Virus Genes

, Volume 37, Issue 3, pp 407–413

Phylogenetic characterization of H5N1 highly pathogenic avian influenza viruses isolated in Switzerland in 2006

Authors

    • Institute of Virology and Immunoprophylaxis
  • Sandra Renzullo
    • Institute of Virology and Immunoprophylaxis
  • Anette Baumer
    • Institute of Virology and Immunoprophylaxis
Article

DOI: 10.1007/s11262-008-0285-2

Cite this article as:
Hofmann, M.A., Renzullo, S. & Baumer, A. Virus Genes (2008) 37: 407. doi:10.1007/s11262-008-0285-2

Abstract

In the winter 2005/2006 H5N1 highly pathogenic avian influenza virus (HPAIV) reached Western Europe and caused numerous deaths primarily in migratory water birds. Between February and April 2006 34 cases of H5N1 HPAIV-infected dead water fowl were identified in Switzerland, almost exclusively occurring in the Lake Constance area, a large overwintering area for migratory birds in the eastern part of the country. In total, 13 of these virus isolates were genetically characterized in the present study by full-length nucleotide sequence analysis of the hemagglutinin and neuraminidase-coding region. All viruses could be confirmed as HPAIV based on the amino acid sequence of their hemagglutinin cleavage site. Phylogenetic analysis revealed that all the virus isolates were highly similar to each other and to other H5N1 strains found in neighboring countries. All analyzed Swiss virus isolates belonged to the influenza virus subclade 2.2.1.

Keywords

Avian influenza virusHighly pathogenicH5N1HPAIVWaterfowlWild birdsHemagglutininNeuraminidaseEpidemiologySwitzerlandPhylogenetic characterization

Introduction

Influenza viruses of the H5N1 subtype have first been identified in 1959 [1]. Although this virus was highly pathogenic for chicken, there are no reports about transmission or clinical disease in other host species. However, in 1997, and again since 2003 H5N1 highly pathogenic avian influenza virus (HPAIV) first found in live bird markets in Asia have been able to infect humans and other mammal species, causing fatal disease [2]. Furthermore, in contrast to all other previously known H5N1 HPAIV in domestic poultry these viruses show a highly pathogenic phenotype also in waterfowl and other migrating birds [3].

In 2005 H5N1 that had so far been confined to East Asian countries started to spread west- and southbound toward Europe and Africa. Early in 2006 it reached Western Europe where it first caused numerous deaths in wild birds primarily in Northern Germany [4]. Interestingly this introduction happened during a time period without any major migratory bird movements. However, it is believed that very cold weather conditions forced aquatic birds normally overwintering in the Baltic Sea, mainly swans, to move westward into the German coastal areas [5]. In the following months the virus spread across Germany, reaching most Western European countries. On February 22nd the first case of H5N1 HPAIV in wild birds was diagnosed in Switzerland [6]. The so far last case of H5N1 HPAIV in Switzerland was detected on March 31st, 2006. All in all, 34 cases in wild aquatic birds were identified, of which 33 were found in the northeastern part of the country (lake Constance area), whereas the 34th case was identified in a goosander on Lake Geneva. In total, 32 of these samples were initially diagnosed positive by the Swiss National Reference Laboratory for Poultry and Rabbit Diseases (NRLPRD) (Prof. R. Hoop), Zurich, [7], whereas two additional H5N1-positive samples were detected during this study (A. Baumer, unpublished). No cases were recorded in domestic poultry.

It has been shown that H5N1 strains belonging to three different clades have been independently introduced in 2006 and 2007 into Germany [5], two of which were also identified in 2006 in Bavaria [8]. Very recently, viruses belonging to the same two clades found in Bavaria were also reported in France [9], again supporting the hypothesis that several introductions of H5N1 viruses of different origin occurred throughout Western Europe. It was therefore of interest to investigate the genetic relationship of the Swiss H5N1 HPAIV among each other and to compare their genotype to other strains from neighboring geographic areas. In the present publication, we present data about the molecular epidemiological characterization of 13 of these isolates by nucleotide sequence analysis of the complete HA and NA genes.

Materials and methods

Virus isolates

Clinical samples in the form of retropharyngeal, tracheal, or cloacal swabs were provided by NRLPRD (Table 1). These samples originated from wild water birds found dead in the northeastern part of Switzerland, and were previously shown by real-time RT-PCR (rRT-PCR) to contain influenza A virus-specific RNA of the H5 subtype by NRLPRD [7; A. Baumer, unpublished].
Table 1

Overview of HPAIV isolates analyzed in the present study

Sample number

Bird species

Date of initial diagnosis

Geographic origin (canton)

Ct values rRT-PCR from swabs;(R), retropharyngeal; (T), trachea; (C), cloaca

HA1/HA2 aa sequencea (basic aa in bold)

GenBankaccession #HA ORFsequence

GenBankaccession #NA ORFsequence

Influenza A

H5

N1

V68

Mute swan

22.02.06

Schaffhausen (SH)

nd

nd

nd

PQGERRRKKR↓GLF

EU016350

EU152215

V82

Goosander

25.02.06

Genf (GE)

nd

nd

nd

PQGERRRKKR↓GLF

EF110518

na

V330

Little grebe

06.03.06

Schaffhausen (SH)

21.8 (R)

27.3 (T)

24.8 (R)

30.3 (T)

32.3 (R)

33.7 (T)

PQGERRRKKR↓GLF

EU016351

EU152216

V389

Duck

09.03.06

Schaffhausen (SH)

24.5 (R)

25.7 (T)

28.1 (R)

29.3 (T)

31.8 (R)

33.0 (T)

PQGERRRKKR↓GLF

EU016352

EU152217

V426

Tufted duck

10.03.06

Diessenhofen (TG)

30.6 (R)

34.5 (R)

33.3 (R)

PQGERRRKKR↓GLF

EU016353

EU152218

V487

Duck

13.03.06

Feuerthalen (ZH)

23.1 (R)

28.6 (T)

25.9 (R)

32.1 (T)

28.8 (R)

34.7 (T)

PQGERRRKKR↓GLF

EU016354

EU152219

V504

Tufted duck

11.03.06

Dörflingen (SH)

26.8 (R)

20.3 (T)

22.3 (R)

22.6 (T)

28.8 (R)

34.7 (T)

PQGERRRKKR↓GLF

EF547197

EU152220

V505

Common pochard

11.03.06

Schaffhausen (SH)

23.3 (R)

28.8 (T)

27.0 (R)

32.8 (T)

33.7 (R)

28.9 (T)

PQGERRRKKR↓GLF

EU016355

EU152221

V537

Mallard

15.03.06

Schaffhausen (SH)

22.4 (R)

30.6 (T)

26.0 (R)

33.9 (T)

29.5 (R)

38.5 (T)

PQGERRRKKR↓GLF

EU016356

EU152222

V544

Common coot

13.03.06

Flurlingen (ZH)

36.1 (R)

17.2 (T)

neg (R)

20.7 (T)

neg (R)

23.6 (T)

PQGERRRKKR↓GLF

EF110519

EU152223

V558

Common pochard

11.03.06

Romanshorn (TG)

26.1 (R)

33.9 (T)

28.5 (R)

36.7 (T)

31.1 (R)

41.6 (T)

PQGERRRKKR↓GLF

EU016357

EU152224

V592

Common pochard

16.03.06

Neuhausen (SH)

17.5 (R)

33.3 (T)

21.0 (R)

37.0 (T)

23.7 (R)

40.7 (T)

PQGERRRKKR↓GLF

EU016358

EU152225

V762

Common pochard

21.03.06

Romanshorn (TG)

26.1 (R)

33.9 (C)

28.1 (R)

35.9 (C)

30.4 (R)

37.7 (C)

PQGERRRKKR↓GLF

EU016359

EU152226

R797/06b

Mute swan

na

Bavaria, Germany

20.4 (T)

25.6 (T)

23.6 (T)

PQGERRRKKR↓GLF

EF547198

nd

aAll sequences contain multiple basic aa (bold) upstream cleavage site, indicating hp phenotype

bViral RNA provided by B. Hoffmann, FLI Riems, Germany; used as positive control for rRT-PCR

↓: Cleavage site

na: not applicable or data not available; nd: not done

The only available remaining material from case V82 from a dead goosander found on Lake Geneva was cDNA primed with an HA-specific reverse transcription primer, and was kindly provided by Y. Thomas, National Influenza Centre of Switzerland, Geneva. Hence only the HA ORF sequence could be determined from this H5N1 isolate. Viral RNA from the first case in Switzerland (V68) was also provided by Y. Thomas.

Viral RNA extracted from a tracheal swab from a dead mute swan found in Bavaria designated R767/06 was kindly provided by B. Hoffmann, FLI Riems, Germany, and served as positive control for full-length HA and NA RT-PCR as well as a reference strain for comparing the HA ORF sequences of the Swiss HPAIV isolates.

RNA extraction

Viral RNA was either extracted manually from 250 μl swab medium with Trizol (Invitrogen), or on a Freedom EVO robot (Tecan, Männedorf, Switzerland) from 100 μl swab medium using the NucleoSpin Multi-96 Virus Kit (Macherey-Nagel, Oensingen, Switzerland). The purified RNA was either dissolved in 20 μl H2O (manual extraction), or was eluted in 50 μl H2O (robotic extraction).

rRT-PCR

The amount of influenza A virus-specific RNA in the samples obtained from NRLPRD was determined by rRT-PCR based on a published protocol [10] using M gene-specific primers, but slightly modified primers were used in order to allow the detection of a broader range of influenza A viruses [6].

The H5 HA subtype was confirmed by an H5-specific rRT-PCR [11], whereas the N1 NA subtype was confirmed using newly designed N1-specific primers (B. Hoffmann, FLI Riems, Germany; personal communication).

HA and NA cDNA synthesis and direct sequencing

For full-length HA and NA cDNA synthesis RNA was reverse transcribed by using primer SZA + [12] and SuperScript III reverse transcriptase (Invitrogen) for 60 min at 50°C. Amplification of the complete HA and NA ORF was achieved by using primers SZAHA + and SZAHA-, or SZANA + and SZANA-, respectively [12], and Platinum Taq DNA Polymerase High Fidelity (Invitrogen) in a touch-down PCR profile optimized to yield maximal sensitivity (94°C (2 min) → 15 × [94°C (30 s)/60…46°C (1 min)/72°C (7 min)] → 5 × [94°C (30 s)/45…49°C (1 min) - >72°C (7 min)] → 15 × [94°C (30 s)/50°C (30 s)/72°C (7 min)]. Samples that yielded only minute amounts of full-length HA and NA cDNA upon RT-PCR, respectively, were reamplified by band picking from the agarose gel and using the same procedure as for RT-PCR, except that the reverse transcription step was omitted.

Specific PCR products were either purified by MicroSpin S400 (Amersham) spin column-mediated buffer exchange, or were cut out from the gel and eluted with the NucleoSpin Extract II kit (Macherey-Nagel).

All amplification products were directly sequenced by cycle sequencing (Thermo Sequenase DYEnamic Direct Cycle Sequencing Kit, GE Healthcare) on a Licor 4200L automated DNA sequencer (LI-COR Biosciences, Lincoln, NE, USA), using sets of terminally and internally located IRD800-labeled sequencing primers (Table 2).
Table 2

Primers used for cDNA amplification and sequencing of HA and NA gene (fragments)

Purpose

Primer name

Sequence or reference

Positionb

HA ORF amplification

SZA+c

[12]

5’UTR

SZAHA+d

[12]

5’UTR

SZAHA-d

[12]

3’UTR

HA ORF sequencing

SZAHA + _Li

[12]

5’UTR

SZAHA-_Li

[12]

3’UTR

H5_HA93 -Li(F)a

GGTTGACACAATAATGGAAAAGAA

93-116

H5_HA378-Li(F)

TGAGAAAATTCAGATCATCCCCA

378-400

H5_HA897-Li(F)

GGCGATAAAYTCYAGYAGGGCA

897-918

H5_HA1279-Li(F)

AACAAGAAGATGGAAGACGGAT

1279-1300

H5_HA602-Li (R)a

GCCGCATCATTAGGATGGT

602-584

H5_HA1171-Li (R)

TCTATTGCYTTTTGAGTGGATTC

1171-1149

H5_HA1641-Li (R)

TGATTGCCAGTGCTAGGG A

1641-1623

NA ORF amplification

SZA+c

[12]

5’UTR

SZANA+d

[12]

5’UTR

SZANA-d

[12]

3’UTR

NA ORF sequencing

SZANA + _Li

[12]

5’UTR

SZANA-_Li

[12]

3’UTR

H5_NA27-Li(F)

CATCGGATCAATCTGTATGGTA

27-48

H5_NA459-Li(F)

GTTTGAGTCTGTTGCTTGGTC

459-479

H5_NA1041-Li(F)

CAGGAGCGGCTTTGAAATGAT

1041-1061

H5_NA479-Li (R)

GACCAAGCAACAGACTCAAAC

479-459

H5N1_NA1010-Li (R)

ACACCATTGCCGTATTTAAATGAAA

1010-986

H5N1_NA1339-Li (R)

TGGTGAATGGCAACTCAGCA

1339-1320

a(F), forward primer; (R), reverse primer

bH5N1 HA or NA ORF, respectively

cFor reverse transcription

dFor PCR

Sequences are shown in their 5′- >3′ orientation

Sequence analysis and molecular epidemiological characterization

Nucleotide sequences were analyzed by e-Seq and AlignIR software (LI-COR Biosciences, Lincoln, NE, USA). Sequences were aligned and phylogenetic analysis was done by using GeneWorks version 2.5.1 software package (Oxford Molecular Group, Oxford, UK), MEGA version 4.0 freeware [13] and online (http://www.ncbi.nlm.nih.gov/genomes/FLU/FLU.html) on Influenza Virus Resource [14].

Results

rRT-PCR and amplification of the complete HA and NA ORF

Swab samples from 11 of the 34 H5N1 HPAIV were re-examined by rRT-PCR during the present study. The presence of influenza A-, H5-, and N1-specific RNA could be confirmed in all cases (Table 1). Samples that yielded H5 and N1 rRT-PCR Ct values up to 34.5 and 33.3, respectively, still contained enough full-length HA and NA RNA to allow full-length cDNA amplification by RT-PCR.

Direct sequencing of PCR cDNA and nucleotide sequence analysis

The HA and NA nucleotide sequence from most of the samples included in the present study could be unambiguously determined by using a set of nine and eight dye-labeled sequencing primers, respectively (Table 2). The 14 HA and 12 NA full-length ORF sequences obtained from Swiss and additionally from a German H5N1 HPAIV sequences were deposited in GenBank (Table 1).

The amino acid (aa) sequence surrounding the HA0 cleavage site was determined in order to determine the pathotype of the virus isolates. All 14 viruses yielded the identical aa sequence PQGERRRKKR*GLF, which characterizes these viruses as HPAIV, based on the presence of six consecutive basic aa upstream the cleavage site. This cleavage sequence has been found in all European H5N1 HPAIV strains from 2005 and 2006 and for the Qinghai viruses that affected wild birds in 2005 [3].

Alignment of the 13 HA ORF sequences yielded a high degree of sequence conservation (98.8% identity). When the aa sequences were compared, an identity score of 99.1% (563/568 aa) was found, and 4 out of the 5 aa substitutions were conserved changes, resulting in a similarity score of 99.8%. Interestingly, the highest number of aa substitutions (n = 3) was identified in the isolate V82, the only H5N1 HPAIV virus found in the western part of Switzerland, i.e., outside the area where all other cases originated from. On the nucleotide level, a sequence identity level of 99.1 (1691/1707 nt) was found.

An even higher degree of nucleotide sequence conservation (99.6%) was found when the 12 NA ORF sequences were aligned. Eight of these sequences were completely identical, whereas in the remaining four cases each sequence contained one individual point mutation (i.e., located at different positions within the NA ORF) compared to the eight identical sequences. All point mutations were silent; hence the NA aa sequence was identical in all analyzed samples.

Comparison of the HA and NA sequences determined in the present study and with corresponding sequences from other recent H5N1 isolates found in Germany [5, 15] and in particular from the geographically close region of Bavaria that is adjacent to the area where most of the H5N1 isolates described in this study were found [8] by phylogenetic analysis clearly revealed that all the Swiss isolates were closely related to the H5N1 subclade containing the majority of Bavarian isolates. This was evident in both the HA as well as the NA UPGMA tree (Fig. 1). However, based on the lower overall sequence conservation of HA compared with NA the HA tree showed a finer resolution even within the group of analyzed Swiss H5N1 strains.
https://static-content.springer.com/image/art%3A10.1007%2Fs11262-008-0285-2/MediaObjects/11262_2008_285_Fig1_HTML.gif
Fig. 1

Phylogenetic analysis of the Swiss H5N1 HPAIV isolates (bold), shown as UPGMA trees based on the nucleotide sequence representing the full-length HA and NA ORF, respectively. Relevant bootstrapping values are indicated. 2.2.1 through 2.2.3 refer to influenza virus subclades [17]. *, V82, the only isolate from Lake Geneva

Discussion

Since it has recently been shown that diverse strains of H5N1 HPAIV have been introduced independently into Europe [5, 8, 9] during the 2006 epidemic, it was interesting to determine the genetic background of virus isolates collected within the same time period in Switzerland. A total of 32 HPAIV cases were reported by the NRLPRD, based on M- and H5-specific rRT-PCR results. In all cases the virus was detected in swabs from wild aquatic birds found dead. Eleven of these cases, from which there was still clinical sample material available, could be confirmed by rRT-PCR as H5N1 positive in our laboratory.

In a first instance, HA sequencing allowed the pathotyping of all of the studied H5N1 HPAIV. However, in no case the genetically determined pathotype could be confirmed by intravenous pathogenicity index analysis because none of the viruses could be isolated in embryonated chicken eggs. This clearly demonstrates the usefulness of genetic pathotyping of H5 AIV.

All the HA and even more the NA sequences showed a very high degree of sequence conservation. Phylogenetic analysis based on UPGMA tree construction of the HA ORF sequences (Fig. 1) revealed that all isolates, including the one from Lake Geneva, belong to the subclade 2.2.1 (also referred to as Europe-Middle East-Africa subclade 1 [16]) within the Qinghai-like H5N1 lineage, now referred to as clade 2.2 [17]. This subclade also contains the majority of H5N1 strains characterized in Bavaria [8] as well as in France [9]. Neighbor-joining and maximum parsimony approaches (not shown) resulted in the same tree topology as obtained by UPGMA analysis. When the NA sequences were used to construct a dendrogram, again basically the same grouping was found. All Swiss isolates belonged to the same subclade, which like for HA contained most of the Bavarian H5N1 isolates. The fact that the some of the Swiss isolates were indistinguishable among themselves and were also identical to many of the Bavarian isolates as well further supports a direct epidemiological link.

The isolate V82 originating from Lake Geneva (bordering France) showed a slightly higher genetic distance from the Lake Constanze isolates (bordering Bavaria) than those isolates among themselves. Based on the available HA sequences from H5N1 HPAIV from France and Germany it was not possible to distinguish whether the V82 isolate was imported from France, or whether the goosander was infected in the Lake Constance area and flew to Lake Geneva afterwards. However, due to the fact that (i) no H5N1 HPAIV was isolated during the 2006 epidemic anywhere in Switzerland between the two lakes, (ii) several outbreaks of H5N1 HPAIV in wild aquatic birds had occurred in France close to the Swiss border only a few days earlier, and (iii) it was the only H5N1 HPAIV case in the western part of Switzerland, it is likely that this bird contracted its infection in France.

On the other hand, the finding that all H5N1 HPAIV isolated in the eastern part of Switzerland in the Lake Constance area were very similar (HA) or eight of them even indistinguishable (NA) and belonged to the same 2.2.1 HA subclade suggests that all Swiss viruses had a common ancestor. This is in contrast to the epidemic in France and in Germany, where viruses belonging to the two separate subclades 2.2.1 and 2.2.2 [5, 9] were found simultaneously during the epidemic early in 2006.

No correlation between the isolation date and the occurrence of single point mutations within the HA ORF was found. This suggests that the observed sequence divergence among the Lake Constance H5N1 isolates does not represent an ongoing evolution of the virus but is rather caused by quasispecies wobbling of the viral genome. This is further supported by the finding that cloned HA ORF sequences from individual virus isolates exhibited a significant degree of point mutations of which most were silent (data not shown).

It was reported that H5N1 HPAIV belonging to clade 2.2 are highly pathogenic for wild aquatic birds [3]. This contrasts with the observation that H5N1 HPAIV was isolated from only 86 out of 2,414 wild birds found dead in the Lake Constance area [18]. Therefore it cannot be concluded that all the H5N1-positive dead wild birds died from the HPAIV infection. This is further supported by the recent observation that H5N1 HPAIV is present in healthy aquatic birds in Switzerland (http://www.oie.int/wahid-prod/public.php?page=event_summary&reportid=6917).

Acknowledgments

The authors would like to thank R. Hoop, Swiss National Reference Laboratory for Poultry and Rabbit Diseases, for providing the H5N1-positive samples for further analysis, and also Bernd Hoffmann and Martin Beer from the Friedrich Loeffler Institute, Island of Riems, Germany, for providing H5N1 HPAIV RNA as reference material. A. Baumer was supported by grant no. 1.07.01 from the Swiss Federal Veterinary Office (BVET).

Copyright information

© Springer Science+Business Media, LLC 2008