Plant Molecular Biology Reporter

, 28:9

Epigenetic Chromatin Modifiers in Barley: II. Characterization and Expression Analysis of the HDA1 Family of Barley Histone Deacetylases During Development and in Response to Jasmonic Acid

Authors

  • Kyproula Demetriou
    • Institute of Agrobiotechnology, CERTH
  • Aliki Kapazoglou
    • Institute of Agrobiotechnology, CERTH
  • Konstantinos Bladenopoulos
    • Cereal Institute, NAGREF
    • Institute of Agrobiotechnology, CERTH
    • Department of Genetics and Plant BreedingAristotle University of Thessaloniki
Article

DOI: 10.1007/s11105-009-0121-4

Cite this article as:
Demetriou, K., Kapazoglou, A., Bladenopoulos, K. et al. Plant Mol Biol Rep (2010) 28: 9. doi:10.1007/s11105-009-0121-4

Abstract

Epigenetic regulation of gene expression plays an important role in various aspects of eukaryotic development and is associated with modifications of chromatin structure. These are accomplished, in part, through the reversible process of histone acetylation/deacetylation, catalyzed by histone acetyltransferases (HATs), and histone deacetylases (HDACs), respectively. Eukaryotic HDACs are grouped in three major families, RPD3/HDA1 (thereafter cited as HDA1), SIR2 and the plant-specific HD2. Histone deacetylase genes have been studied in Arabidopsis and rice, but little is known about these genes from important crop plants. In this work, cDNAs encoding members of the HDA1 family and representing all four classes, Class I, Class II, Class III, and Class IV, were isolated and characterized from barley (Hordeum vulgare), a cereal crop of high agronomic importance. Expression analysis of the barley HDA1 family genes, HvHDAC1-I-1, HvHDAC1-I-3, HvHDAC1-II-1, HvHDAC1-III-1, and HvHDAC1-IV-1 demonstrated that they are expressed in all tissues and seed developmental stages examined. Differences in transcript abundance both in vegetative and reproductive tissues were observed among the different genes suggesting functional diversification of the HDA1 members. Differential expression was also evidenced for some of the HDA1 genes in two barley cultivars differing in various characteristics, such as seed size and resistance to stress, implying a possible association of these genes with different traits. Furthermore, the HDA1 genes were found to respond to the stress-related hormone jasmonic acid (JA), suggesting an association of these genes with barley responsiveness to biotic and abiotic stress. The expression pattern of the HDA1 genes suggests possible roles in the epigenetic regulation of barley development and stress response.

Keywords

Histone deacetylasesRPD3/HDA1 familyChromatin modificationEpigenetic regulationBarley

Introduction

Epigenetic regulation of gene expression is achieved, in part, through changes in chromatin structure. Highly organized chromatin consisting of DNA wrapped around histone proteins in nucleosomal structures can switch between relaxed and condensed states associated with transcriptional activity and transcriptional repression, respectively (Goldberg et al. 2007). This is accomplished by a variety of enzymatic complexes which catalyze the modification of DNA and histones (Kouzarides 2007; Wu et al. 2009). Post-transcriptional modifications of histones include acetylation, methylation, phosphorylation, and ubiquination.

Acetylation of nucleosomal core histones is a reversible process which plays a crucial role in the regulation of eukaryotic transcriptional activity. Acetylation of histones is often associated with increased gene activation, whereas deacetylation of histones is correlated with transcriptional repression and gene silencing (Chen and Tian 2007). This is achieved through the action of specific enzymes. Histone acetyltransferases (HATs) transfer an acetyl moiety to the ε-amino group of highly conserved lysines in the N-terminal extensions of core histones, thereby neutralizing the positive charge of lysines and resulting in less affinity to the negatively charged DNA molecules. Highly ordered condensed chromatin is then unfolded and accessibility of promoters to transcription factors is increased. Histone deacetylases (HDACs) remove the acetyl moieties from lysines resulting in reestablishment of the positive charge and compact chromatin configuration (Chen and Tian 2007). HATs and HDACs and other factors involved in chromatin structure are highly conserved in yeast, animals, and plants suggesting a fundamental mechanism in transcriptional regulation (Loidl 2004).

The first histone deacetylase, HDAC1, was discovered in mammalian cells and showed striking similarity with the yeast protein RPD3 (reduced potassium deficiency; Taunton et al. 1996). Since then, a number of histone deacetylases have been identified in a variety of higher eukaryotes. Sequence analysis of these proteins demonstrated that most of these enzymatic proteins contain conserved domains: a large domain of homology with the yeast RPD3 that covers most of the N-terminal, and a short C-terminal region with a more variable sequence. Mutagenesis of this homology domain confirmed its involvement in deacetylase enzymatic activity (Hassig et al. 1998; Kadosh and Struhl 1998).

Eukaryotic HDACs can be grouped into three major families based on their primary homology to the yeast HDACs, HDA1, and SIR2 (sirtuins). These are: (1) the HDA1 family, (2) the SIR2 family, and (3) the plant-specific HD2 family (Pandey et al. 2002; Yang and Seto 2003). The presence of a unique HDAC protein family in plants, HD2, possibly reflects the divergence of developmental processes and environmental responses of plant organisms from those of yeast and mammals. SIR2 proteins differ from the other HDACs in that they depend on nicotinamide adenine dinucleotide for enzymatic activity and have no structural similarity to other HDACs. Sequence analysis by Pandey et al. (2002) revealed that the first family of histone acetyltransferases, HDA1, can be subdivided further into three major clades, Class I, Class II, and Class III. Recently, sequence and phylogenetic analysis of the rice genome (Fu et al. 2007) identified the HDA1 family in rice, and showed that rice HDACs belonging in this family can also be divided in Class I, Class II, and Class III. In addition, the sequence analysis in rice revealed a fourth clade, Class IV. Expression analyses of 18 rice HDAC genes from HDA1, SIR2, and HD2 families demonstrated distinct spatial expression patterns and differential responses to environmental stresses and hormones (Fu et al. 2007). Characterization of HDAC mutants in Arabidopsis also revealed functional diversification among the members of different HDAC families and classes. AtHDAC6 gene (HDA1-Class I) for instance was shown to be involved in transgenic and repetitive DNA silencing and in the nuclear organization of rDNA loci (Ausfatz et al. 2002; Lippman et al. 2003; Probst et al. 2004). AtHDAC19, another member of the HDA1-Class I type was shown to be important for proper vegetative development as hdac19 mutants displayed various developmental abnormalities (Tian and Chen 2001; Tian et al. 2005; Zhou et al. 2005; Long et al. 2006). Mutations in the AtHDA18 gene (HDA1-Class II) resulted in alterations in the cellular patterning in the root epidermis in Arabidopsis (Xu et al. 2005). Recently, it was shown that HDA6 and HDA19 are involved in repression of embryonic-specific gene functions during germination (Tanaka et al. 2008). Similar to the HDA1 family, the plant-specific HD2 family has been suggested to be crucial for proper reproductive development. Silencing of the AtHD2A gene resulted in aborted seed development (Wu et al. 2000) and overexpression of AtHD2A resulted in repression of a number of genes involved in seed development and maturation (Zhou et al. 2004). Furthermore, HDAC genes from both families have been associated with the response to biotic and abiotic stress. AtHDAC19 was suggested to mediate jasmonic acid (JA) and ethylene signaling during pathogen defense (Tian and Chen 2001; Tian et al. 2005; Zhou et al. 2005) and HDA6 was shown to be required for jasmonate response, senescence, and flowering, in Arabidopsis (Wu et al. 2008). In addition, AtHD2C, belonging to the HD2 family was proposed to play a role in abscisic acid (ABA) signaling and abiotic stress (Sridha and Wu 2006).

Nevertheless, many aspects of the role that HDACs may play in plant development and the mechanism by which they regulate chromatin structure and gene activity remain obscure. Moreover, very little is known about the function of HDACs in crop plants. The best characterized crop system so far is that of maize where 15 HDAC genes have been identified (ten HDA1, one SIR2, and four HD2-like genes). Members of all three HDAC families have been identified and biochemically characterized from this important cereal crop (Lusser et al. 2001; Rossi et al. 2003) and overexpression of the gene hda101 (HDA1-Class I) showed that it is involved in the process of vegetative to reproductive transitions and it mediates other chromatin modifications such as histone methylations and phosphorylations (Rossi et al. 2007).

Working with another important cereal crop, barley, our group recently reported the isolation, mapping, and expression analysis of the histone deacetylase genes belonging to the HD2 family (Demetriou et al. 2009). Two full-length cDNAs, HvHDAC2-1 and HvHDAC2-2, were cloned and characterized and their expression investigated during seed development and in two cultivars with varying seed size. The two genes displayed differential expression during seed development, suggesting possibly different functional specificity. One member, HvHDAC2-1, exhibited significantly different levels of expression in different seed developmental stages. Interestingly, it also displayed higher levels of expression in all seed developmental stages in a small-seed cultivar, as compared to a large-seed cultivar. In the current work, we have extended these investigations presenting the characterization of the barley HDA1 gene family members as well. Representatives of each of the four classes of the HDA1 family: Class I, Class II, Class III, and Class IV were identified and the putative protein sequences analyzed and classified in a phylogenetic tree of other monocot and dicot HDA1 proteins. The expression of each class was analyzed in different tissues and developmental stages, in two barley cultivars with different characteristics, and in response to treatment with JA.

Materials and Methods

Plant Material

Two commercial barley cultivars, Caresse and Kos were planted in the field and were the source of RNA for expression analysis. Caresse has larger grain and Kos is more resistant to various stresses and diseases. For Caresse, the weight of 1,000 grains is 55 g, and 98% of seeds have diameter longer than 2.5 mm. For Kos, the weight of 1,000 grains is 36–40 g and only 36–49% of seeds have diameter longer than 2.5 mm. (www.cerealinstitute.gr).

Hormonal Treatment

Seven-day-old seedlings (Caresse) grown in a growth chamber (16 hours (h) light, 8 h darkness, at 22°C) were sprayed with 100 µM JA (methyl jasmonate, ALDRICH). Aerial parts of plants were collected at 6 h and 24 h after treatment and immediately thrown in liquid nitrogen. Aerial parts from five plants were pooled together for RNA extraction for each time point. Control plants were sprayed with water plus 0.2% Tween.

RNA Isolation and First-Strand cDNA Synthesis

Total RNA was isolated from roots, shoots, apical meristems, first leaves of seedlings, flowers before fertilization (immature flowers), seeds 1–3, 3–5, 5–10, 10–15, and 15–20 DAF (days after fertilization), and aerial parts of 7-day-old seedlings before and after hormonal treatment, respectively, using the TRIZOL method (TRI REAGENT, Sigma) according to the instructions of the manufacturer.

For the first-strand cDNA synthesis, 1 µg of total RNA was used for each reaction with the M-MLV Reverse Transcriptase kit of Invitrogen, according to the specifications of the manufacturer.

Isolation of cDNAs

A search of the barley EST database in TIGR (www.tigr.org) identified tentative consensus sequences corresponding to different HDACs belonging to different families and classes.

HvHDAC 1-I-1

RT-PCR performed using two specific primers, Barley RPD3CIF2 and Barley RPD3CIR2, based on TC135897 from the barley EST database (TIGR), and total RNA from barley seeds (cultivar Caresse) 1–3 DAF resulted in a HvHDAC 1-I-1 fragment of 762 bp. To obtain the 5′end of the HvHDAC1-I-1 cDNA, the RCA-rolling circle amplification (RACE) technique was utilized according to Polidoros et al. (2006). Circular cDNA synthesized from Caresse seeds 1-3 DAF total RNA was used as template. Specific primers, Barley RPD3CIF5a and HvHDAC1R1, HvHDAC1R2, and HvHDAC1R3 were used as forward and reverse primers, respectively.

HvHDAC 1-I-3

RT-PCR was performed using the primers Barley RPD3C1F1a and Barley RPD3C1R1a (based on the sequence of the TC132159, from the barley EST database, TIGR) and first-strand cDNA synthesized from a mixture of total RNA from Caresse seeds 5–10 and 15–20 DAF, as template. A fragment of 1,700 bp was obtained including the ATG translation initiation codon. To obtain the 3′ end of the HvHDAC 1-I-3 cDNA 3′RACE was performed using first-strand cDNA prepared from a mixture of total RNA from Caresse seeds 5–10, 10–15, and 15–20 DAF. The primers, Barley RPD3CIF1a and Abridge Universal Amplification Primer (AUAP, Invitrogen, Paisley, UK) were used as forward and reverse primers, respectively. A nested PCR with primers Barley RPD3CIF1b and AUAP produced a PCR product of 1,300 bp which contains the 3′UTR.

HvHDAC I-II-1

RT-PCR was performed using the specific primers Barley RPD3CIIF1/Barley RPD3CIIR1 (based on the sequence of the TC 137977) and first-strand cDNA synthesized from total RNA from Caresse seeds 1–3 DAF, as template. This produced a fragment of 742 bp. In order to obtain the 3′end of the HvHDAC I-II-1 cDNA, 3′RACE-PCR was performed using the primer pair BarleyRPD3CIIF1/AUAP for the first PCR reaction with RNA/cDNA from 1–3 DAF seed and HvHDACIIF2/AUAP for the nested PCR reaction. The 5′end of the HvHDAC I-II-1 cDNA was obtained using the 5′RACE System for Rapid Amplification of cDNA Ends, Version 2.0, Kit (Invitrogen, Paisley, UK). The primer pairs used were HvHDAC1II-1GST1/

Abridge amplification primer (AAP) and HvHDACIIR1/AUAP (Abridge Universal Primer) for the first and second PCRs, respectively, were used. A second nested PCR was performed with HvHDACIIR2 as forward primer, and AUAP as reverse primer and the second PCR as template at 0.1% and 0.05% dilution.

HvHDAC I-III-1

RT-PCR was performed using the specific primers Barley RPD3CIIIF1/Barley RPD3CIIIR1 (based on the sequence HDA1005 from ChromDB) and first-strand cDNA synthesized from total RNA from Caresse seeds 5–10 DAF, as template. This amplifies a fragment of 532 bp. 3′RACE-PCR then followed with primers HvHDACIII-F1/AUAP.

All PCR products of interest were cloned into pCR 2.1 TOPO vector using the TOPO TA cloning Kit (Invitrogen) and sequenced.

Protein Sequence Analysis

The protein sequence alignments was generated with the Clustal W Method (Thomson et al. 1994) of MegAlign of the LaserGene software and processed with Bioedit software. The phylogenetic tree was calculated using MEGA 3.1 software (Kumar et al. 2004) by the neighbor-joining method with p distance correction (Saitou and Nei 1987). Bootstrap values were obtained from 1,000 bootstrap replicates.

Expression Analysis

Semiquantitave RT-PCR was carried out with total RNA from roots, shoots, apical meristems, and first leaves of seedlings and from flowers before fertilization (immature flower) and seeds 1–3, 3–5, 5–10, 10–15, and 15–20 DAF from each cultivar, Caresse and Kos, respectively. The PCR conditions for all genes were: initial denaturation at 96°C for 2 min, then 30 cycles of denaturation at 96°C for 30 s, annealing for 30 s, extension at 72°C for 1 min and final extension at 72°C for 10 min. Tannealing was 53°C, 54°C, 63°C, 52°C, and 57°C for HvHDAC1-I-1, HvHDAC1-I-3, HvHDAC1-II-1, HvHDAC1-III-1, and HvHDAC1-IV-1, respectively. Primer pairs used were as follows: BarelyRPD3CIF2/BarelyRPD3CIR2, BarelyRPD3CIF1b/BarleyRPD3CIR1a, BarleyRPD3CIIF1/BarleyRPD3CIIR1, BarleyRPD3CIIIF1/BarleyRPD3CIIIR1, and BarleyRPD3CIVF1/BarleyRPD3CIVR1, respectively. To verify the presence of equal amounts of RNA/cDNA across samples during the PCR reactions, actin amplification was carried out. The pair of primers ActinF and ActinR amplify 1,111 bp of the actin coding EST sequence of barley AY145451. The PCR conditions for the amplification of actin were: initial denaturation at 96°C for 3 min, then 30 cycles of 96°C for 30 s, 70°C for 1 min, 72°C for 2 min and final extension at 72°C for 15 min.

Quantitative real-time RT-PCR was performed with cDNA synthesized from 1 µg of total RNA from aerial parts of 7-day-old Caresse seedlings before and after JA treatment. For each sample, the reaction was a PCR reaction mix (20 µl total volume) containing 5 μl of the 1:50 diluted cDNA, 0.25 μM of each primer and 1× Platinum SYBR Green qPCR Supermix-UDG (Invitrogen, Paisley, UK). Each reaction was carried out in triplicate in an Opticon2 DNA engine (MJ Research). Primer pairs used were: BarleyRPD3F5a/BarleyRPD3R5; BarleyRPD3CIF1b/BarleyRPD3CIR1b; BarleyRPD3CIIF1/HvHDACIIR1; HvHDACIIIF1/BarleyRPD3CIIIR1; HvHDACIVF1/BarleyRPD3CIVR1 (which amplify fragments of 349 bp, 406 bp, 232 bp, 386 bp, and 66 bp respectively) for the genes HvHDAC1-I-1, HvHDAC1-I-3, HvHDAC1-II-1, HvHDAC1-III-1, and HvHDAC1-IV-1 respectively. The thermocycler conditions were: 50°C for 2 min, 95°C for 2 min, then 42 cycles at 95°C for 30 s, Tannealing (56°C, 56°C, 56°C, 53°C, 59°C, respectively) for 30 s, 72°C for 30 s, plate read at 82°C, followed by 72°C for 5 min. To identify the PCR products, a melting curve was performed from 65°C to 95°C with observations every 0.2°C and a 10-s hold between observations. Relative quantification and statistical analysis were performed with the REST software (Pfaffl et al. 2002) and using actin as the reference gene with HvActinF/HvActinR as primers (amplify 235 bp). All primers used in expression analysis correspond to non-conserved regions and are shown in Table 1.
Table 1

Primers used for cloning and expression analysis

Gene

Primer

Sequence

HvHDAC1-I-1

Barley RPD3CIF2

5′-GCTATTGTTCTTCAGTGTGG-3′

Barley RPD3CIR2

5′-CAGGAAATGTTACATTCTCCC-3′

Barley RPD3CIF5a

5′-GGTCATGTTGGAGAAAGACAGG-3′

Barley RPD3C1R5

5′-GATTTAGTCTTCGAGCCGCATC-3′

HvHDAC1R1

5′-GGACATAGAAATCTGGTGGAACC-3′

HvHDAC1R2

5′-CGCAAACTCTCCATGACTTGC-3′

HvHDAC1R3

5′-CACACTGAAGAACAATAGCACC-3′

HvHDAC1-I-3

Barley RPD3CIF1a

5′-GCGATGGAGCCCTCCTCG-3′

Barley RPD3CIR1a

5′-CCGAATGCTTACAATCATGGC-3′

Barley RPD3CIF1b

5′-CTGCTACGTCAACGACATCG-3′

Barley RPD3CIR1b

5′-CACGCATTCTGCATGACCTCTG-3′

HvHDAC1-II-1

Barley RPD3CIIF1

5′-CCAAATCCACATCCCGAAAGACC-3′

Barley RPD3CIIR1

5′-CGCAACAACCCAGAGGATCACC-3′

HvHDACIIF2

5′-GGTAAATATACCTTGGAGTTGTG-3′

HvHDAC1II-1GST1

5′-CCGAGAATCCTTTACC-3′

HvHDACIIR1

5′-CAGCACATGCCGAGTGTCC-3′

HvHDACIIR2

5′-CGTGATCTGAAGTATGGACC-3′

HvHDAC1-III-1

BarleyRPD3CIIIF1

5′-CAGCAAAGGCTACTGTACC-3′

BarleyRPD3CIIIR1

5′-GTGATTAGAGATGAGAAGG-3′

HvHDACIIIF1

5′-CGCTGATATTTCGCTCTGC-3′

HvHDAC1-IV-1

Barley RPD3CIVF1

5′-GGCTTCCTCGACGTGCTCG-3′

HvHDACIVF1

5′-CGAATGGAAGACAGTGCTTGACC-3′

Barley RPD3CIVR1

5′CCAGGCTCCTCATTATCTGTCC3

HvADC2

HvADC2 F

5′-CTTCCACATCGGCTCCATGATC- 3′

HvADC2 R

5′-TTGAGCCGCACCGCCTGCAC- 3′

Actin

Barley Actin F

5′-ATGGCTGACGGTGAGGACATCCAGCC

Barley Actin R

5′-TCAGAAGCACTTCCTGTGGACGATCGC-3′

HvActin F

5′-GCCGTGCTTTCCCTCTATG-3′

HvActin R

5′-GCTTCTCCTTGATGTCCCTTA- 3′

Universal

AAP

5′-GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG-3′

AUAP

5′-GGCCACGCGTCGACTAGTAC-3′

The barley gene HvADC2 (arginine decarboxylase 2), which is known to be induced by JA (Walia et al. 2007) was used as a positive control.

Results

Identification, Cloning and Protein Sequence Analysis of HvHDAC Members Belonging to the HDA1 Family of Barley HDACs

Two full-length cDNAs sequences belonging to Class I of the HDA1 family were isolated from Caresse and named HvHDAC1-I-1 and HvHDAC1-I-3, respectively.

Using two specific primers based on a EST sequence (TC135897) from the barley EST database in TIGR (www.tigr.org), a HvHDAC 1-I-1 fragment was isolated from barley seeds 1–3 DAF by RT-PCR. The cDNA was completed using the RCA-RACE using two pairs of inverse primers. The completed cDNA sequence contains 1,623 bp coding for a putative protein of 430 amino acids. Similarly, with specific primers based on another barley EST sequence (TC132159), a HvHDAC1-I-3 fragment was isolated from barley seeds 1–3 DAF. The full-length cDNA was obtained with 3′RACE-PCR. The completed cDNA sequence contains 1,736 bp and encodes a putative protein of 518 amino acids. An alignment of different HDA1-Class I proteins from different plant species is shown in Fig. 1. The protein sequences HvHDAC1-I-1 and HvHDAC1-I-3 share 57% amino acid identity with each other. HvHDAC1-I-1 shows high homology to the maize ZmHDA102 (96% identity). HvHDAC1-I-3 has high homology with wheat TaHDAC3 (96% identity), and maize ZmRPD3 (85% identity). A phylogenetic tree constructed with different HDAC sequences from different plant species shows the classification of HDACs in families and classes and the relationship of HvHDAC1-I-1 and HvHDAC1-I-3 with the other HDA1-Class I, family members (Fig. 2). Within Class I, HvHDAC1-I-1 forms a sub-class with maize ZmHDA102 and OsHDA711, whereas HvHDAC1-I-3 is more closely related to TaHDAC3, ZmRPD3, and OsHDA702 in another sub-class (Fig. 2).
https://static-content.springer.com/image/art%3A10.1007%2Fs11105-009-0121-4/MediaObjects/11105_2009_121_Fig1a_HTML.gifhttps://static-content.springer.com/image/art%3A10.1007%2Fs11105-009-0121-4/MediaObjects/11105_2009_121_Fig1b_HTML.gif
Fig. 1

Amino acid sequence alignment of HDA1-Class I, Class II, Class III, and Class IV proteins from different plants. Identical and similar amino acids are shaded in pink and blue, respectively. Residues potentially involved in histone deacetylase activity are indicated by asterisks

https://static-content.springer.com/image/art%3A10.1007%2Fs11105-009-0121-4/MediaObjects/11105_2009_121_Fig2_HTML.gif
Fig. 2

Phylogenetic analysis of barley HDA1 proteins. HDA1 family is divided in four classes, I, II, III, and IV. The HD2 family is shown as a condensed branch. The sequences used and their accession numbers are shown in Table 2. Barley members are in bold red letters and shaded gray. Numbers indicate bootstrap values (1,000 = 100%)

One full-length cDNA belonging to Class II of the HDA1 family was isolated from barley, cultivar Caresse, and named HvHDAC1-II-1. A barley EST (TC 137977) corresponding to Class II of the HDA1 family of HDACs was used to design specific primers which amplified a fragment of the EST using total RNA from seeds 1–3 DAF. The cDNA was completed with 5′ and 3′ RACE-PCR and contains 2,391 bp encoding a putative protein of 614 amino acids. An alignment of different HDA1-Class II, proteins from different plant species is shown in Fig. 1. The HvHDAC1-II-1 protein sequence has 95% amino acid identity with TaHDAC4 from wheat. HvHDAC1-II-1 is classified together with HDA1-Class II HDACs, being more closely related to the monocot Class II sequences as shown in the phylogenetic tree (Fig. 2).

For HvHDAC1-III-1, firstly, a partial cDNA was obtained with specific primers based on the sequence of the EST HDA1005 from the ChromDB database (www.chromdb.org) and total RNA from Caresse seeds 5–10 DAF. This cDNA was completed to the 3′ end by 3′RACE-PCR to give a total of 225 amino acids which contain the entire histone deacetylase domain. It has 88% identity with rice OsHDA706 and 73% identity with Arabidopsis AtHDA2 (Fig. 1). HvHDAC1-III-1 groups out into the HDA1-Class III HDAC sequences as shown in the phylogenetic tree (Fig. 2).

A full-length cDNA containing a HDA1-Class IV protein sequence from the cultivar Haruna nijo was identified in the barley DB database (http://www.shigen.nig.ac.jp/barley/) encoding 389 amino acids. The putative protein sequence has highest homology with OsHDA712 (86% identity) and OsHDA716 (70% identity; Fig. 1). The relationship of HvHDAC1-IV-1 with the other HDA1 family members is shown in the phylogenetic tree (Fig. 2). HvHDAC1-IV-1 is classified together with the newly identified Class IV clade in rice (Fu et al. 2007).

Expression of HDA1 Genes During Barley Development

Semiquantitative RT-PCR was used for studying the expression of HDA1 gene homologues from barley in different tissues and developmental stages, as well as in two different barley cultivars, Caresse and Kos, differing in agronomical traits. As shown in Fig. 3, transcripts from all members of the RPD3/HDA1 family are detected in all tissues and developmental stages examined but with large differences in mRNA accumulation for each member, across samples. For the two Class I genes, HvHDAC1-I-1 and HvHDAC1-I-3, global expression was observed except for the later stages of seed development in Caresse, the larger seed cultivar. A different expression profile was seen in Kos, the smaller seed cultivar, where expression was higher in reproductive tissues. The Class II barley gene, HvHDAC1-II-1, exhibited higher expression in root, flower, and seed than in green tissues and transcript accumulation profiles were similar in both cultivars, except for higher expression in Kos seeds 10–15 DAF. A unique expression pattern was observed for the Class III gene, HvHDAC1-III-1, with noticeable expression in roots in both cultivars, but little expression in other vegetative and reproductive tissues. The Class IV gene, HvHDAC1-IV-1, showed preferential expression in vegetative tissues in Caresse, whereas more global expression was observed in Kos.
https://static-content.springer.com/image/art%3A10.1007%2Fs11105-009-0121-4/MediaObjects/11105_2009_121_Fig3_HTML.gif
Fig. 3

Expression analysis of barley HDA1 genes during development and in two barley cultivars. Semiquantitative RT-PCR from different tissues and seed developmental stages of barley for the members of the HDA1 family HDAC genes, HvHDAC 1-I-1, HvHDAC1-3-1, HvHDAC1-II-1, HvHDAC 1-III-1, and HvHDAC1-IV. HvActin was used as the internal control. DAF days after fertilization. Caresse (larger seed size), Kos (smaller seed size)

Expression of Barley HDA1 Genes after JA Treatment

Quantitative real-time PCR was performed using total RNA from 7-day-old seedlings subjected to exogenous application with JA, in order to examine any response of the barley HDA1 genes to this stress-related hormone. HvHDAC1-I-3, HvHDAC1-II-1, HvHDAC1-III-1, and HvHDAC1-IV-1 were induced at 24 h after spraying of seedlings with 100 μM JA, as compared to the Tween–water-treated controls plants (Fig. 4). On the contrary, HvHDAC1-I-1 expression is not increased by JA but seems slightly diminished at 6 h after treatment. HvHDAC1-III-1 exhibits the highest induction with approximately sixfold increase in transcript abundance as compared to the untreated control. HvHDAC1-IV-I seems to undergo earlier induction as it shows significantly increased transcript levels already at 6 h after JA treatment.
https://static-content.springer.com/image/art%3A10.1007%2Fs11105-009-0121-4/MediaObjects/11105_2009_121_Fig4_HTML.gif
Fig. 4

Expression analysis of barley HDA1 genes after treatment of seedlings with JA. a Quantitative real-time PCR analysis of HvHDAC1-I-1, HvHDAC1-I-3, HvHDAC1-II-1, HvHDAC1-III-1, and HvHDAC1-IV-1genes at 6 and 24 h after treatment of Caresse seedlings with 100 µM JA. b Quantitative real-time PCR analysis of the barley gene HvADC2 (known to be induced by JA) at 6 and 24 h after treatment of Caresse seedlings with 100 µM JA, respectively, used as positive control. Expression values were normalized to those of HvActin. Data represent mean values from two independent experiments with standard deviations. Relative expression ratio of each sample was compared to the control group which was untreated plants, 0 h, and was assigned the value of 1. Values significantly different (P < 0.05) from the control group (untreated 0 h) are marked with an asterisk. Gray bars hormone-treated plants for 6 h and 24 h, white bars no hormone-treated plants (mocked with H2O/Tween for 6 h and 24 h, respectively)

Discussion

In this work, we have presented the cloning and characterization of members of the HDA1 gene family of histone deacetylases from barley. Four cDNAs, encoding HvHDAC1-I-1, HvHDAC1-3-1, HvHDAC1-II-1, and HvHDAC1-III-1 were isolated from barley and one cDNA encoding HvHDAC1-IV-1 was identified in a public database. Previous sequence analysis of HDA1 protein sequences from different organisms (Pandey et al. 2002; Fu et al. 2007) had demonstrated that the HDA1 proteins are divided into four classes, Class I, Class II, Class III and Class IV. Phylogenetic analysis of the barley HDA1 sequences revealed that they are also grouped in Class I, Class II, Class III, and Class IV. Specifically, we have identified and characterized two members of Class I, HvHDAC1-I-1, and HvHDAC1-I-3, and one member of each of the other classes, HvHDAC1-II-1, HvHDAC1-III-1, HvHDAC1-IV-1, respectively. Class IV was recently identified in rice (Fu et al. 2007). Interestingly, our analysis reveals that AtHDAC8, a previously unclassified Arabidopsis HDAC sequence (Hollender and Zhong 2008), and ZmHDA117 a newly identified maize sequence (ChromDB database) also group out in Class IV of HDA1, increasing the size of this previously unknown class.

Protein sequence alignments including members of all four classes from different plants, demonstrated that the barley HDA1 sequences of each class share a highly conserved histone deacetylase motif, including four histidine and two aspartate residues critical for catalytic activity Hassig et al. 1998; Kadosh and Struhl 1998). The divergence in the rest of the sequences among classes may suggest structural differences possibly associated with interaction with other proteins and functional specifications Table 2.
Table 2

Protein sequences used for alignments and phylogenetic tree construction

Gene name

Accession number

Family

Class

AtHDA6

NM_125705

HDA1

I

AtHDA7

AF510166

  

AtHDA9

NM_114336

  

AtHDA10

NM_114334

  

AtHDA17

NM_114317

  

AtHDA19

NM_001085042

  

OsHDA701

NM_192536

  

OsHDA702

AF_513382

  

OsHDA703

AF_513384

  

OsHDA705

XM_481792

  

OsHDA707

NM_188519

  

OsHDA709

NM_192536

  

OsHDA710

AF_513383

  

OsHDA711

XM_479060

  

ZmHDA108

AAL33653

  

ZmRPD3

AAC50038

  

ZmHDA102

AAL33655

  

TaHDAC

AAU82113 Q5XUV0

  

TaHDAC3

ABG43092 Q0Z9W2

  

HvHDAC1-I-1

Bankit 1047187 EU348772

  

HvHDAC1-I-3

Bankit 1047198 EU348773

  

AtHDA5

NM_125499

HDA1

II

AtHDA14

NM_119501

  

AtHDA15

NM_112737

  

AtHDA18

AF510670

  

OsHDA704

XM_476712

  

OsHDA713

AK060337

  

OsHDA714

AK067069

  

ZmHDA1

AAP92528

  

ZmHDA110

AAM93212

  

TaHDAC4

ABG43093

  

HvHDAC1-II-1

Bankit 1047277 EU348774

  

AtHDA2

NM_122505

HDA1

III

OsHDA706

NC_008399

  

HvHDAC1-III-1

Bankit 1206526 FJ898365

  

AtHDA8

NM_100719

HDA1

IV

OsHDA712

AF25571

  

OsHDA716

NC_008398

  

ZmHDA117

EU947413.1

  

HvHDAC1-IV-1

AK252219

  

At HD2a

AAG28472

HD2

 

At HD2b

AAG28473

  

At HD2c

AAF70197

  

At HD2d

AAF70198

  

Os HD2

AAF70196

  

OsHD2b

NP_001045151

  

Zm HD2a

O24591

  

Zm HD2b

AAF68624

  

Zm HD2c

AAF68625

  

Zm HDA106

AAK67143

  

Ta HDAC2

ABG43091

  

HvHDAC2-1

Bankit 1047282 EU348775

  

HvHDAC2-2

Bankit 1047284 EU348776

  

The expression of barley HDA1 genes was examined in different tissues, seed developmental stages and in two cultivars, Caresse and Kos, with different agronomical characteristics. For instance, Caresse has larger grain size, and Kos is superior with respect to resistance to diseases and general adaptability. Differential expression was observed for each gene during vegetative and reproductive development with notable variation in expression across classes. Likewise, differential expression was evidenced between the cultivars Caresse and Kos for each individual gene. The differences in expression patterns across developmental stages among the different classes of the family may reflect distinct functions of different HDA1 genes during barley development. Similarly, the differences in gene expression for each HDA1 gene between cultivars might be associated with the different characteristics of each cultivar. Further experiments will elucidate the roles of HDA1 genes and the likely functional diversification among family members. Equally, additional experiments with a large number of cultivars will be necessary in order to reach to a conclusive assessment about any potential HDA1-trait association.

The barley HDA1 genes were also examined for their responsiveness to the stress-related hormone, JA. Four genes, HvHDAC1-I-3, HvHDAC1-II-1, HvHDAC1-III-1, and HvHDAC1-IV-1, were found to be induced by exogenous JA application. In our previous work on the barley HD2 family, HvHDAC2-1 and HvHDAC2-2 were also shown to be induced with JA treatment (Demetriou et al. 2009), suggesting that a general JA-mediated HDAC induction may exist in barley. In rice, certain HDA1 genes were found to be induced by external JA whereas others were downregulated. According to Fu et al. (2007), two members of the rice HDAC class I (HDA 702 and HDA 705) and one member of class II (HDA 704) were induced by exogenous JA application, whereas another member of class II (HDA 714) as well as a member of class III (HDA 706) did not show any significant changes in their expression upon JA treatment. Conversely, the expression of a member of class IV (HDA 712) was reduced upon JA application.

In barley, except for HvHDAC1-I-1, the rest of HDA1 genes examined (one of each class, I, II, III, and IV, respectively) were induced upon JA treatment. Induction by JA agrees with that for rice at least for one class I and one class II genes. Differential gene expression between the rice and barley HDA1 members of the same HDAC class may be due to the fact that the representative HDA1 genes examined are not functional homologues. Additionally, it may reflect differences in the expression of these genes between the two plants, implying differences in the HDAC-associated JA response within monocots. Certainly, examination of the expression of all members within a class would be needed in order to make more conclusive comparisons of the HDA1 gene expression in response to external JA, between the two plants. The barley HDA1 genes were also examined for their response to ABA, but no significant changes in gene expression were observed (data not shown).

Histone modifications, including acetylation, are involved in the responses of plants to stress (Chinnusamy et al. 2008; Chinnusamy and Zhu 2009). Biotic and abiotic stress factors trigger the production of certain hormones by plants. The plant hormones JA, ABA, SA (salicylic acid), and ethylene mediate the regulation of gene expression during the adaptive responses of plants to abiotic and biotic stresses. It has been suggested that histone acetylation/deacetylation through the action of HATs and HDACs, respectively, may epigenetically regulate the integration of hormonal signals controlling stress response genes (Sridha and Wu 2006). For example, in Arabidopsis, AtHDA19, a HDA1-Class I gene, was found to mediate histone deacetylation in response to abiotic and biotic stress. AtHDA19 is induced by wounding, JA, ethylene and infection by pathogens (Zhou et al. 2005). Overexpression of AtHDA19 resulted in reduced histone acetylation levels and upregulation of the stress-related genes ERF1 (Ethylene Response Factor-1) and PR (Pathogenesis Related). Conversely, silencing of AtHDA19 led to increased histone acetylation and downregulation of ERF1 and PR. AtHDA6, another HDA1-Class I gene was also found to be induced by exogenous JA and ethylene (Zhou et al. 2005). In addition, in AtHDA6 mutants and in HDA6-RNAi plants the expression of the Arabidopsis JA-responsive genes PDF1.2, VSP2, JIN1, and ERF1 was downregulated. Furthermore, histone modifications have been suggested to play a major role in ABA-mediated response to abiotic stress (Chinnusamy et al. 2008). ABA treatment caused severe reduction in expression of the histone deacetylase, AtHD2C, in Arabidopsis, whereas overexpression of AtHD2C resulted in enhanced abiotic stress tolerance to salt and drought stress, and both repression of several ABA-responsive genes and induction of others (Sridha and Wu 2006). Finally, cold, osmotic and salt stresses, and external application of hormones such as JA, ABA, and SA, in rice, were shown to increase the expression of certain HDA1 genes, and reduce the expression of others (Fu et al. 2007).

The observed induction of certain barley HDA1 genes upon treatment with the hormone JA may suggest a role for these genes in the epigenetic regulation of stress responses in barley.

The study described above on the HDA1 family of barley HDACs in conjunction with our recently published work on the plant-specific HD2 family (Demetriou et al. 2009), provide a basis for future studies aiming to elucidate the role of both HDA1 and HD2 families in epigenetic regulation of barley development and stress response.

Acknowledgments

This work was supported by a PENED grant (Ο3ΕΔ402/2003). Continuous support for the Institute of Agrobiotechnology/CERTH from the General Secretariat of Research and Technology of Greece is also acknowledged.

Copyright information

© Springer-Verlag 2009