Veterinary Research Communications

, Volume 34, Issue 5, pp 413–421

Characterization of a new protective antigen of Streptococcus canis

Authors

    • Department of Animal ScienceTianjin Agricultural University
  • Yanfei Liu
    • Department of Animal ScienceTianjin Agricultural University
  • Jun Xu
    • Department of Animal ScienceTianjin Agricultural University
  • Benqiang Li
    • Department of Animal ScienceTianjin Agricultural University
Original Article

DOI: 10.1007/s11259-010-9414-1

Cite this article as:
Yang, J., Liu, Y., Xu, J. et al. Vet Res Commun (2010) 34: 413. doi:10.1007/s11259-010-9414-1

Abstract

Streptococcus canis (S. canis), a lancefield group G streptococcus, is an opportunistic pathogen mainly found in dogs and cats. The study on pathogenesis and protective immune mechanism of S. canis is not clear. A new streptococcal protective antigen (SPA) was first identified from a genomic library of S. canis. SPA of S. canis (SPASc) contained a 1224-bp open reading frame which encoded a 407aa protein and a 34-aa signal sequence with a deduced molecular mass of 46.368 kDa. Protein analysis and BLAST result showed that SPASc was homologous to the SPA of Streptococcus. equi subsp. zooepidemicus, M protein Streptococcus. equi., and SPA of Streptococcus pyogenes. The protective response of SPASc antiserum was demonstrated by passive mouse protection. These studies suggested that SPASc might be an important component of vaccines to prevent S. canis infections.

Keywords

Streptococcal protective antigenS. canisCharacterizationPassive protection

Introduction

S. canis, a member of Lancefield group G streptococcus, is an opportunistic pathogen found in dogs and other animals including cats, cattle, rats, mink, mice, rabbits and foxes (Devriese et al. 1986). In dogs, S. canis is isolated from a variety of diseases including skin infections, infections of the reproductive tract, mastitis, pneumonia, septicemia and streptococcal toxic shock syndrome (Miller et al. 1996). Very few human infections with S. canis have been reported. Group G streptococci are isolated occasionally from human infections including streptococcal toxic shock syndrome and streptococcal pharyngitis (Galpérine et al. 2007; Lam et al. 2007).

Previous studies have shown that virulence factors of group A streptococci have been thoroughly clarified, and these factors include M protein, the hyaluronic acid capsule, Plasminogen-binding proteins, Streptococcal proteinase, the C5a peptidase and others. The surface M protein of group A streptococci plays a dual role in the pathogenesis of infection. M protein is a major determinant of virulence and confers group A streptococci the ability to resist phagocytosis and killing by neutrophils. In addition, antibody against M protein can protect the host against subsequent infection by the same serotype (Lancefield 1962). Hyaluronic acid capsule has a polymer of hyaluronic acid containing repeating units of glucuronic acid and its N-acetylglucosamine is required for the resistance to phagocytosis (Wessels and Bronze 1994). Plasminogen-binding proteins are the surface receptors which enhance bacterial invasion or movement through normal tissue barriers (Lottenberg et al. 1994). Streptococcal pyrogenic exotoxins are well known for their pyrogenicity, enhancement of endotoxic shock, and superantigenic effects on the immune system (Broeseker et al. 1988). Streptococcal proteinase is an extracellular cysteine protease produced by all group A streptococci (Musser et al. 1996). The C5a peptidase is a proteolytic enzyme (endopeptidase) found on the surface of group A streptococci. It is a 130-kDa serine peptidase that is anchored to the streptococcal cell wall and it inactivates C5a and chemotaxis and then inhibits the recruitment of phagocytic cells to the site of infection (Ji et al. 1996).

The virulence factors of Group A streptococci have been thoroughly documented, but less is known on those of Group G streptococci (DeWinter et al. 1999). In this paper, streptococcal protective antigen of Streptococcus canis (SPASc) was characterized by screening a genomic library of S. canis, BLAST analysis, and passive protection test. Studies demonstrated that SPASc is homologous to the SPA of Streptococcus. equi subsp. zooepidemicus, M protein of Streptococcus equi., and SPA of Streptococcus pyogenes. The passive mouse protection test showed the protective response of antiserum to SPASc.

Material and methods

Bacterial strains and media

S. canis, provided by Harbin Veterinary Research Institute of Chinese Academy of Agricultural Sciences, was cultured in Todd Hewitt Broth (THB) (Difco, Detroit, USA) + 0.2% yeast extract at 37°C overnight. Escherichia coli XL-l MRF’ and SOLR (Stratagene, California, USA) were hosts for phage manipulation and plasmid excision. DH5α and BL21 (DE3) were used for cloning and expression of recombinant proteins and were cultured according to the manufacturer’s protocol (Takara, Dalian, China).

Convalescent sera

Six healthy dogs were infected with a low dose (5 × 103 CFU) of S. canis by three subcutaneous injections at ten days’ interval. At 50 days after the primary inoculation, surviving dogs were bled and the convalescent sera were collected from each animal and pooled for use of library screening.

Library construction

The genome of S. canis was extracted and randomly digested by Tsp5091. The recovered 3∼8 kb genome fragments were ligated with predigested A lambda ZAPII vector. After packaging and amplification, the library was titered and characterized according to the manufacturer’s protocol (Stratagene, California, USA).

Library screening and plasmid rescue

Library screening and plasmid rescuing were conducted as previously reported (Verma et al. 2005). The lambda ZAPII libraries containing 3 to 8 kb fragments of genomic DNA of S. canis were screened by immunoblot with pooled dog sera (1:200) which were pre-absorbed with E. coli XL-l MRF’, followed by HRP conjugated goat anti-dog IgG(H+L) (KPL, Gaithersberg, USA) with 4-chloro-l-naphthol as substrate. Positive plaques were selected, replated, and rescreened. Plasmids of positive plaques were rescued according to provided protocols (Stratagene, California, USA). For those positive plaques whose plasmids were not rescued, phage DNA was extracted by using Qia lambda mini kit. Primers T3 and T7 were used to amply the insert sequence from the phage DNA.

Gel electrophoresis and immunoblotting

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed using an X-Cell SureLock Mini-Cell for 2 h at 125 V, with Tris-glycine running buffer (25 mM Tris, 192 mM glycine, 0.1% SDS [pH 8.3]. Plaque samples to estimate protein size were mixed with l/5 volume of 5× gel loading buffer (100 mM Tris-Cl [pH 6.8], 10% SDS, 50% glycerol, 500 mM dithiothreitol, and 0.1% bromophenol blue) and boiled for 5 min before loading. The gels were rinsed twice in distilled water and stained with Protoblue Safe Stain (Sangon, Shanghai, China). Protein bands in gel were transferred to nitrocellulose (0.2 mM pore size) and blocked with 4% dry milk in Tris-buffered saline (20 mM Tris, 150 mM NaCl, 0.05% Tween 20 [pH 7.5]). The membranes were incubated with antiserum, followed by Protein G conjugated to horseradish peroxidase. Bound conjugate was detected by using 4-chloro-l-naphthol.

DNA sequencing and analysis

Amplified fragments and plasmids excised from selected recombinant phages by using the ExAssist helper phage and E. coli SOLR were isolated with the QIAprep spin miniprep kit and sequenced. Sequencing was performed in a commercial DNA sequencing facility (Sangon, Shanghai, China), and editing was performed using Chromas 1.61. Nucleotide sequences were aligned and connected by using DNASIS. Analyses of nucleotide sequence and deduced amino acid sequences were performed with DNASIS and the DNAstar. Homologies were identified by a BLAST search with the National Center for Biotechnology Information server (http://www.ncbi.nlm.nih.gov/BLAST/). Prediction of signal sequence was analyzed by SignalP 3.0 Server (http://www.cbs.dtu.dk/services/SignalP/)

Protein expression

Primers Scf (TCGCTCGAGGAAAGTAATAGGGCTGATAG) and Scr (TTAGGATCCTGATTCACCTGTTGATGGTAATTG), including an XhoI restriction enzyme site and a BamHI restriction site respectively, were designed by using DNASIS. The sequence encoding SPASc was amplified by PCR from a rescued clone, which was denatured at 92°C for 2 min followed by 30 cycles of 92°C at 1 min, 59°C at 45 sec, and 72°C for 1 min and 25 sec. The product and pET-15b vector were digested with XhoI and BamHI and then ligated together. The resulting construct was transformed into E. coli BL21. Expression of SPASc protein was induced with 1 mM IPTG when the culture reached an optical density of 0.6 at 600 nm, and cells were harvested after 3 h. Recombinant His6-SPASc was isolated by using TALON metal affinity resin (Clontech, Madison, USA) under denaturizing conditions. Fractions containing His6-SPASc were combined and dialyzed against 20 mM Tris-50 mM NaCl buffer (pH 7.5). Recombinant SPASc was stored at −70°C prior to use.

Determination of LD50

The LD50 was determined by the method provided by Dale et al. (1999). Four groups of 6 mice each were intraperitoneally challenged with 10-fold increasing inoculations, ranging from 3.1 × 104 to 3.1 × 107 CFU of S. canis. Deaths were recorded for 7 days after challenge infections.

Polyclonal antisera

Two healthy rabbits were injected subcutaneously with 100 µg of recombinant protein and 1 µg of N-acetylmuramyl-L-alanyl-D-isoglutamine (Sigma, St. Louis, USA) adsorbed to aluminum hydroxide (Accurate Chemical & Scientific Corp., Westbury, USA). Booster injections with 50 µg protein were performed on days 14 and 28. Serum was collected 35 days after the primary immunization and tested for reactivity with SPASc. The titer of the antisera was evaluated by ELISA. Briefly, 96-well plates were coated with recombinant SPASc, followed by the antisersa and peroxidase labeled Protein G, and color was developed with O-phenylenediamine (OPD) as substrate.

Passive mouse protection tests

Eight-week-old female Balb/c mice were given 0.5 ml of rabbit antiserum via the introperitoneal route. After 24 hours, the mice were challenged intraperitoneally with the indicated number of streptococci that had been grown to early log-phase in THB. Deaths were recorded twice daily for 7 days.

Opsonization of SPASc-specific antiserum

Phagocytosis of S. canis by neutrophils was performed using a modification of a previously described procedure (Timoney et al., 2008). S. canis were grown to early exponential phase and opsonized with SPASc-specific rabbit antiserum (1:50) for 1 h at 37°C. Several aliquots of neutrophils (2 × 106) and opsonized S. canis (1 × 107 CFU) were prepared with a final volume of 1 ml for each aliquot, and control bacterial suspensions were opsonized S. canis (1 × 107 CFU) with naïve rabbit serum (1:50). Mixtures were rotated for 1 h at 37°C and phagocytosis was terminated by placing the suspensions on ice. Aliquots of each suspension taken at 0 and 60 min were plated on CNA blood agar and colonies were counted after overnight incubation. Bacterial survival was expressed as the percentage of viable S. canis remaining at 60 min.

Result

Isolation and characterization of SPASc gene

Convalescent sera were prepared from five surviving out of six dogs inoculated with the bacteria. Three clones strongly reacted with the pool of convalescent sera and were isolated. Two of them expressed a protein of about 42 kDa. A fragment with about 1.2 kb neucleotides was amplified from the phage DNA. Sequence analysis showed that each of these colonies contained the same 1224-bp open reading frame encoding a 407aa protein and a 34-aa signal sequence. The molecular weight of the mature protein was calculated as 41,879 kDa (GeneBank Accession No. ACM47242).

Amplification of SPASc gene and construction of recombinant plasmid

The SPASc gene was successfully amplified. The gene and pET15b were ligated after digestion by restriction enzymes and the recombinant plasmids were verified with the same digestion sites.

Phylogentic analysis

SPASc was compared by DNAstar with homologous proteins obtained from the Genebank, which included SPA of S. equi subsp. zooepidemicus MGCS10565 (Accession YP_002124118) (SpaZ), M protein of S. equi (MSe) (Accession AAB71984), SPA of S. pyogenes (SPASp) (Accession ACD81471), and M protein of Streptococcus. sp (MSsp) (Accession CAA42694). Those amino acid sequences were aligned with DNAstar by ClustalW method to analyze phylogenetic relationship. Figure 1 shows that SPASc and SpaZ share a common ancestry with 50.6% homology. SPASc was much more similar to MSe and SPASp (33.7% and 33.2%, respectively) than MSsp (24.3%).
https://static-content.springer.com/image/art%3A10.1007%2Fs11259-010-9414-1/MediaObjects/11259_2010_9414_Fig1_HTML.gif
Fig. 1

Phylogenetic analysis of SPASc with homologous proteins. The amino acid of SPASc and related proteins were aligned by DNAstar. The phylogenetic tree was constructed by the ClustalW method based on the alignment. Abbreviation and GeneBank accession number for each sequence are: SpaZ, SPA of S. equi subsp. zooepidemicus MGCS10565 (YP_002124118); MSe, M protein of S.equi (AAB71984); SPASp, SPA of Streptococcus. pyogenes (ACD81471), and MSsp, M protein of Streptococcus. sp (CAA42694)

Expression and purification of recombinant SPASc

Recombinant SPASc was purified by nickel exchange chromatography (Fig. 2b). Reactivity of the recombinant protein with the convalescent serum pool is shown on Fig. 2d.
https://static-content.springer.com/image/art%3A10.1007%2Fs11259-010-9414-1/MediaObjects/11259_2010_9414_Fig2_HTML.gif
Fig. 2

SDS-PAGE of a purified recombinant SPASc (lane b) stained by Protoblue Safe Stain and immunoblot of purified SPASc reacted with convalescent dog sera (lane d) showed with protein markers (lane a and c)

Passive mouse protection tests with SPASc specifc rabbit antiserum

ELISA showed that the OD value of SPASc specific rabbit antiserum (1:100) was up to 2.6, compared with OD 0.1 of naïve rabbit serum, indicating that rabbits produced significantly high titer to SPASc after 3 immunizations. Passive mouse protection examination was performed to examine the protective role of SPASc. Results demonstrated that 9 out 10 mice in the control group, which was inoculated with the naïve rabbit serum before challenged with 3.1 × 107 CFU, died from the challenge (Table 1). However, only 2 of 10 mice pretreated with SPASc specific rabbit antiserum died from the challenge, showing higher rates of survival and these were statistically different from the control group (p ≤ 0.05). The mice that received the same amount of SPASc specifc rabbit antiserum and challenged with 6.2 × 107 CFU were less protected (6/10 in Test B). Taken together, these results demonstrated the protective role of SPASc.
Table 1

Passive mouse protection test with antiserum to SPASc

Group

Inoculated serum

Challenged CFU

Survival

control

Naïve serum

3.1 × 107 CFU

1/10

Test A

Rabbit antiserum to SPASc

3.1 × 107 CFU

8/10

Test B

Rabbit antiserum to SPASc

6.2 × 107 CFU

6/10

Mice of different groups were given 0.5 ml of rabbit antiserum indicated above via the intraperitoneal route. After 24 hours, all the mice were challenged using the same route with the indicated number of streptococci that had been grown to early log-phase in THB. In the control group, all died except for one. Test A and B pretreated with SPASc specific rabbit antiserum had higher rates of survival, and these were statistically different from the control group (p ≤ 0.05).

Opsonization of SPASc-specific antiserum

Neutrophils in canine plasma were incubated with S. canis which is opsonized with either SPASc specific rabbit antiserum or rabbit naïve serum. Bacterial survival of neutrophils for each treatment is expressed as a percentage of numbers (CFU) of S. canis following incubation for 60 min in the naïve rabbit serum. The data from Fig. 3 showed SPASc-specific antiserum was opsonic.
https://static-content.springer.com/image/art%3A10.1007%2Fs11259-010-9414-1/MediaObjects/11259_2010_9414_Fig3_HTML.gif
Fig. 3

Opsonization of SPASc-specific antiserum. Neutrophils in canine plasma were incubated with S. canis opsonized with SPASc specific rabbit antiserum and with rabbit naïve serum. Bacterial survival of neutrophils for each treatment is expressed as a percentage of numbers (CFU) of S. canis following incubation for 60 min in the naïve rabbit serum. Vertical bars are standard errors of the mean calculated from the three time results of experiments

Discussion

S. canis is a species originally proposed in 1986 (Devriese et al.) for streptococci isolated from dogs and cows processing the Lancefield Group G antigen. Since then, the species has been isolated from a variety of animals including cats, rats, mink, mice, rabbits, and foxes. In dogs, S. canis is involved in a variety of diseases including skin infections, infections of the reproductive tract, mastitis, pneumonia, septicemia and streptococcal toxic shock syndrome (Hassan et al. 2005; Miller et al. 1996). The infections in humans by S. canis have been well documented and increasing infection in human may be due to underestimation of the true number of the infections (Whatmore et al. 2001). The increasing infection in human and cross-infection among animals made it necessary for a better understanding of the protective immunity against S. canis (Tikofsky and Zadoks 2005; Galpérine et al. 2007)

Recent studies have been focused on the group A streptococci for their pathogenesis and protective immunity (Cunningham 2000). In this study, we identified a new protein (SPASc) from a genomic library of S canis. The mature SPASc was predicted to be a 41.879 KDa with 34-aa signal sequence from the whole 1224 bp open reading frame. SPASc is homologous to the SpaZ, MSe, and SPAsp by protein analysis, NCBI BLAST, and phylogenetic analysis. MSe has an anti-phagocytic action similar to that of the group A M proteins in that C3b deposition on the bacterial surface is inhibited and fibrinogen is actively bound. MSe is a distant relative of the group A M protein family, but it is more closely related to group C and G streptococci (Timoney et al. 1997). These reports support our findings that SPASc is homologous to MSe. It was reported that mutations of genes occur in Bordetella evolution to adapt to different hosts (Parkhill et al. 2003), suggesting that genes loss or mutations might occur in some genes of Streptococci which derived from different hosts.

In our studies, recombinant expression plasmid SPASc-pET15b was constructed. The predicted protein was expressed, purified, and detected by Western blot. The protective function of the protein was shown by passive mouse protection tests. Also its antiserum to SPASc was opsonic. The discovery of a new protective antigen of S canis has implications for the development of vaccines that would prevent the infections. Other functions of SPASc remain to be clarified further in future studies. The availability of amino acid sequence of SPASc now makes it possible to study on its new role in virulence and pathogenesis and on the epitopes and domains of the protein relevant to opsonic and protective responses. The availability of DNA sequence will be of great value in characterizing the precursor of SPASc gene in S. canis and perhaps provide more information on the gene transfer or mutation which makes them adapt to different hosts.

Acknowledgments

The financial supports of Tianjin Natural Science Foundation (07JCYBJC16000) and the Project-sponsored by SRF for ROCS, SEM were gratefully acknowledged. We thank Dr. Wenzhi Xue of Intervet (Merrian, Kansas) and Dr. Minghao Sun of the Scripps Research Institute for proof reading the manuscript.

Supplementary material

11259_2010_9414_MOESM1_ESM.doc (69 kb)
Fig. 1DNA sequnence and deduced amino acid of SPASc. The sequence contains complete open reading frame with 1,224 nucleotides and deduced 407 amino acids. Underlined sequence means signal sequence. The sequence has been submitted to GeneBank and has the accession no. ACM47242 (DOC 69 kb)

Copyright information

© Springer Science+Business Media B.V. 2010