Plant Cell, Tissue and Organ Culture (PCTOC)

, Volume 109, Issue 2, pp 383–390

Agrobacterium-mediated genetic transformation and regeneration of transgenic plants using leaf segments as explants in Valencia sweet orange

Authors

  • Ehsan Ullah Khan
    • Key Laboratory of Horticultural Plant Biology (MOE), National Key Laboratory of Crop Genetic Improvement, College of Horticulture and Forestry SciencesHuazhong Agricultural University
  • Xing-Zheng Fu
    • Key Laboratory of Horticultural Plant Biology (MOE), National Key Laboratory of Crop Genetic Improvement, College of Horticulture and Forestry SciencesHuazhong Agricultural University
    • Key Laboratory of Horticultural Plant Biology (MOE), National Key Laboratory of Crop Genetic Improvement, College of Horticulture and Forestry SciencesHuazhong Agricultural University
Research Note

DOI: 10.1007/s11240-011-0092-7

Cite this article as:
Khan, E.U., Fu, X. & Liu, J. Plant Cell Tiss Organ Cult (2012) 109: 383. doi:10.1007/s11240-011-0092-7
  • 567 Views

Abstract

In this study, attempts were made to develop a protocol for regeneration of transgenic plants via Agrobacterium tumefaciens-mediated transformation of leaf segments from ‘Valencia’ sweet orange (Citrus sinensis L. Osbeck) using gfp (green fluorescence protein) as a vital marker. Sensitivity of the leaf segments regeneration to kanamycin was evaluated, which showed that 50 mg l−1 was the best among the tested concentrations. In addition, factors affecting the frequency of transient gfp expression were optimized, including leaf age, Agrobacterium concentration, infection time, and co-cultivation period. Adventitious shoots regenerated on medium containing Murashige and Tucker basal medium plus 0.1 mg l−1 α-naphthaleneacetic acid (NAA), 0.5 mg l−1 6-benzyladenine (BA) and 0.5 mg l−1 kinetin (KT). The leaf segments from 3-month-old in vitro seedlings, Agrobacterium concentration at OD600 of 0.6, 10-min immersion, and co-cultivation for 3 days yielded the highest frequency of transient gfp expression, shoots regeneration response and transformation efficiency. By applying these optimized parameters we recovered independent transformed plants at the transformation efficiency of 23.33% on selection medium (MT salts augmented with 0.5 mg l−1 BA, 0.5 mg l−1 KT, 0.1 mg l−1 NAA, 50 mg l−1 kanamycin and 250 mg l−1 cefotaxime). Expression of gfp in the leaf segments and regenerated shoots was confirmed using fluorescence microscope. Polymerase chain reaction (PCR) analysis using gfp and nptII gene-specific primers further confirmed the integration of the transgene in the independent transgenic plants. The transformation methodology described here may pave the way for generating transgenic plants using leaf segments as explants.

Keywords

Citrus sinensis L. OsbeckGreen fluorescence proteinLeaf segmentsGenetic transformation

Abbreviations

BA

6-benzyladenine

CaMV

Cauliflower mosaic virus

CTAB

Cetyltrimethylammonium bromide

gfp

Green fluorescence protein

Km

Kanamycin

AS

Acetosyringone

Cef

Cefatoxime

NAA

α-Naphthaleneacetic acid

nptII

Neomycin phosphotransferase II gene

KT

Kinetin

MT

Murashige and Tucker basal medium

IAA

Indole-3-acetic acid

IBA

Indole-3-butyric acid

PCR

Polymerase chain reaction

Introduction

Citrus is one of the most important fruit crops globally due to its highly economical and nutritional value, with an annual production exceeding 108 million tons in 2007. Provision of desirable cultivars is a key strategy to maintain a stable and sound citrus industry. Genetic improvement of Citrus spp. via conventional approaches like cross hybridization and selection based on natural mutation faces a range of obstacles including large tree size, long juvenile period, nucellar polyembryony, high degree of heterozygosity and pollen or ovule sterility (Terol et al. 2008). Accumulating evidence has shown that genetic transformation offers promising solutions to many of the challenges and impediments to citrus breeding and can expedite the cultivar improvement (Poupin and Arce-Johnson 2005; Dutt et al. 2011). It holds the potential to create novel germplasm with specific traits, such as biotic and abiotic stress tolerance without affecting their desirable genetic background (Fagoaga et al. 2007; Zanek et al. 2008; de Campos et al. 2011).

Agrobacterium-mediated transformation has been the most commonly used method to transform various citrus species. A range of explants have been tried in Agrobacterium-mediated transformation of citrus species, such as epicotyls, stem segments, hypocotyls, protoplasts and embryogenic calluses (Almeida et al. 2003; Kayim et al. 2004; Khawale et al. 2006; Omar et al. 2007; Chen et al. 2008; Dutt and Grosser 2009; de Oliveira et al. 2009; Ballester et al. 2010; Duan et al. 2010, 2011; Fu et al. 2011a, b). However, these explants have their own drawbacks. For example, embryogenic calluses loose their regeneration capacity if they are subcultured for longer period. Epicotyls and hypocotyls are primarily obtained from seedy cultivars, which are otherwise impossible from seedless ones like Satsuma mandarin and navel oranges. Abundant availability of leaf discs or segments from a single citrus seedling as starting material for Agrobacterium-mediated transformation compared to epicotyls makes it an attractive choice for many researchers. Leaves are rapidly produced from germinating seedlings and can be obtained at large number and allow multiple successive rounds of selection and regeneration. Genetic transformation of leaf explants enables one to introduce the genes of agronomic significance and create novel plants without losing the clonal fidelity (Sandal et al. 2007). Leaf segments have been reported to be more susceptible to Agrobacterium infection in the transformation experiments (Li et al. 1999). For these reasons, leaf tissue is an explant of choice for Agrobacterium-mediated transformation of various plants including tomato (McCormick et al. 1986), strawberry (Husaini et al. 2008), apricot (Petri et al. 2008), sour cherry (Song and Sink 2005), pomegranate (Terakami et al. 2007), tobacco (Huang et al. 2010), chilli pepper (Subramanyam et al. 2010) and Lotus tenuis (Espasandin et al. 2010). However, so far no successful report is available concerning production of transgenic plants through Agrobacterium-mediated transformation of leaf segments in Citrus, although Almeida et al. (2003) had tried using leaf tissues as explants in transformation of Hamlin sweet orange. Very recently, Figueiredo et al. (2011) reported Agrobacterium-mediated leaf transformation in citrus, but their goal was to study transient gene expression rather than to produce transgenic plants.

We have successfully regenerated sweet orange plants by utilizing in vitro leaf segments as explants (Khan et al. 2009). Therefore, in the present study, efforts were made to establish an Agrobacterium tumefaciens-mediated transformation protocol from leaf segments of ‘Valencia’ sweet orange (C. sinensis L. Osbeck), with the intention of developing an efficient and alternative transformation system for citrus cultivar improvement.

Materials and methods

Plant material and bacterial culture

The plant material used in this study was obtained from Valencia sweet orange (Citrus sinensis L. Osbeck) plants growing in the citrus orchard of Huazhong Agricultural University, Wuhan, PR China. Freshly harvested seeds of ‘Valencia’ were washed with distilled water and then soaked in 1 M sodium hydroxide (NaOH) solution for 20 min, followed by washing with sterilized double distilled water (ddH2O) for three times. Subsequently, the seeds were surface-sterilized in 2.5% (w/v) sodium hypochlorite (NaOCl) solution for 15–20 min and rinsed thoroughly with sterilized ddH2O. After removal of seed coats, seeds were inoculated on germination medium composed of Murashige and Tucker (MT) basal medium (Murashige and Tucker 1969), 3% (w/v) sucrose and 0.8% (w/v) agar. Unless otherwise stated, pH of the medium used in this study was adjusted to 5.8. The cultures were maintained at 26 ± 1°C in the dark for 2 weeks and then transferred to 16/8 h (light/dark) cycle using cool white fluorescent light (45 μmol s−1 m−2) until used for transformation.

A disarmed Agrobacterium tumefaciens strain EHA105, harboring a binary vector plasmid pBin-mgfp5-ER (Haseloff et al. 1997), was used for transformation. The T-DNA of the vector contained a neomycin phosphotransferase II gene (nptII) as a selectable marker and a green fluorescence protein gene (gfp) as a vital marker, under the control of cauliflower mosaic virus 35S promoter (Duan et al. 2007).

Preparation of explants and Agrobacterium tumefaciens for transformation

Fully expanded leaves excised from 1 to 4-month-old in vitro seedlings of ‘Valencia’ were used as source of explants for transformation. Each leaf was cut into 2–3 leaf segments of 1.0 cm2 in size and all the leaf segments were slightly wounded transversely three or four times across the midrib without fully separating the segments, and incubated in flasks containing sterilized ddH2O until infected in the bacterial suspension.

Agrobacteriumtumefaciens stock was grown on semi-solid LB (Luria–Bertani) medium containing 5 g l−1 tryptone, 10 g l−1 sodium chloride (NaCl), 5 g l−1 malt extract (ME) and 50 mg l−1 kanamycin (Km) at 28°C. A single clone was selected and multiplied in liquid MT medium containing 50 mg l−1 Km (Amresco, USA) and 25 mg l−1 acetosyringone (AS), which was shaken (200 rpm) in an orbital shaker for 2 h at 28°C. The bacterial cells were precipitated and re-suspended in the same medium and the final bacterial concentration (OD600) was adjusted at the range of 0.2–1.0 using a UV-spectrophotometer (Shimadzu Model UV-1206, Japan).

Sensitivity test of the leaf segments to Kanamycin (Km)

For the efficient selection of putative transgenic plants during the transformation process, Km sensitivity was first tested. Based on our previous report (Khan et al. 2009), shoot regeneration medium (SRM) consisted of MT salts, 0.1 mg l−1 α-Naphthaleneacetic acid (NAA) (Sigma, USA), 0.5 mg l−1 6-benzyladenine (BA) (Bio Basic Inc., Canada), 0.5 mg l−1 kinetin (KT), 3% sucrose, and 0.8% agar. Leaves excised from in vitro seedlings of ‘Valencia’ sweet orange were cut into small pieces and cultured on SRM supplemented with Km at concentrations of 0, 50, 100, 200, and 250 mg l−1, while the leaf segments cultured on Km-free regeneration medium were regarded as control. Km was filter-sterilized and added to the autoclaved medium prior to solidification. The cultures were maintained at 26 ± 1°C in the dark and subcultured at 15-d intervals. After 2 months of culture, an optimum level of Km concentration was determined based on percentage of surviving explants.

Evaluation of factors influencing transient gfp expression

Several factors affecting the GFP transient expression were investigated, including Agrobacterium concentration (OD600 at 0.2, 0.4, 0.6, 0.8, and 1.0), infection time of Agrobacterium solution (5, 10, 15, and 20 min), age of leaves used for the explant preparation (1, 2, 3 and 4 months old) and co-cultivation time (1, 2, 3, 4 and 5 days). All of these parameters were evaluated and optimized based on the transient gfp expression and recovery of Km resistant shoots. The frequencies of transient gfp expression was calculated as: the number of leaf segments with gfp positive spots/total number of leaf segments evaluated ×100, and regeneration of Km resistant shoots was calculated as: number of Km resistant shoots/total number of explants cultured × 100 respectively. The factor standardized by one experiment was applied to the next.

Transformation, selection and regeneration of transgenic plants

To produce transgenic plants, the leaf segments were immersed in the bacterial suspension (OD600 = 0.6) for 10 min with manual agitation every 2–3 min. The explants were washed with sterile ddH2O, blotted dry on sterile filter paper to remove attached excess bacteria and were cultured in Petri plates (60 mm diameter) with adaxial side onto sterile filter paper overlying on semi-solid co-cultivation medium (CM) containing shoot regeneration medium (SRM) and AS (25 mg l−1). The plates were sealed with parafilm and placed in an incubator (GHP-Series, China) under dark conditions at 25°C for 3 days. After 3 days of co-culture, the leaf segments were washed 3-4 times with sterile ddH2O containing 250 mg l−1 Cefatoxime (Cef) (Bio Basic Inc., Canada) to stop the overgrowth of Agrobacterium tumefaciens. After blotting dry, the leaf segments were transferred onto selection medium (SM) containing SRM, augmented with 50 mg l−1 Km and 250 mg l−1 Cef. For control, explants were cultured onto SM without inoculation into bacterial suspension with or without antibiotics in all experiments. The cultures were incubated at 26 ± 1°C for 4 weeks in the dark and subsequently transferred to 16/8 h (light/dark) cycle. The selection medium was refreshed every 3–4 weeks to maintain selection pressure and prevent Agrobacterium re-contamination. Transformation efficiency was calculated as the total number of gfp+ shoots/total number of explants cultured ×100.

Shoot elongation and in vitro rooting

The Km-resistant shoots that were regenerated from leaf segments via direct organogenesis were excised aseptically and transferred to shoot elongation medium (SEM) consisting of MT salts, 0.2 mg l−1 BA, 0.2 mg l−1 indole-3-acetic acid (IAA), 0.2 mg l−1 gibberellic acid (GA3), 30 g l−1 sucrose, 0.8% agar, 50 mg l−1 Km and 250 mg l−1 Cef for elongation. Well-developed elongated shoots (1–5 cm) were subjected to rooting on the rooting medium (RM) composed of half strength MT medium supplemented with 0.5 mg l−1 NAA, 0.1 mg l−1 indole-3-butyric acid (IBA), 0.5 g l−1 activated charcoal, 2.5% sucrose and 0.8% agar. Rooting in glass tubes (150 × 25 mm) was carried out in the dark at 26 ± 1°C for 1 week followed by a 16/8-h (light/dark) cycle under 45 μmol s−1 m−2 fluorescent lighting conditions. The number of rooted shoots was recorded 4 weeks after transfer into rooting medium. The well-rooted plantlets were removed from the medium, freed of agar by washing under running tap water and transplanted into plastic pots containing sand: compost mixture (1:2), covered with transparent plastic pots and placed in the growth chamber at 80% relative humidity. The acclimatized plants were subsequently grown in larger pots filled with soil mixture.

Detection of gfp fluorescence by stereomicroscopy

The gfp transient expression in the leaf segments and regenerated shoots was monitored periodically after 1 month of co-cultivation with Agrobacterium using a Leica fluorescence stereomicroscope (MZFLIII, Chroma Technology Corp., USA) comprising of 480/40 nm exciter filter, a 505 nm LP dichromatic beam splitter and a 510 nm LP barrier filter. Leaf segments with at least 10 green flurescence spots were scored as positive indicators of transient gfp expression. The CCD camera (Nikon D100) and the Nikon Capture 4 Camera Control software (version 4.1.0) were used to capture the images, taken as JPEG files.

DNA isolation and PCR analysis

Genomic DNA was extracted from leaves of the gfp-positive and untransformed plants as described by Liu et al. (2002) with minor modifications. The PCR reaction mixtures (20 μL) contained 50 ng of genomic DNA, 1.5 mM MgCl2, 0.2 mM dNTPs, 1.0 U Taq DNA polymerase, and 0.1 mM of each gene specific primer. The primers used for PCR amplification of nptII gene were 5′-TGCGCTGCGAATCGGGAGCG-3 (reverse) and 5′- GAGGCTATTCGGCTATGACT-3′ (sense), and for gfp gene were 5′-TGGCCAACACTTGTCACTAC-3′ (forward) and 5′- AGGACCATGTGGTCTCTCTT -3′ (reverse). Size of the PCR products wasexpected to be of 710 bp for nptII gene, and 500 bp for gfp gene. PCR analysis was carried out in a thermocyler (PTC-200, MJ Research, USA). Reactions were subjected to 35 cycles of 30 s at 94°C, 30 s at 60°C and 42 s at 72°C for nptII, and 1 min at 94°C, 1 min at 55°C and 1.5 min at 74°C for gfp. The PCR products were electrophoresed on 1.0% (w/v) agarose gel, which was stained with ethidium bromide and visualized under a UV transillumination.

Statistical analysis

For optimization of the transformation factors, each treatment was composed of three replicates (Petri dishes) with 10 leaf segments in each dish. The experiment was repeated at least three times using completely randomized block design setup. The data were subjected to Analysis of Variance (ANOVA), and the significance of difference among means was tested using Duncan’s (1955) Multiple Range Test.

Results and discussion

Effect of Km on survival of the leaf segments

During transformation, use of selection agent is important to reduce escapes and to save labor for confirmation of transgenic individuals. As transformation of leaf segments has never been successful in citrus, therefore we first tested Km sensitivity of the explants. The explants cultured on Km-free media (control) showed 100% survival. It was observed that with an increase in Km concentration, there was a drastic decline in the frequency of the explants survived (Fig. 1). Furthermore, the ability of the leaf segments to produce shoots was severely affected onto regeneration medium consisting of Km at concentration of over 50 mg l−1. In the present study, no putative transformants were yielded after application of 200 mg l−1 Km to the explants, suggesting excessive selective pressure. From this study, the optimum dose of Km was determined as 50 mg l−1, where 63.0% of leaf segments survived after 1 month of culture. Therefore, Km at concentration of 50 mg l−1 was used for selection of transformants in the subsequent experiments. Our results are in line with those of Duan et al. (2007) who found that Km at 50 mg l−1 resulted in the highest transformation efficiency in ‘Bingtangcheng’ sweet orange. It is worth mentioning that Km at other concentrations, such as 100, 200 and 25 mg l−1, has been tested in citrus, where higher concentration reduced the number of regenerants drastically and the lower one allowed the growth of a large number of escapes (Cervera et al. 1998; Peña et al. 1995).
https://static-content.springer.com/image/art%3A10.1007%2Fs11240-011-0092-7/MediaObjects/11240_2011_92_Fig1_HTML.gif
Fig. 1

Effect of kanamycin at different concentrations on the survival of leaf segments of Valencia sweet orange. Explants were cultured on shoot regeneration medium containing kanamycin (0–250 mg l−1). The bar represents the standard error

Optimization of the factors affecting transient gfp expression and regeneration of shoots

As alluded to above, no successful report is available on transformation of leaf segments in Citrus; four key factors influencing Agrobacterium tumefaciens-mediated transformation were evaluated, including leaf age, Agrobacterium concentration, infection time, and co-cultivation duration.

The age of the explant is one of the most critical factors in transformation experiments and therefore, appropriate biological condition of the explants is important for optimal infection and T-DNA transfer by Agrobacterium tumefaciens (Purkayastha et al. 2010). To evaluate the effect of leaf age on the frequency of transient gfp expression and regeneration, leaf segments derived from 1, 2, 3 and 4-month-old in vitro seedlings were immersed for 10 min in bacterial suspension (OD600 0.6). Analysis of variance revealed that the 3-month-old leaf segments gave rise to the highest frequencies of transient gfp expression and shoot regeneration compared to the older and younger leaf tissues (Table 1). Difference in transformation efficiency has been observed in explants excised from the initiating materials of different ages (Purkayastha et al. 2010; Mazumdar et al. 2010), which may be largely related to various levels of endogenous hormones.
Table 1

Effect of different factors on frequencies of transient gfp expression and regeneration of Km resistant shoots from seedling Valencia leaf segments

Factors

Treatments

Frequency of transient gfp expression (%)*

Frequency of Km resistant shoots** (%)

Bacterial concentration (OD600)

0.2

13.40d***

14.60c

 

0.4

44.53b

39.67a

 

0.6

53.67a

42.90a

 

0.8

30.27c

25.17b

 

1.0

26.40c

21.53b

Leaf age (months)

1

14.87b

8.60d

 

2

19.88b

21.83b

 

3

34.43a

49.20a

 

4

18.03b

17.13c

Co-culture period (days)

1

20.30cd

15.93c

 

2

25.20c

21.94b

 

3

44.67a

35.90a

 

4

34.40b

20.67b

 

5

15.53d

14.60c

Infection time (min)

5

15.40de

12.84cd

 

10

34.27a

31.70a

 

15

27.37b

24.10b

 

20

22.60bc

21.70b

 

25

18.40cd

13.93c

 

30

10.40e

9.87d

*Frequency of transient gfp expression was defined as the number of leaf segments showing gfp expression/total number of leaf segments evaluated ×100

**Frequency of Km-resistant shoots was calculated as number of Km resistant shoots/total number of explants cultured ×100

***Numbers with different letters within a column under the same parameter were significantly different by Duncan’s multiple range test (P < 0.05). Data are the mean value of three replicates from two experiments with 30 explants

To determine the right concentration of Agrobacteriumtumefaciens for high transformation efficiency, leaf segments from 3-month-old seedlings were inoculated in 10 mL suspension of Agrobacterium tumefaciens at five different concentrations (OD600 = 0.2, 0.4, 0.6, 0.8 and 1.0). A highly significant effect of bacterial concentration on transformation and regeneration from ‘Valencia’ leaf segments was observed in the current study (Table 1). With the increase in bacterial concentration, the frequency of transformed shoots and gfp transient expression and regeneration frequency increased up to OD600=0.6 and declined thereafter. It is conceivable that when the Agrobacterium concentration was too low (OD600 = 0.2 herein), few Agrobacterium cells entered inside the receptor cells, whilst when the OD600 was above 0.6 most shoots became necrotic due to the flourishing growth of Agrobacterium. Our work is in line with the findings of Zhang et al. (2010) and Kumar et al. (2004) working on Kentucky blue grass (Poa pratensis L) and tea, respectively, where OD600: 0.6 exhibited the most beneficial effects on transformation and regeneration frequencies.

The duration of the exposure interval to Agrobacterium cells is a critical step in the process of Agrobacterium-mediated transformation, since absorption of Agrobacterium, transference and integration of T-DNA are all completed during this period. To this end, 3-month-old leaf segments were infected in Agrobacterium suspension (OD600: 0.6) for various time periods (5–20 min). As can be seen in Table 1, the highest frequencies of transient gfp expression (34.27%) and shoot regeneration (31.7%) were obtained when the leaf segments were infected with the bacterial suspension for 10 min, but a longer infection time (15–30 min) decreased the transformation frequencies. Hence, infection for 10 min was found to be optimum in the current study and therefore used in the subsequent experiments. In earlier studies, inoculation for 10–30 min has been used for plant transformation (Costa et al. 2002; Yu et al. 2002; Almeida et al. 2003). It seems likely that bacterial exposure time may vary depending upon the plant species, explant type, physiological conditions of the explants.

Co-cultivation is a crucial factor influencing Agrobacterium-mediated gene transfer in plants. Therefore, the effect of co-culture period (1, 2, 3, 4 and 5 days) was investigated (Table 1). The frequency of transient gfp expression was increased from 1 to 3 days of co-culture, and then decreased when the explants were co-cultured for longer than 3 days. Our data are consistent with those of Cervera et al. (1998) and Liu and Pijut (2010). Influence of co-culture period on Agrobacterium-mediated transformation has been reported in many plant species (Cervera et al. 1998; Seong and Song 2008, Dutt and Grosser 2009; Dutt et al. 2010; Guo et al. 2010; Liu and Pijut 2010, Torreblanca et al. 2010). In general, a long-time co-culture may result in excessive bacterial overgrowth, leading to tissue necrosis, which was also observed in our study (data not shown).

Production of transgenic plants

With the optimized parameters, 3-month-old leaf discs were infected with Agrobacterium (OD600 0.6) for 10 min, followed by 3-d co-culture. Four weeks later, the explants were examined periodically under a fluorescence stereomicroscope to investigate the gfp expression (Table 2).
Table 2

Summary of production of transgenic plants from leaf segments in this study

Inoculated seedling Valencia leaf segments

Mean number of shoots/explant

Shoots expressing gfp gene

Transgenic plants developed

Transformation efficiency (%)

600

4.3

140

37

23.33*

*Transformation efficiency was calculated as the total number of gfp+ shoots/total number of explants cultured ×100

Transient gfp expression was efficiently observed in some of the infected leaf segments (Fig. 2a, b), whereas the non-transformed tissues appeared red due to the autofluorescence of the chlorophyll (data not shown). Km-resistant buds (Fig. 2c, d) on the selection medium were excised from the cutting ends and cultured on SEM. Well-developed shoots were obtained within 8 weeks of culture (Fig. 2e). GFP expression was also checked in some regenerating shoots, which clearly showed green fluorescence (Fig. 2f, g). For recovery of transgenic plants, well-developed shoots were transferred to rooting medium. Over 70% shoots initiated 2–3 roots per shoot within 4–6 weeks (Fig 2h). The well-rooted plantlets were transplanted to small plastic pots to acclimate for a certain period (Fig. 2i), followed by transfer to larger plastic pots for normal growth (Fig. 2j).
https://static-content.springer.com/image/art%3A10.1007%2Fs11240-011-0092-7/MediaObjects/11240_2011_92_Fig2_HTML.jpg
Fig. 2

Transformatino and production transgenic plants using leaf segments as starting materials. a, b Observation of gfp expression in the leaf segments under fluorescence microscope. Red color is the autofluorescence of the mesophyll. c, d Regeneration of shoots from the cutting ends of leaf segments cultured on the selection medium. e Shoots on the shoot elongation medium. Observation of the same shoot under bright (f) or fluorescence (g) field. h Well-rooted transgenic plantlets. Plantlets in the plastic pots for acclimation (i) or in the soil pots (j)

Molecular analysis of the transgenic plants

To further confirm the integration of gfp and nptII genes through PCR analysis, genomic DNA PCR of 14 randomly selected gfp expressing plants and one non-transformed plant was carried out using gene-specific primers. The gfp and nptII genes were detected as 500-bp (3a) and 710-bp (3b) fragments, respectively, in the transgenic plants (Fig. 3, lanes 1–14). The amplified fragments were of the same size as was expected. However, these fragments were not amplified in the non-transformed plant (Fig 3a, b, lane C). The data indicate that transgenic plants overexpressing gfp have been successfully produced via Agrobacterium-mediated transformation of leaf segments.
https://static-content.springer.com/image/art%3A10.1007%2Fs11240-011-0092-7/MediaObjects/11240_2011_92_Fig3_HTML.gif
Fig. 3

PCR analysis of the transgenic plants with primers specific to gfp gene (a) and nptII gene (b). M, Molecular size marker (100 bp ladder). C Control (untransformed plant). P Positive control (plasmid DNA). Lanes 1–14 are independent plants. Arrows point to the bands of expected size

In summary, this study constitutes a successful work on Agrobacterium tumefaciens-mediated transformation of leaf segments in Citrus. The established protocol allows regeneration of transgenic plants from leaf segments. It provides an alternative approach for citrus transformation and holds potential for integrating some genes of agronomically significant value in the future.

Acknowledgments

This work was supported by National Natural Science Foundation of China, the Research Fund for the Doctoral Program of Higher Education (20090146110010), Fok Ying Tong Education Foundation (114034), Wuhan Municipal Project for Academic Leaders (201150530148) and Hubei Provincial Natural Science Foundation (2009CDA080). Khan EU was supported financially by Islamic Development Bank (IDB), Saudi Arabia under PhD Merit Scholarship Program for High Technology.

Copyright information

© Springer Science+Business Media B.V. 2012