the 16 Malus genes mapped in the three rosaceous genera in this investigation. The Arabidopsis gene homolog names were entered into SeqViewer and their positions were displayed using the whole genome view. Exact positions of genes were identified using the nucleotide view functions of the TAIR Arabidopsis SeqViewer.

Results

Primer pair design and product amplification

Thirty-seven of the 62 Malus cDNA sequences downloaded from the EMBL database had a match with an Arabidopsis sequence with an E value >1e−4. Twenty-seven of the Arabidopsis homologs contained introns around which primers could be designed at appropriate conserved sites in the Malus cDNA sequences. The minimum number of introns contained in a single Arabidopsis gene homolog was one and the maximum ten, with an average of 3.6 introns per sequence.

In total, 98 primer pairs were designed from Malus cDNA sequences. Primer pairs were designed where possible from exon sequence around all introns; thus, ten primer pairs were designed flanking the ten predicted introns in the Farnesyl pyrophosphate synthase (FPS) sequence, while only one primer pair was designed flanking the single intron in Flavonol synthase. At least one primer pair in every gene amplified a product of approximately the size expected for a product containing an intron in “Fiesta” and “Totem,” the parents of the Malus mapping population. An exception was the two primer pairs designed from the cDNA sequence of the gene Serine threonine protein phosphatase, which both consistently failed to amplify a product, presumably either due to very large intron product sizes or poor homology between the EMBL mRNA sequence and the sequence of the primer binding sites in “Fiesta” and “Totem.” Thus, primer pairs were successfully designed flanking putative intron–exon junctions in 26 Malus genes. Just 12 primer pairs in total, flanking putative introns in eight cDNA sequences, failed to amplify a product, and a total of 86 primer pairs amplified products in “Fiesta” and “Totem.” Although the majority of the primer pairs amplified products indicating single loci in Malus, some primer pairs amplified products of two distinct sizes, indicating two discrete loci, in accordance with the allotetraploid nature of the Malus genome. However, primer pairs amplifying two putative loci in Malus revealed just a single product in the diploid Fragaria and Prunus species accessions in which they were subsequently tested. Table 1 lists the primer names and sequences for the 86 primer pairs that amplified a product from Malus genomic DNA, along with the gene names and EMBL accession numbers of the 26 mRNAs, the number of the putative intron around which each primer pair was designed, and the number of putative loci each primer pair amplified in Malus.
Table 1

Primer names and sequences for 86 primer pairs designed flanking putative intron–exon junctions in 26 Malus mRNA sequences, along with the EMBL accession numbers of the cDNA sequences, the nucleotide start site of the forward primer in the EMBL cDNA sequence, the number of the putative intron around which the primers were designed, and the putative number of loci revealed in Malus

Malus gene

EMBL accession number

Primer name

Forward primer sequence (5’–3’)

Reverse primer sequence (5’–3’)

Forward primer start (nt)

Intron

No. putative loci in Malus

Amplification

Fragaria

Prunus

3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR)

AY039230

MpHMGR1

tctacttgctcggattcttcg

tgaccacctcctcatcttcc

446

1

2

3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR)

AY039230

MpHMGR2

cttgtgtgaggttcaactctgc

ggcacacttaattgtctgaagc

1109

2

2

3-hydroxy-3-methylglutaryl coenzyme A reductase (HMGR)

AY039230

MpHMGR3

gatttcctccagaacgacttcc

attggttttcaacaccttctgc

1339

3

2

Spermine synthase (ACL5)

AB204522

MpACAULIS1

aaagggactagcgagtatcagg

acttctgcactttgcatcttcc

273

1

1

Spermine synthase (ACL5)

AB204522

MpACAULIS2

agatgcaaagtgcagaagtgg

aatttgtgcttgagtgcttcc

349

2

1

Spermine synthase (ACL5)

AB204522

MpACAULIS3

caaattgctggacaaagttacc

caactgggtctgctaaatctcc

488

3

1

Spermine synthase (ACL5)

AB204522

MpACAULIS4

atttagcagacccagttgaagg

agaggtgaagacctctttgtgg

664

4

1

ACC synthase (ACS)

AB010102

MpACS1

acaaacgggattattcagatgg

gctctgcaaatatggattctcc

2471

1

1

ACC synthase (ACS)

AB010102

MpACS2

tttgcagagcttgctctcttcc

gcagaagataaaggtctcattcg

2708

2

1

ACC synthase (ACS)

AB010102

MpACS3

tttatcttctgccttgctgacc

gaatgggtacaatctcgactcc

2992

3

1

Alpha amylase (AMY)

AF153828

MpAAmy1

atctggttttacgtcagcatgg

catcatagcggttgtactttcc

203

1

1

Alpha amylase (AMY)

AF153828

MpAAmy2

gaaagtacaaccgctatgatgg

ttattacgtagccactgcaacc

412

2

1

Alpha amylase (AMY)

AF153828

MpAAmy3

tattacaggatggttgcagtgg

gttgcaagaatcccaatactcc

560

3

1

Alpha amylase (AMY)

AF153828

MpAAmy4

tttttctgttggggagtattgg

cccttggttgtaaagtcaaacg

680

4

1

Alpha amylase (AMY)

AF153828

MpAAmy5

gcgtttgactttacaaccaagg

gaaggtgacagatcgagaagg

801

5

1

Auxin binding protein (ABP)

U77952

MpABP1

aaatatcagtgagcttccacagg

cacaagaatgcctgtgtattgg

117

1

1

Auxin binding protein (ABP)

U77952

MpABP2

gccacaagagttctctatctttgc

taactttgctgcagtgtgtgg

348

2

1

Beta-cyanoalanine synthase 1 (BCS)

DQ471308

MpBCSyn1

acaaagtcactgagggatgtgg

ataaacgccatgctgattcc

321

1

1

Beta-cyanoalanine synthase 1 (BCS)

DQ471308

MpBCSyn2

attctcactgatccaaccaagg

gtcaacttgtccgttggtatcc

605

2

1

Beta-cyanoalanine synthase 1 (BCS)

DQ471308

MpBCSyn3

gagatatgggaggataccaacg

tactttcagcaggctccactcc

746

3

1

Beta-cyanoalanine synthase 1 (BCS)

DQ471308

MpBCSyn4

gagcctgctgaaagtaatgtgc

tctttccaacatatccaagtcc

872

4

1

Calcium-dependent protein kinase (CPK)

AY395701

MpCPK1

tggaaaggaaatagacatttgg

tgcagaagtaattctctttcttgg

1023

1

1

Calcium-dependent protein kinase (CPK)

AY395701

MpCPK2

ggccatcaatatcagacagtgc

atggcttgtctgatgctactcc

1163

2

2

Calcium-dependent protein kinase (CPK)

AY395701

MpCPK3

agtccagggcaatgaataagc

gctaaacctgtcttcagttcttcg

1328

3

1

Calcium-dependent protein kinase (CPK)

AY395701

MpCPK4

aggccttaaaacaatgttcacc

gtcaattgatccatttccatcg

1404

4

1

Calcium-dependent protein kinase (CPK)

AY395701

MpCPK5

gcatttcagtacttcgacaagg

cattccatgctccttcatagc

1633

5

1

Calcium-dependent protein kinase (CPK)

AY395701

MpCPK6

tgaattagaggctgctatgaagg

ctggaaacaatgctctgatacg

1680

6

2

Dehydroascorbate reductase (DHR)

DQ322706

MpDHAR1

acctgatctcctcggcgact

ttgggtttgtcgctgagatt

121

1

1

Dehydroascorbate reductase (DHR)

DQ322706

MpDHAR2

catcaatctcagcgacaaacc

agaaggctcagggtatttttcc

205

2

1

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS1

ggtgtactccgttctgaaatcg

agttaattcccttccttgttgc

172

1

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS2

attgacagctatcagttgttgc

atctaaaccagcaaggctgacc

305

2

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS3

agccttgctggtttagattgc

tctgagaatccttgggatatgg

456

3

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS4

gcagtaaatgatggtgttgtgc

ttggatagatctttttctccttcg

494

4

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS5

tcgaaggagaaaaagatctatcc

cggaaaggtaaaatgagtaatagg

648

5

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS6

gcctattactcattttacctttcc

cagttcctcacctgacataagc

716

6

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS7

cttatgtcaggtgaggaactgg

ccaatcgtttccggatcacc

755

7

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS8

atgattatttggattgctttgg

tgttcctcattgcagagttcc

837

8

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS9

gatttcaagtgctcttggttgg

ttactgttgccacattttctgg

899

9

2

Farnesyl pyrophosphate synthase (FPS)

AY083165

MpFPPS10

aaggccctctacaaagaactcg

ttgtaaatcttgcccaagaagg

1013

10

2

Flavonol synthase (FLS)

AF119095

MpFLS2

tcgtccccaacgatgttcag

cttgttcacagtggttctgtgc

768

2

1

Gibberellin 20-oxidase (GOX)

AB037114

MpAP20OX1

aatgggggaagaattcaagg

taaagtctgctcaggtctctgg

752

1

1

Gibberellin 20-oxidase (GOX)

AB037114

MpAP20OX2

tcaacattggtgacaccttc

cgcttttgtacttcccatttg

1164

2

1

Glutathione peroxidase (GP)

AF403707

MpGP1

ttgatctcagcacctacaaagg

catacaactgagccaactctgtg

264

1

1

Glutathione peroxidase (GP)

AF403707

MpGP2

cacagagttggctcagttgtatg

aaagatgggatactcagccttg

343

2

1

Glutathione peroxidase (GP)

AF403707

MpGP3

cgcttcaaggctgagtatcc

gagaagttgtaggggcataacg

470

3

1

Jointless (JL)

DQ402055

MpJOINTLESS1

gaggagaagaggccttttgaag

ctgtagctgaagagatggttgttc

69

1

1

Jointless (JL)

DQ402055

MpJOINTLESS2

ctagaacaaccatctcttcagc

gccagtttcaagtgacttctcc

235

2

1

Jointless (JL)

DQ402055

MpJOINTLESS3

tgagaggagaagaaattcaagga

tgaagatcaccgatctctttcat

332

3

1

Jointless (JL)

DQ402055

MpJOINTLESS4

gaaagagatcggtgatcttcaaa

aatcgttcattctcttccatcaa

441

4

1

Leafy (LEAFY)

AB056158

MpLEAFY1

cttgttggggagaggtatgg

cacagctcgtagagatagaagagg

331

1

1

Leucine-rich receptor-like protein kinase (LRPK)

AF053127

MpLRPKm1

ggattttggagctcgagtgg

attgtctacccctttctgatcc

2496

1

1

L-galactose dehydrogenase (LGD)

AY264803

MpLGalDH1

aggcatcaacttctttgacacc

gtcatggcattgcagtatatcg

185

1

1

L-galactose dehydrogenase (LGD)

AY264803

MpLGalDH3

tcattagtgcttctccacttgc

ggacaagctgtattgcagagc

658

3

1

L-galactose dehydrogenase (LGD)

AY264803

MpLGalDH4

agctctgcaatacagcttgtcc

gccatgtctgattcttcactgg

800

4

1

Maltose transporter (MEX)

DQ648082

MpMEX1

ctgcaaatgcctcaaatctacc

cctcattctccctcttctttgc

388

1

2

Maltose transporter (MEX)

DQ648082

MpMEX2

gtcattacctccattgttgtcg

ttgggtagatatggaacaaacg

628

2

2

Maltose transporter (MEX)

DQ648082

MpMEX3

tggcttttgttgtagctgtgg

tagctgtccatccagatattgc

815

3

2

Maltose transporter (MEX)

DQ648082

MpMEX4

acacttctcttcatgtggatgc

acatcgaggaagctgataaacc

916

4

2

Maltose transporter (MEX)

DQ648082

MpMEX5

tttttattcgtgatttgatgtgg

aagaaagaagcccaagtagaacc

1049

5

2

Maltose transporter (MEX)

DQ648082

MpMEX6

cttgggcttctttcttttatgg

tgtcgctgctaagaaaaattcc

1085

6

2

Maltose transporter (MEX)

DQ648082

MpMEX7

gacaactggtttgtttttgtgg

caacagcatctctccatacagc

1170

7

2

NAD-dependent sorbitol dehydrogenase (NDSD)

AB016256

MpNDSD1

aagagaacatggctgcttgg

agccggactctaacatcatgg

125

1

1

Non-symbiotic haemoglobin 1 (GLB)

AY224132

MpGLB1

acagaagaacaggaaacactgg

gtccctcaagaaagagaacagc

19

1

2

Non-symbiotic haemoglobin 1 (GLB)

AY224132

MpGLB2

cctcttgagaagaacccaaagc

actgtaaccttgcctgctttcc

166

2

2

Non-symbiotic hemoglobin 1 (GLB)

AY224132

MpGLB3

tgcagttcaactcaggaaagc

cagcaaccaactgatcataagc

231

3

2

Omega-3-desaturase (O3D)

AY551558

MpO3Des2

tcttcaatccttgtcccatacc

ggttctgatgatgagttctgtgg

541

2

1

Omega-3-desaturase (O3D)

AY551558

MpO3Des3

gtcgaaaatgacgagtcttgg

agaaaggataagcaagcatgg

610

3

1

Omega-3-desaturase (O3D)

AY551558

MpO3Des4

tttaggttcaccctaccattcc

gctgtttggatcataatgagagc

682

4

1

Omega-3-desaturase (O3D)

AY551558

MpO3Des5

gctctcattatgatccaaacagc

acgataccatggaagcttgtcc

755

5

1

Omega-3-desaturase (O3D)

AY551558

MpO3Des6

ttccatggtatcgtgggaag

ggatttgagggaagagatgatg

977

6

1

Omega-3-desaturase (O3D)

AY551558

MpO3Des7

catcatctcttccctcaaatcc

cagtaggtgaagtgggagagg

1090

7

1

Pectate lyase (PL)

AY376878

MpPL1

cgttcaatcactttggagaagg

ggctattgattgtagggtctgc

927

1

2

Polyamine oxidase (PAO)

AB250235

MpPAO1

ctcctccgtcatcattgtcg

gagaagatagtgcggagattcg

63

1

2

Polyamine oxidase (PAO)

AB250235

MpPAO2

aatgctcgctacaacatctacg

cgtgtagggtgaaatcaatgg

319

2

2

Polyamine oxidase (PAO)

AB250235

MpPAO3

ccattgatttcaccctacacg

caaccaaaaactctcgttctcc

500

3

2

Polyamine oxidase (PAO)

AB250235

MpPAO4

cctttttggattatggagaacg

catgtaatttgcttggaagacg

554

4

2

Polyamine oxidase (PAO)

AB250235

MpPAO5

tcagttagcattggtgttctcc

aggataagcattttccatgtgc

778

5

2

Soluble inorganic pyrophosphatase (SIP)

AF220202

MpSolInP2

acctggagctcctaagattttc

gctcatatttcactttgcttcc

318

2

2

Soluble inorganic pyrophosphatase (SIP)

AF220202

MpSolInP3

ggaagcaaagtgaaatatgagc

ggggtagacaacagatgagtcc

364

3

2

Soluble inorganic pyrophosphatase (SIP)

AF220202

MpSolInP4

tggactcatctgttgtctaccc

ctggtcaatcataggcatcagg

425

4

2

Soluble inorganic pyrophosphatase (SIP)

AF220202

MpSolInP5

gcctgatgcctatgattgacc

aggatcatcagcacaaacagc

563

5

2

Sucrose transporter (SUT)

AY445915

MpSUT2

gagaagctttgcaggaaatgg

gagaagaaaccaaagcatacgg

1080

2

1

Terminal Flower 1 (TFL)

DQ535888

MpTFL1

ctagtctgcaatggacttgagc

actagggcctggaaaatctgg

127

1

1

Terminal Flower 1 (TFL)

DQ535888

MpTFL3

attccaggcaccacagatgc

cttcggcatctcataactcacc

1516

3

1

Xyloglucan endotransglycosylase (XET)

AY144593

MpXET1

aattacttgtttggccacttcc

cattggtctgcagaatgtatgg

271

1

2

Xyloglucan endotransglycosylase (XET)

AY144593

MpXET2

ggatagagagcagaggattttcc

aggctggagtagagcttcatgg

456

2

2

The Fragaria and Prunus columns indicate whether the primer pairs amplified a product from Fragaria and Prunus genomic DNA

Transferability to Fragaria and Prunus

When the 86 primer pairs were tested on F. vesca 815 and F. nubicola 601, 52 (61%), representing introns in 22 (85%) of the 26 genes studied, amplified a PCR product of a size approximately similar to that amplified in Malus. Likewise, in the “Texas” and “Earlygold” Prunus genotypes, 59 (69%) primer pairs, again representing introns in 22 (85%) of the 26 genes studied, amplified such a PCR product. The primer pairs that amplified a product in Fragaria and Prunus are indicated in Table 1.

Marker polymorphism, segregation, and mapping in F × T

Primer pairs for ten (42%) of the 26 genes for which intron products could be amplified revealed polymorphic, heterozygous products in “Fiesta” and “Totem” and thus could be scored in the F × T mapping population. Despite many primer pairs amplifying two distinct products, primer pairs for just one gene, Maltose transporter (MEX) amplified two polymorphic loci that segregated independently, the primer pairs for the remaining genes where two loci were revealed, amplified two homozygous loci or just a single heterozygous locus. After cosegregation analysis, all 11 segregating loci were located on the map of Fernández-Fernández et al. (2008). Figure 1 shows the linkage groups and map positions of these 11 markers. The names of the primer pairs used to map the 11 loci, along with the size of the amplicons scored, segregation data and chi-squared values of tests for goodness of fit to the expected Mendelian segregation ratios, and their map positions are given in Table 2.
https://static-content.springer.com/image/art%3A10.1007%2Fs11295-008-0178-5/MediaObjects/11295_2008_178_Fig1_HTML.gif
Fig. 1

Seven of the 17 Malus linkage groups of the F×T map to which the 11 gene-specific markers mapped in this investigation located, showing the map positions of the markers in centiMorgans. Linkage group numbering follows that of Fernández-Fernández et al. (2008); however, for clarity in this investigation, linkage group numbers are preceded by MG

Table 2

The 11 loci mapped in the Malus mapping population F×T and the primer pairs used to amplify each locus, along with the size of the amplicons generated, segregation data and chi-squared values of tests for goodness of fit to the expected Mendelian segregation ratios, the linkage groups to which they were mapped and the locus positions in centiMorgans from the origin of each linkage group

Locus

Primer pair

Amplicon sizes

Expected Segregation

Observed

χ2

Df

Signif.a

Linkage group

Position (cM)

ACL5

MpACAULIS4

256/261

1:1

44:40

0.19

1

8

0

CPK

MpCPK1

329/330

1:1

44:39

0.3

1

5

0

DHR

MpDHAR2

315/317

1:1

33:51

3.86

1

*

7

35.1

GLB

MpGLB1

314/316

1:1

52:31

5.31

1

*

5

62.5

GOX

MpAP20Ox2

266/281

1:1

41:44

0.11

1

7

56.5

GP

MpGP3

293/295

1:1

35:49

2.33

1

6

12.5

MEX-1

MpMEX6

220/224

1:1

46:37

0.98

1

1

63.9

MEX-2

MpMEX3

407/408/411

1:1:1:1

25:18:15:27

4.55

3

7

66.7

O3D

MpO3Des5

373/375

1:1

36:48

1.71

1

7

42.5

PL

MpPL1

359/361

1:1

43:42

0.01

1

14

39.9

SIP

MpSolINP2

820/830*

1:1

55:30

7.35

1

**

4

24.5

Nonsignificant

*P ≤ 0.05; **P ≤ 0.01

Marker polymorphism, segregation, and mapping in Fragaria and Prunus

Primer pairs for ten (38%) of the genes developed from Malus mRNA sequences revealed intron length polymorphisms or SNP sites between F. vesca 815 and F. nubicola 601. Between those markers mapped via SNP polymorphisms, there was an average of one SNP every 119 nucleotides in the amplicons sequenced; however, these SNPs were detected only between the parents of the Fragaria FV × FN mapping population and thus were not validated in a wider germplasm screen. The scoring of these polymorphisms in the six bin set seedlings allowed all ten genes to be located to bins on the Fragaria reference map. One of the ten primer pairs used, MdACAULIS4, which amplified a gene encoding a spermine synthase (ACL5), produced heterozygous products that were difficult to interpret unambiguously in all cases. When this gene was mapped via a length polymorphism in the 815 × 903 BC Fragaria mapping population, its location matched that expected through the interpretation of the FV × FN bin set SNP sequencing scores (data not shown); thus, it was placed in that bin on the FV × FN reference map. The primer pairs used, the genes which they amplified, the bin set seedling segregation scores, amplicon sizes and number of SNPs detected (where applicable), and the location of each mapping bin of the ten genes mapped in Fragaria are given in Table 3 and those mapping to bins on FG7 are shown on Fig. 2.
https://static-content.springer.com/image/art%3A10.1007%2Fs11295-008-0178-5/MediaObjects/11295_2008_178_Fig2_HTML.gif
Fig. 2

Comparison between linkage groups of the Fragaria (FG7) and Prunus (PG2) reference linkage maps. The bins to which markers were mapped in this investigation are indicated by a solid vertical bar at the corresponding locations on each of the linkage groups and bin names are given after marker names in parentheses

Table 3

The ten loci bin mapped in Fragaria along with the primer pairs used, the bin set seedling segregation scores, the size of the amplicons generated and number of SNPs identified (where applicable), and the location of each mapping bin on the Fragaria reference map (FV × FN)

Locus

Primers

Bin set seedling genotypes

Mapping bin

Amplicon size (bp)

Polymorphism

No. of SNPs detected

32

46

48

59

62

83

BCS

MpBCSyn1

B

H

B

A

H

H

VII:21

437/438

Indel

n/a

AMY

MpAAmy4

H

A

H

B

A

H

II:56

488

SNP

2

PL

MpPL1

A

B

B

H

A

H

V:37

431

SNP

4

SIP

MpSolINP4

H

A

A

H

A

H

VI:43

476

SNP

3

MEX

MpMEX3

B

A

H

H

H

H

VII:90

535

SNP

3

PAO

MpPAO2

B

H

B

H

H

H

VII:40

466

SNP

2

CPK

MpCPK5

A

H

H

H

H

B

III:13

208

SNP

3

FPS

MpFPPS10

A

H

H

H

H

B

III:13

257

SNP

3

GP

MpGP1

A

B

B

A

A

B

V:21

317

SNP

8

ACL5

MpACAULIS4

H

H

H

B

H

H

II:50

265

SNP

1

In the case of Prunus, primer pairs for ten (38%) of the genes developed from Malus cDNA sequences revealed intron length polymorphisms or polymorphic SNP sites between “Texas” and “Earlygold.” Between those markers that were mapped via SNP polymorphisms, there was an average of one SNP every 108 nucleotides in the amplicons sequenced. The scoring of these polymorphisms in the six bin set seedlings allowed all ten genes to be located to bins on the Prunus reference map; again, however, these SNPs were not validated in a wider germplasm survey. The primer pairs used, the genes which they amplified, the bin set seedling segregation scores, amplicon sizes and number of SNPs detected (where applicable), and the location of each mapping bin of the ten genes mapped in Prunus are given in Table 4 and those mapping to bins on PG2 are shown on Fig. 2.
Table 4

The ten loci bin mapped in Prunus together with the primer pairs used, bin set seedling segregation scores, the size of the amplicons generated and number of SNPs identified (where applicable), and the location of each mapping bin on the Prunus reference map (T × E)

Locus

Primers

Bin set seedling genotypes

Mapping bin

Amplicon size (bp)

Polymorphism

No. of SNPs detected

05

12

23

30

34

83

BCS

MpBCSyn2

H

H

A

A

A

H

2:25

448/457

Indel

n/a

O3D

MpO3Des2

B

H

H

H

H

B

2:45

156/192

Indel

n/a

PL

MpPL1

A

H

H

H

A

A

5:41

264/266

Indel

n/a

TFL

MpTFL1

H

H

H

B

H

B

7:31

296/298

Indel

n/a

SIP

MpSolINP2

B

H

A

B

B

B

6:74

469

SNP

1

GP

MpGP2

A

H

H

H

H

A

5:21

348

SNP

3

PAO

MpPAO2

A

B

H

A

A

H

2:08

785

SNP

13

MEX

MpMEX5

B

H

H

H

H

H

2:50

137

SNP

1

FPS

MpFPPS3

H

H

H

H

H

H

4:18

158

SNP

1

DHR

MpDHAR2

B

H

A

A

H

B

2:34

255

SNP

1

In total, 15 genes were mapped in at least one of the three mapping populations; four loci were mapped in all three mapping populations; seven were mapped in two genera and four were mapped in just one genus. Thus, 73% of the loci mapped in at least two genera, providing novel comparative mapping information between Fragaria, Malus, and Prunus. The other four loci, mapped in just one of the three genera were GLB, which mapped at 62.5 cM on MG5 in Malus, GOX which mapped at 56.5 cM on MG7 in Malus, TFL which was located in bin 7:31 of PG7 in Prunus and AMY which was located in bin II:56 of FG2 in Fragaria.

Marker locations on the Arabidopsis genome

The genome positions of the Arabidopsis homologs closest to the 15 genes mapped here in rosaceous genera were successfully identified using the TAIR SeqViewer (Fig. 3). Two genes located to the proximal arm of Arabidopsis chromosome 1 (AC1), one to the proximal arm of AC2, two to the proximal arm of AC3, two to the proximal arm, one to the distal arm of AC4, and two to the proximal arm and five to the distal arm of AC5. The gene name, function, physical position on the Arabidopsis genome, E values, and bit scores for the 15 Arabidopsis genes with close homology to the rosaceous genes mapped in this investigation are given in Table 5.
https://static-content.springer.com/image/art%3A10.1007%2Fs11295-008-0178-5/MediaObjects/11295_2008_178_Fig3_HTML.gif
Fig. 3

The genome positions of the Arabidopsis homologs closest to the 15 genes mapped in rosaceous genera in this investigation. Locus names of the genes mapped in rosaceous genera are given to the right of the chromosome bars, the Arabidopsis gene names are given to the left

Table 5

The 15 Arabidopsis genes with close homology to the rosaceous genes mapped in Fragaria, Malus, and Prunus together with gene function, physical position on the Arabidopsis genome, E values, and bit scores

Malus gene

Arabidopsis gene name

Gene function

Location (bp)a

Orientationb

E value

Bit score

ACL5

AT5G19530

Spermine synthase

6588960–6591213

Reverse

4e−30

133

AMY

AT1G76130

Alpha amylase

28566175–28568970

Forward

1e−86

321

BCS

AT3G61440

Involved in beta-cyanoalanine biosynthesis

22746722–22748953

Forward

1e−46

188

CPK

AT4G04720

Calcium-dependent protein kinase

2394456–2397757

Reverse

2e−48

194

DHAR

AT1G75270

Dehydroascorbate reductase

28253736–28255011

Reverse

2e−25

117

FPS

AT5G47770

Farnesyl diphosphate synthase

19362399–19364855

Forward

1e−83

311

GLB

AT2G16060

Class 1 nonsymbiotic hemoglobin

6989703–6990713

Reverse

4e−28

125

GOX

AT5G51810

Gibberellin 20-oxidase

21072414–21074034

Reverse

4e−10

68

GP

AT4G11600

Glutathione peroxidase

7009763–7011369

Reverse

4e−48

192

MEX

AT5G17520

Maltose transporter

5772585–5775347

Reverse

1e−33

145

O3D

AT5G05580

Omega-3 fatty acid desaturase

1664135–1666528

Forward

3e−74

280

PAO

AT5G13700

Polyamine oxidase activity

4420072–4423036

Reverse

3e−26

121

PL

AT4G24780

Pectate lyase

12770341–12772343

Reverse

8e−54

212

SIP

AT3G53620

Inorganic pyrophosphatase

19891482–19894650

Forward

3e−61

236

TFL

AT5G03840

Controls inflorescence meristem identity

1024640–1025811

Reverse

5e−15

84

aDenotes the physical position of the gene in base pairs (bp) on the Arabidopsis genome

bDenotes the orientation of the gene on the Arabidopsis genome

Discussion

The primer pairs developed in this investigation have proved to be highly transferable between genera. In a previous study, Sargent et al. (2007) showed transferability of 50% of the primer pairs designed arbitrarily from mRNA sequence—not taking into account conserved exon regions—from Fragaria to both Malus and Prunus. The transferability of markers from Malus to Fragaria and Prunus reported here was higher than that reported by Sargent et al. (2007; 61% and 69% for Fragaria and Prunus, respectively). Despite the level of SNP polymorphism in the Prunus mapping population being higher than that of the Fragaria population (one SNP on average every 108 and 118 nucleotides, respectively), the level of polymorphism observed in T × E was lower than that observed in other comparisons of coding sequence data from the parents of this population (Illa et al. 2007). However, this may have been due to the conserved nature in general of the genes studied here, which would have contributed to the high degree of transferability of these markers between genera and also to the low levels of polymorphism observed. Thus, we mapped 15 (73%) of the genes investigated in at least two genera from different rosaceous subfamilies and compared synteny between these genera. Additionally, we were able to compare the map positions of the loci mapped in Rosaceae with their physical positions on the Arabidopsis genome.

Comparative mapping within Rosaceae

The primer pairs developed in this investigation have permitted the mapping of homologous loci in Malus and their homologs in Fragaria and Prunus. Many of the markers mapped in Malus were linked—i.e., DHR, O3D, GOX, and MEX-2—on MG7. This has enabled syntenic comparisons to be made, which are discussed below.

Two MEX loci were mapped in the F × T linkage map (Fig. 1). In Malus, MEX-1 mapped to the distal section of MG1 and was closely linked (at 1.5 cM) to the Vf locus conferring resistance to apple scab. MEX-2 mapped to the distal section of MG7, 16.1 cM from marker EMPc111. Maliepaard et al. (1998) reported a linkage map for the Malus progeny “Prima” × “Fiesta” (P × F) on which MG1 and MG7 both contained the RFLP marker MC014 and the isoenzyme locus PGM. The findings of Liebhard et al. (2002) supported the association of MG1 and MG7 through the mapping of two SSR loci amplified with marker CH02a04 to those linkage groups on their map of the cross “Fiesta” × “Discovery” (F × D). The mapping of two MEX loci to MG1 and MG7 in this investigation further strengthens the hypothesis that MG1 and MG7 are homologous Malus linkage groups.

A single MEX locus was amplified in both Fragaria and Prunus. The MEX locus located to mapping bins VII:90 and 2:50 on FG7 and PG2 of the Fragaria and Prunus reference maps, respectively, along with a further two markers which located to these two linkage groups, BCS (mapping to VII:21 and 2:25 on FG7 and PG2, respectively) and PAO (mapping to VII:40 and 2:08 of FG7 and PG2, respectively). The addition of these three markers to FG7 and PG2 supports data for eight loci mapped to both FG7 and PG2 from one of our laboratories (Vilanova et al. unpublished data) that suggests these linkage groups are homologs. The positions of these markers indicates that at least one inversion event (between BCS and PAO) has occurred since these two genera diverged from a common ancestor (Fig. 2).

An additional two markers, DHR and O3D, which were monomorphic in the FV × FN Fragaria mapping population, located to bins on PG2 of the T × E Prunus map. These markers, along with MEX-2, located to the distal end of MG7 in the F × T Malus map in the order DHR (35.1 cM)–O3D (42.5 cM)–MEX-2 (66.7 cM; Fig. 1). In Prunus, these three markers were located to bins in the order DHR (2:34)–O3D (2:45)–MEX (2:50) on PG2 demonstrating complete macrosynteny of this 31.6-cM region of the Malus linkage group MG7 with Prunus PG2 and, along with the mapping data presented here for MEX-1 and the data of Maliepaard et al. (1998), this study provides evidence that both MG1 and MG7 are homologs of Fragaria FG7 and Prunus PG2.

Markers GP and PL mapped to linkage groups FG5 and PG5, GP (to bins V:21 and 5:21 on FG5 and PG5, respectively) and PL (to bins V:43 and 5:47 on FG5 and PG5, respectively), and identifies these groups as putative homologs. The GP and PL loci were also mapped in Malus and located to MG6 and MG14, respectively. Maliepaard et al. (1998) mapped a number of multilocus RFLP markers, MC023, MC040, and 7B9 to both MG6 and MG14. The mapping of GP and PL to these linkage groups in this investigation provides evidence that these two linkage group homologs in Malus are the homologs of FG5 and PG5 in Fragaria and Prunus.

The SIP locus mapped to MG4 in Malus and located to bins on FG6 (VI:43) and PG6 (6:74) in a region containing the EST markers EPPCU1830 (tat-binding protein homolog 1; TBP-1) and the enzyme locus phosphoglyceromutase 1 (Pgl-1; PG6), which has been mapped as both an RFLP (Pgl-1) and an STS marker (PGLM) in the FV × FN Fragaria mapping population. The addition of SIP supports the relationship between a short genome region on both FG6 and PG6. The region to which SIP mapped in Prunus is also the location of the S-locus in that genus, conferring self-incompatibility in species such as almond (P. dulcis; Ballester et al. 1998). However, the S-locus in Malus is located on MG17 (Maliepaard et al. 1998), closely linked to the isoenzyme locus AAT-1 (Got-1).

MG4 in Malus has been shown to have markers in common with MG12 by both Maliepaard et al. (1998; RFLP MC019) and Liebhard et al. (2002; SSR markers CH01b12 and CH01d03) and MG17 has been shown to be associated with MG9 by MC038 and MC115 (Maliepaard et al. 1998) and the SSRs Ch01h02, CH05d08, and NZ04f03 (Liebhard et al. 2002, Fernández-Fernández et al. 2008). Both MG9 and MG17 have been anchored to PG3 of the Prunus reference map by Dirlewanger et al. (2004) through the comparative mapping of markers MC038, MC007, and AAT, supporting the suggestion that the S-loci of Prunus and Malus are not homologous (Ma and Oliveira 2002). Here, we have reported a marker (SIP) closely linked to the S-locus in Prunus. This locus mapped to MG4 and is thus not linked to the S-locus in Malus. In addition, there have been no reports of an association between MG4 and MG17 and thus our data support the hypothesis that the RNase systems operating in Malus and Prunus are evolutionarily distinct.

Two loci mapped in Malus did not segregate in the Prunus progeny but were mapped in Fragaria. The locus CPK (MG5 0.0 cM) located to bin III:13 of FG3, while ACL5 (MG8 0.0 cM) located to bin II:50 of FG2. There have been no previous reports in the literature of syntenic relationships between Fragaria and Malus. The FPS locus, while not segregating for intron length polymorphism in Malus, was polymorphic in both Fragaria and Prunus and located to FG3 (III:13) and PG4 (4:18), indicating that these linkage groups are homologous. While the mapping of these markers provides evidence for tentative relationships between MG5 and FG3, between MG8 and FG2, and between FG3 and PG4, more markers must be mapped before these tentative relationships can be confirmed.

The four loci, AMY, GLB, GOX, and TFL, that were mapped in just one of the three populations investigated were not useful for comparative mapping within Rosaceae on this occasion. However, they have served as useful anchor markers for the comparison with the Arabidopsis genome sequence and may prove useful as markers for linkage analysis and comparative mapping in other rosaceous mapping populations.

Comparison of rosaceous maps and the Arabidopsis genome sequence

Dominguez et al. (2003) and Jung et al. (2006) searched the Arabidopsis genome for regions of synteny with Prunus genetic maps. A total of 139 conserved regions were identified, 20 of them containing more than three gene pairs. The largest region (denoted gp128 by Jung et al. 2006) contained four gene pairs and covered 20 cM of PG2 and 342 kb of AC5. In the investigation presented here, genes were mapped to a ∼40-cM region of PG2, which was conserved in both MG7 and FG7 and corresponded to a 4.1-Mbp region of AC5. This region of AC5 is where gp128 was identified and also where a 25-cM region of PG2 containing 13 homologous markers corresponding to a 5.4-Mbp region of AC5 was identified by Dominguez et al. (2003). However, despite the mapping of three genes from the MG7–PG2 syntenic block to this region, other genes from PG7 and FG2 were located flanking it. Additionally, other genes found closely linked on the rosaceous genetic maps were dispersed throughout the Arabidopsis chromosomes, supporting the findings of other studies (Dominguez et al. 2003; Georgi et al. 2003; Jung et al. 2006) that conserved syntenic blocks between the genomes of rosaceous genera and Arabidopsis are small and found in diverse locations on the Arabidopsis genome.

Concluding remarks

We have described an efficient method for the isolation of large numbers of PCR-based transferable markers for comparative mapping in the Rosaceae, demonstrated through a screen of approximately 0.25% of the Malus gene sequences deposited in the EMBL database. We have demonstrated that with even a modest number of loci, our approach has provided strong evidence for syntenic relationships between putatively homologous regions of the Fragaria, Malus, and Prunus genomes. The genetic loci mapped have revealed relationships between linkage groups in distantly related rosaceous genera and provided insights into genome evolution within this economically important family. Additionally, families such as Leguminosae are close to Rosaceae (Angiosperm Phylogeny Group 2003), and the primers developed in this investigation may prove useful for comparative mapping in the Rosales.

The results presented here and those of other studies such as Dirlewanger et al. (2004) have shown that mapping information gained in one genus will inform studies in other rosaceous genera. The EMBL database currently contains 261,025 Malus EST sequences, along with tens of thousands of sequences from Fragaria, Prunus, Pyrus, Rubus, and other economically important rosaceous genera (http://www.ebi.ac.uk/embl accessed November 2007). With the Malus and Prunus genomes about to be sequenced, there is the real opportunity for the development of vast numbers of gene-specific STS markers using the approach we have described, which will facilitate comparative mapping studies across the Rosaceae.

Acknowledgements

Rosaceous genomics at East Malling Research is funded by Defra through grant HH3724SSF (Comparative genomics of rosaceous fruit crops and HNS for sustainable production).

Copyright information

© Springer-Verlag 2008