Neurochemical Research

, Volume 35, Issue 4, pp 572–579

Comparison of the Efficiencies of Three Neural Induction Protocols in Human Adipose Stromal Cells

Authors

  • Dong-Xiang Qian
    • Neurosurgery Institute of Guangdong, Key Laboratory on Brain Function Repair and Regeneration of Guangdong, Department of Neurosurgery, Zhujiang HospitalSouthern Medical University
    • Department of Neurosurgery, The Third Affiliated HospitalGuangzhou Medical College
  • Hong-Tian Zhang
    • Neurosurgery Institute of Guangdong, Key Laboratory on Brain Function Repair and Regeneration of Guangdong, Department of Neurosurgery, Zhujiang HospitalSouthern Medical University
    • Department of NeurosurgeryThe General Hospital of Beijing PLA
  • Xu Ma
    • Neurosurgery Institute of Guangdong, Key Laboratory on Brain Function Repair and Regeneration of Guangdong, Department of Neurosurgery, Zhujiang HospitalSouthern Medical University
    • Department of NeurosurgeryGuangdong Provincial Hospital of Traditional Chinese Medicine
    • Neurosurgery Institute of Guangdong, Key Laboratory on Brain Function Repair and Regeneration of Guangdong, Department of Neurosurgery, Zhujiang HospitalSouthern Medical University
    • Neurosurgery Institute of Guangdong, Key Laboratory on Brain Function Repair and Regeneration of Guangdong, Department of Neurosurgery, Zhujiang HospitalSouthern Medical University
    • Department of NeurosurgeryThe General Hospital of Beijing PLA
Original Paper

DOI: 10.1007/s11064-009-0101-y

Cite this article as:
Qian, D., Zhang, H., Ma, X. et al. Neurochem Res (2010) 35: 572. doi:10.1007/s11064-009-0101-y
  • 235 Views

Abstract

The aim of this study was to compare the neural differentiation potential and the expression of neurotrophic factors (NTFs) in differentiated adipose-derived stem cells (ADSCs) using three established induction protocols, serum free (Protocol 1), chemical reagents (Protocol 2), and spontaneous (Protocol 3) protocols. Protocol 1 produced the highest percentage of mature neural-like cells (MAP2ab+). Protocol 2 showed the highest percentage of immature neural-like cells (β-tubulin III+), but the neural-like state was transient and reversible. Protocol 3 caused ADSCs to differentiate spontaneously into immature neural-like cells, but not into mature neural cell types. The neural-like cells produced by Protocol 1 lived the longest in culture with little cell death, but Protocol 2 and 3 led to the significant cell death. Therefore, Protocol 1 is the most efficient among these protocols. Additionally, soon after differentiation, the mRNA levels of nerve growth factor (NGF) and brain-derived neurotrophic factor (BDNF) in dADSCs were sharply decreased by Protocol 1 and 2 (acute induction protocol), but not by Protocol 3 (chronic induction protocol). The results indicate that NTFs played an important role in neural differentiation via acute responses to NGF and BDNF, but not chronically during the transdifferentiation process.

Keywords

Mesenchymal stem cellsTransdifferentiationNeural differentiationNerve growth factors

Introduction

Mesenchymal stem cells (MSCs) are an attractive cell source for cell therapy and regeneration [1]. MSCs can be isolated and expanded from different adult tissues, including adipose-derived stem cells (ADSCs), which are abundant and can be easily isolated by a less invasive method than bone marrow-derived MSCs [2, 3].

Several in vitro studies described conditions under which MSCs can be differentiated in culture to neural-like cells [46]. These neural differentiation protocols include chemical inducers [7], cytokines [810], co-culture with neurons or glia [11, 12], chemical inducers plus cytokines [13, 14], and special supplements plus cytokines [10]. MSCs in long-time culture undergo chronic, spontaneous transformation to neural-like cells without cytokines or specific chemicals [15]. Despite these studies, controversy persists regarding the neural differentiation potential of MSCs. Some protocols are reversible and only transiently induce differentiation, with MSCs reverting to normal morphologies after passaging [1620]. Therefore, we wanted to determine the most efficient protocol as well as to stably maintain neural differentiation in ADSCs.

The mechanism for transdifferentiation of MSCs is unclear, but may result from the induction of neurotrophic factors (NTFs) [21, 22]. NTFs are involved in neuroblast proliferation, neural development, and maturation [23, 24]. MSCs express NTFs and their high affinity receptors [21], but few reports have measured the expression of NTFs during the course of transdifferentiation [21, 22].

In this study, we compared different protocols for generating neural-like cells from ADSCs. First, we measured the expression of several neural markers by immunohistochemistry and Western blot. Second, cell death was analyzed by the TUNEL assay. Lastly, we measured protein and mRNA levels of nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), and neurotrophin-4 (NT-4) by enzyme-linked immunosorbent assay (ELISA) and real-time polymerase chain reaction (RT-PCR) after differentiation.

Materials and Methods

Preparation and Culture of ADSCs

The method for isolation of ADSCs was as described previously [25]. After anesthesia by an intraperitoneal injection of 10% kessodrate, ADSCs were isolated from adult Sprague–Dawley rats (200–300 g; Animal Experimental Center, Southern Medical University). Visceral fat encasing the stomach and intestines was carefully dissected and minced using a sterile razor blade under sterile conditions. Tissue was then enzymatically dissociated for 60 min at 37°C using 0.15% (w/v) collagenase type I (Invitrogen, UK). The suspension was neutralized by DMEM/F12 (Gibco, USA) containing 10% (v/v) fetal bovine serum (FBS; Hyclone) and centrifuged at 1,200 rpm for 5 min to separate the floating adipocytes from the stromal vascular fraction. The pellet of stromal cells was resuspended in DMEM/F12 containing 10% (v/v) FBS and 1% (v/v) penicillin/streptomycin solution. Cultures were maintained at subconfluence in a 37°C incubator with 5% CO2. At confluence, cells were split with 0.25% trypsin/0.02% EDTA (Invitrogen) at the ratio of 1:3 every passage. Cells from 3 to 5 passages were used in this study. The characteristics of the ADSCs have been identified in our previous studies [25].

Neuronal Differentiation Protocols

Protocol 1: Serum-free Induction

The procedures were modified from those of Hermann et al. [10]. First, ADSCs were dissociated with 0.05% trypsin/0.02% EDTA and were plated on low-attachment plastic tissue culture flasks at 1 × 105 cells/cm2 in neurosphere induction medium [Neurobasal medium (Gibco) supplemented with 92% N2, 20 ng/ml epidermal growth factor (EGF), fibroblast growth factor-2 (FGF-2; both from Sigma, St Louis, MO)]. After 5–7 days, sphere formation could be observed. These neurosphere-like structures were then expanded for 2–4 passages. The medium was changed once per week, and growth factors were added twice per week. Second, spheres were plated on poly-l-lysine-coated glass coverslips at 1.5–2.0 × 105 cells/cm2 in neural induction medium [Neurobasal medium supplemented with 1% N2 supplement, 10 ng/ml rh-BDNF (R&D Systems, Minneapolis, MN) and 1% penicillin/streptomycin (all from Invitrogen)].

Protocol 2: Chemical Induction

The procedures were adopted from Woodbury et al. [7]. ADSCs at 1 × 105 cells/cm2 were maintained in DMEM/10% FBS. Twenty-four hours prior to neuronal induction, the medium was replaced with preinduction medium consisting of DMEM, 20% FBS, and 1 mM β-mercaptoethanol (BME, Sigma). To initiate neuronal differentiation, the preinduction medium was removed, and the cells were washed with PBS and transferred to neuronal induction medium composed of DMEM, 2% dimethylsulfoxide (DMSO), and 200 mM butylated hydroxyanisole (BHA).

Protocol 3: Spontaneous Differentiation

The protocols were modified from Tseng et al. [15]. ADSCs at 1 × 105 cells/cm2 were cultivated with DMEM/F12 and 10% FBS. The culture medium was changed every 3 days, and the cultures were continually maintained for 6 weeks.

All protocols are summarized simply in Table 1. For Protocol 3, dADSCs were collected for analysis on weeks 1, 4, and 6 post-differentiation. After passage, differentiated dADSCs were maintained in DMEM/F12 + 10% FBS.
Table 1

Summarize the procedures of Protocol 1–3

Protocols

Author

Main agents

Steps

Feature

Protocol 1

Hermann et al. [10]

N2, EGF, FGF-2

rh-BDNF

2

Serum free condition and growth factors

Protocol 2

Woodbury et al. [7]

BME, DMSO, BHA

1

Chemical agents

Protocol 3

Tseng et al. [15]

No supplements

1

Spontaneous differentiation

Immunocytochemistry

The procedures for immunohistochemistry have been described in detail [26]. The primary antibodies used were mouse anti-fibronectin antibody (1:400; Chemicon), mouse anti-β-tubulin isotype III (1:800; Sigma), mouse anti-GFAP (1:200; Chemical), and mouse anti-MAP2ab (1:1,000; Chemicon). The secondary antibody was goat anti-mouse IgG CY3 (1:200; Sigma, F9887). The nuclei were double-stained by Hoechst33342 (2 μg/ml, Invitrogen). Samples were examined using a fluorescent microscope (Leica, Germany) and an IM50 imaging system. All immunocytochemical experiments were repeated twice in eight independent experiments.

TUNEL Assay

The cultures were fixed with 4% (v/v) paraformaldehyde for 15 min at room temperature and washed 3 times in Tris-buffered saline (TBS) buffer. They were then permeabilized in 1% Triton-X100 (v/v) with 0.1% sodium citrate for 15 min and washed 3 times in TBS buffer. The presence of apoptotic cells was assayed with the TUNEL label mix (Roche Applied Science, Belgium) following the manufacturer instructions.

Western Blot

Briefly, cells were washed in 1 M PBS and lysed in RIPA buffer (Roche). Protein concentrations were determined by the Bradford method. For electrophoresis, protein samples (50 μg each) were dissolved in sample buffer (60 mM Tris–HCl, pH 6.8, 14.4 mM β-mercaptoethanol, 25% glycerol, 2% SDS, 0.1% bromophenol blue), boiled for 5 min, and separated on 10% SDS–PAGE reducing gels. After transferring the proteins onto PVDF-membranes (Bio-Rad), the membranes were blocked in 5% non-fat dry milk/PBS for 1 h and, incubated with mouse anti-fibronectin antibody (1:500), mouse anti-MAP2ab antibody (1:400), mouse anti-β-tubulin III (1:200), or mouse anti-GFAP antibody (1:400) overnight at 4°C. Antibody binding was revealed by incubation with secondary antibody on the second day. Chemiluminescence was detected by exposure to X-ray film. All Western blot experiments were repeated at least three times. β-Actin served as an internal control.

Real-time RT-PCR

Total cellular RNA was extracted from undifferentiated ADSCs (uADSCs) and dADSCs (protocol 1–3) using an RNeasy total RNA purification kit, followed by treatment with RNase-free DNase (Qiagen, Hilden, Germany). Quantitative real-time one-step RT-PCR was performed with the LightCycler System (Roche, Mannheim, Germany), and amplification was monitored and analyzed by measuring the binding of the fluorescence dye Sybr green I to double-stranded DNA. One microliter of total RNA was reversely transcribed and subsequently amplified using the QuantiTect Sybr green RT-PCR Master mix (Qiagen) and 0.5 μmol/l of both sense and antisense primers. After amplification, melting curves of the RT-PCR products were acquired, demonstrating product specificity. The primers of each gene were: NGF, forward: CCAGCCTGCGGACATCAC, reverse: GGCTCCTCAATGGGCAGAT; BDNF, forward: CACTTTTGAGCACGTGATCGA, reverse: CGTTGGGCCGAACCTTCT; NT-3, forward: CATTCGGG GACACCAGGTC, reverse: TTTGCACTGAG AGTTCCAGTGTTT; NT-4, forward: CTCCATCTTCAGG TGTGCAA, reverse: CACTCAGGAGCCAGAAAAGG. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an endogenous control to normalize expression levels.

ELISA

The supernatants from cultured ADSCs and differentiated ADSCs (2 weeks after differentiation) were analyzed by ELISA to determine the concentration of BDNF, NGF, NT-3, and NT-4. ELISA kits from Chemicon were used according to the manufacturer’s specifications and analyzed in duplicate in eight independent experiments.

Statistical Analysis

Experiments were repeated in at least six independent experiments (with cells from six rats), and the mean value was used for statistical analysis. Results are presented as means ± standard error (SE). Significant differences were determined using one-way ANOVA by SPSS. A value of P < 0.05 was considered statistically significant.

Results

Morphological Changes During Differentiation

Different protocols produced different morphologies of dADSCs (Fig. 1a–d). Protocol 1 involves two steps: conversion of uADSCs into neurosphere-like structures (Fig. 1a), and terminal differentiation into neural-like cells. At 48 h following differentiation, the uADSCs changed from flat, elongated, and spindle-shaped to spherical with several branches and retractile characteristics (Fig. 1b). In Protocol 2, ADSC morphology changed quickly to neural-like, with most cells showing a typical neuronal shape within 4 h following exposure to DMSO and BHA (Fig. 1c). Cell bodies were pyramidal or spherical, with long processes. Without supplemental chemicals and cytokines in Protocol 3, ADSCs spontaneously transformed into neural-like cells, forming cellular aggregates with a rosette-like appearance after long-term culture (Fig. 1d).
https://static-content.springer.com/image/art%3A10.1007%2Fs11064-009-0101-y/MediaObjects/11064_2009_101_Fig1_HTML.gif
Fig. 1

ad Shows morphologies of differentiated ADSCs using Protocol 1–3. e Percentages of positive cells for neural markers using Protocol 1–3 at different times following differentiation. f Immunostaining of undifferentiated ADSCs and differentiated ADSCs with neural markers 1 week following differentiation. Nuclei are counterstained with Hochest33342 (blue). g Western blot analysis of neural markers. Scale bars in ac, e = 50 μm, d = 100 μm. For interpretation of the references to color in this figure legend, the reader is referred to the online version of this article

Expression of Neural Markers During Differentiation

To test the possible influences of culture time on neuroectodermal transdifferentiation protocols, we measured dADSC labeling with β-tubulin III, MAP2ab, and fibronectin after culture 1 and 4 weeks. Before differentiation, No cells were positive for neural and glia markers but the majority of uADSCs expressed fibronectin (96.5 ± 1.2%; Fig. 1e, f). Protocol 1 decreased fibronectin expression significantly at 1 week (5.3 ± 1.2%), but Protocol 2 (39.2 ± 4.2%) and Protocol 3 (56.2 ± 8.2%) still showed fibronectin expression. β-tubulin III and MAP2ab showed higher levels of expression after Protocol 1 and 2 than Protocol 3 (P < 0.001). Only Protocol 1 produced dADSCs (21.3 ± 3.4%) with GFAP immunoreactivity. After 4 weeks of differentiation, Protocol 2 caused dramatic cell death. Levels of β-tubulin III, MAP2ab, and fibronectin expression were similar to week 1 in Protocol 1. Interestingly, 37.2 ± 3.3% dADSCs were labeled for β-tubulin III and no cells expressed MAP2ab by Protocol 3.

To test the possible influences of passage number on neuroectodermal transdifferentiation protocols, we measured dADSC labeling with β-tubulin III, MAP2ab, and fibronectin after passage for 1 and 5 times. In Protocol 1, passage 1 showed similar levels of neural markers and fibronectin as 1-week cells. However, β-tubulin III (11.7 ± 4.9%) and MAP2ab (2.3 ± 1.0%) labeling decreased sharply following Protocol 2. Protocol 3 did not show any markers except β-tubulin III (23.1 ± 5.6%). For Protocol 1 after passage 5, the percentage of β-tubulin III-positive cells decreased slightly (43.7 ± 3.3%), but MAP2ab expression increased dramatically (22.4 ± 4.1%). In Protocol 2, no cells expressed neural markers and fibronectin levels decreased to undifferentiated values. For Protocol 3, most cells expressed fibronectin (83.2 ± 2.5%) and few cells expressed β-tubulin III (2.3 ± 1.1%). The expression of neural markers (51 kDa GFAP, 275 kDa MAP2, 50–54 kDa β-tubulin III, and 220 kDa Fibronectin) in differentiated dADSCs was confirmed through Western blot. All proteins were detected at the expected molecular weights (Fig. 1g).

Determination of Cell Viability

We next measured levels of apoptotic cells (Fig. 2a) and cell viability (Fig. 2b). Protocol 2 induced significantly more cell death than Protocol 1 or 3 at week 1 (P < 0.001) and 4 (P < 0.001) after differentiation. One passage in maintenance medium reduced cell death in for all Protocols, but particularly for Protocol 2, from 90–95 to ~20%.
https://static-content.springer.com/image/art%3A10.1007%2Fs11064-009-0101-y/MediaObjects/11064_2009_101_Fig2_HTML.gif
Fig. 2

a Cell apoptosis as detected by TUNEL assay. b Cell viability using Protocol 1–3 in different time points after differentiation. Scale bar = 100 μm

Expression of NTFs During Differentiation

We used real time PCR to detect mRNA levels of NTFs. We did not detect NT-3 and NT-4 after any protocol. Protocol 1 and 2 (acute induction) decreased mRNA levels of NGF and BDNF decreased early (1–3 days), with BDNF levels decreasing more sharply than NGF mRNA (Fig. 3a). mRNA levels of NGF and BDNF began to recover at 1 week, and at week 2 with Protocol 1, increased to higher levels than uADSCs. NTFs in Protocol 2 decreased gradually may result from cell death. Protocol 3 did not decrease NGF or BDNF levels at 1–3 days post-differentiation, and long-term culture increased them above uADSC at 6 weeks post-differentiation.
https://static-content.springer.com/image/art%3A10.1007%2Fs11064-009-0101-y/MediaObjects/11064_2009_101_Fig3_HTML.gif
Fig. 3

NGF and BDNF expression during differentiation. a Changes in BDNF and NGF mRNA levels were examined by performing real-time PCR. b BDNF and NGF protein levels in culture medium at 2 weeks post-differentiation were examined by ELISA. Bars show means ± SE values as percent of control (n = 8). * P < 0.05, ** P < 0.01, *** P < 0.001, compared with controls (uADSCs)

We also measured NGF, BDNF, NT-3, and NT-4 levels in culture supernatants using ELISA (Fig. 3b). In uADSCs, BDNF levels were 74.2 ± 8.1 pg/ml and NGF levels were 60.4 ± 5.9 pg/ml (Fig. 3). All 3 protocols decreased NGF and BDNF levels 2 weeks after neural differentiation (P < 0.001). However, Protocols 1 (NGF: 32.3 ± 4.2 pg/ml, P < 0.001; BDNF: 58.1 ± 8.3 pg/ml, P < 0.001) and 3 (NGF: 24.8 ± 4.8 pg/ml, P < 0.01; BDNF: 30.6 ± 4.3 pg/ml, P < 0.05) showed higher NTF levels than Protocol 2 (NGF: 3.3 ± 1.0 pg/ml, BDNF: 2.3 ± 0.7 pg/ml), and Protocol 1 produced higher BDNF levels than Protocol 3 (P < 0.05). NT-3 and NT-4 were not detected.

Discussion

Protocol 1 induces the most efficient neural differentiation of ADSCs for a number of reasons. First, Protocol 1 produced the highest percentage of mature, neural-like cells (MAP2ab+) induced from neurospheres which show similar morphology, phenotype, and gene expression as neural stem cells from the brain [27]. Neurospheres derived from MSCs from other origins also show self-renewal and multipotent differentiation [10], key features of neural stem cells. These stem cells may differentiate into mature neurons, as shown by bone marrow derived-cells that show electrophysiological characteristics and express outward-rectifying potassium channels and sodium channels [10]. Second, dADSCs with Protocol 1 retained neural-like morphology and expressed stable neural markers after being passaged 5 times, indicating stable neural-like changes. Protocol 2 produced the highest percentage of immature neural-like cells (β-tubulin III+), but only transiently, and Protocol 2 and 3 did not induce MAP2ab+ expression. Third, Protocol 2 and 3 caused significant cell death after long-term culture, as described for chemical inducers by other groups [2830]. Other cells, such as adult rat fibroblasts, can acquire neuronal morphology after BME and DMSO treatment, indicating changes in the cytoskeleton rather than transdifferentiation in Protocol 2 [30]. Although uADSCs can spontaneously differentiate into immature neural-like cells [15], they die quickly since they lack the basic nutrients essential for survival.

NTF such as NGF, BDNF, NT-3, and NT-4 promote the survival and development of specific neural populations. ADSCs and other MSCs secrete NTFs and could facilitate neural repair [3133], recruit supporting cells, or restore injured tissues [34]. After being grafted into the injured central nervous system, neural cells derived from MSCs might settle at the injury site directly and replace lost neurons [31, 35], and the secreted growth factors could provide a micro-environment to promote grafted cell survival. In the present study, the neural differentiation decreased the expression of NGF and BDNF at 96 h post induction, which may reduce the ability to repair neuronal damage [22, 32]. Thus, some author thought that undifferentiated MSCs may have better repair capabilities than differentiated cells [21, 22]. However, NGF and BDNF expression recovered at 1 week and surpassed control levels at 2 weeks following differentiation. Other neuro-regulatory factors expressed by ADSCs can also regulate neuronal survival and neurogenesis [36, 37], and these changes still need to be clarified. We therefore cannot determine whether dADSCs are better than uADSCs for treating neural injuries, as this comparison requires in vitro and in vivo studies to assess therapeutic effectiveness. Ischemic brain-conditioned medium increases the expression of NGF and BDNF [38], suggesting that environmental factors stimulate secretion of growth factors to regenerate injured sites. It seems that both differentiated and undifferentiated cells are stimulated to secrete the required amounts of growth factors for regeneration of injured sites [21, 22]. Considering the merit of replacing lost neurons, differentiated ADSCs may be more effective to heal neural injuries than undifferentiated cells.

Protocol 1 and 2 are acute induction protocols, and Protocol 3 is a chronic induction protocol. Acute and chronic induction produced different levels of NTFs during differentiation. Both NGF and BDNF expression decreased early in Protocol 1 and 2, consistent with recent reports [21, 22], but not in Protocol 3. The acute induction protocol may consume NGF and BDNF, whereas the chronic induction protocol may consume other growth or regulation factors. Regardless of the mechanism, the neural differentiation efficiencies of acute induction protocols are significantly higher than chronic induction protocols.

Acknowledgments

This work was supported by grants from the Natural Science Foundation of China (No. U0632008), Foundation for Key Sci-Tech Research Projects of Guangdong (No. 2008A030201019, 2007-05/06-7005206) and Guangzhou (No. 09B52120112, 2008A1-E4011-6), Foundation for Medical and Scientific Technology Research of Guangdong (No. A2009293).

Copyright information

© Springer Science+Business Media, LLC 2009